A TaLAC58 gene that can enhance wheat resistance to Fusarium head blight and its application

By introducing and overexpressing the TaLAC58 gene, the problem of insufficient resistance to wheat scab was solved, achieving high-efficiency disease resistance in wheat and ensuring food security.

CN118516379BActive Publication Date: 2026-07-03YANGZHOU UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
YANGZHOU UNIV
Filing Date
2024-05-23
Publication Date
2026-07-03

AI Technical Summary

Technical Problem

Current technologies lack sufficient resistance to wheat scab, leading to significant yield reductions and excessive toxin levels in grains, threatening food security.

Method used

By introducing and overexpressing the TaLAC58 gene, and using Agrobacterium-mediated stable genetic transformation, the TaLAC58 gene was introduced into recipient plants to improve wheat's resistance to Fusarium head blight.

Benefits of technology

It significantly improves wheat's resistance to Fusarium head blight, ensures high-quality and stable wheat yields, increases farmers' economic income, and guarantees food quality and safety.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118516379B_ABST
    Figure CN118516379B_ABST
Patent Text Reader

Abstract

This invention discloses a gene, TaLAC58, capable of enhancing wheat resistance to Fusarium head blight and its applications. The TaLAC58 gene belongs to the laccase family and is a gene specifically expressed in the resistant wheat variety Sumai 3. This gene was overexpressed using a constructed overexpression vector and introduced into the popular variety Fielder via Agrobacterium infection, resulting in stable transgenic plants. In the three transgenic lines obtained, resistance to Fusarium head blight was significantly enhanced. This invention has significant production implications for improving wheat resistance to Fusarium head blight and provides a new gene resource for breeding high-yielding, stable-yielding, and widely adaptable new wheat varieties.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically involving a TaLAC58 gene that can improve wheat resistance to Fusarium head blight and its application. Background Technology

[0002] Fusarium head blight (FBB) is a fungal disease caused by Fusarium graminearum invading the wheat ear. It causes ear wilt, shriveled grains, and the accumulation of large amounts of deoxynivalenol toxin in the grains, leading to significant yield reduction and excessive toxin levels in the grains, seriously threatening food security. Lacase (LAC) is a copper oxidase essential for lignin polymerization during the formation of plant secondary cell walls. Plant laccases increase cell wall strength by catalyzing the formation of polymeric lignin from lignin monomers, providing mechanical support, xylem sap transport, and protection against pests and pathogens. To date, the role of wheat laccases in FBB resistance mechanisms has been rarely reported. Summary of the Invention

[0003] The purpose of this section is to outline some aspects of embodiments of the present invention and to briefly describe some preferred embodiments. Simplifications or omissions may be made in this section, as well as in the abstract and title of this application, to avoid obscuring the purpose of these documents; however, such simplifications or omissions should not be construed as limiting the scope of the invention.

[0004] In view of the problems existing in the above and / or prior art, the present invention is proposed.

[0005] To solve the above-mentioned technical problems, the present invention provides the following technical solution: the TaLAC58 gene, characterized in that it includes the following (A1) or (A2):

[0006] (A1) A DNA molecule with the nucleotide sequence shown in SEQ ID No. 1.

[0007] (A2) The coding region is the DNA molecule shown in SEQ ID No. 1 from position A to position 1710.

[0008] Another object of the present invention is to overcome the shortcomings of the prior art and provide the TaLAC58 protein for translating the TaLAC58 gene of claim 1.

[0009] The protein is shown as any one of (B1) to (B4):

[0010] (B1) A protein with the amino acid sequence SEQ ID NO.2;

[0011] (B2) Proteins derived from SEQ ID NO.1 with the same function, having undergone substitution and / or deletion and / or addition of one or more amino acid residues as shown in SEQ ID NO. 2;

[0012] Proteins that have 99%, 95%, 90%, 85%, or 80% homology with any of the amino acid sequences defined in (B3) to (B1)-(B2) and have the same function;

[0013] (B4) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of any of the proteins defined in (B1)-(B3).

[0014] As a preferred embodiment of the TaLAC58 gene of the present invention, the TaLAC58 gene has a length of 1710 bp and the number of amino acids encoded in the TaLAC58 gene is 570 bp.

[0015] Another objective of this invention is to overcome the shortcomings of the prior art and provide a recombinant vector for the TaLAC58 gene.

[0016] The nucleotide sequence of the recombinant vector is shown in SEQ ID No. 3, obtained by inserting the nucleotide sequence of SEQ ID No. 1 between the restriction endonucleases SmaI and HindIII at the multiple cloning site of the pCambia3300 backbone vector.

[0017] Another objective of this invention is to overcome the shortcomings of the prior art and provide an application of overexpressing the TaLAC58 gene.

[0018] As a preferred embodiment of the TaLAC58 gene described in this invention, the method includes: overexpressing the TaLAC58 gene.

[0019] Overexpression of the TaLAC58 gene has been used to significantly improve wheat resistance to Fusarium head blight.

[0020] The final objective of this invention is to overcome the shortcomings of the prior art and provide a method for cultivating plant varieties that improve resistance to wheat scab.

[0021] A stable genetic transformation method mediated by Agrobacterium was used to introduce nucleic acid molecules capable of expressing TaLAC58 protein into recipient plants, resulting in transgenic plants; the transgenic plants exhibited higher resistance to Fusarium head blight than the recipient plants.

[0022] The recipient plant is a grass (Poaceae).

[0023] The introduction of nucleic acid molecules expressing the TaLAC58 protein into recipient plants is achieved by introducing a recombinant expression vector containing nucleic acid molecules capable of expressing the TaLAC58 protein into the recipient plants.

[0024] Beneficial effects of this invention:

[0025] This invention significantly improves wheat's resistance to Fusarium head blight by overexpressing the TaLAC58 gene. This can ensure high-quality and stable wheat yields and increase farmers' economic income in areas with high incidence of Fusarium head blight. Therefore, this invention is of great significance and has promising application prospects for ensuring the quality and safety of food. Attached Figure Description

[0026] To more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings used in the description of the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort. Wherein:

[0027] Figure 1 This is a comparison diagram of the nucleic acid sequences of Sumai 3 and TaLAC58 from China Spring in Example 1 of the present invention.

[0028] Figure 2 This is a diagram showing the expression and tissue-specific expression of TaLAC58 in resistant and susceptible varieties in Example 1 of this invention. Figure 2 A represents TaLAC58, which is specifically expressed in Sumai 3. Figure 2 B represents the expression pattern of TaLAC58 in different tissues of Sumai 3.

[0029] Figure 3 This is a simplified diagram of the carrier construction in Embodiment 1 of the present invention.

[0030] Figure 4 This is a diagram showing a positive transgenic identification in Example 1 of the present invention.

[0031] Figure 5 This is an expression detection diagram of the positive strain in Example 1 of the present invention.

[0032] Figure 6 This is a phenotypic diagram of the TaLAC58 overexpressing transgenic material in Example 1 of the present invention.

[0033] Figure 7 The above are the statistical results of the disease incidence rate of the TaLAC58 overexpressing transgenic material in Example 1 of this invention. Detailed Implementation

[0034] To make the above-mentioned objects, features and advantages of the present invention more apparent and understandable, the specific embodiments of the present invention will be described in detail below with reference to the examples in the specification.

[0035] Many specific details are set forth in the following description in order to provide a full understanding of the invention. However, the invention may also be practiced in other ways different from those described herein, and those skilled in the art can make similar extensions without departing from the spirit of the invention. Therefore, the invention is not limited to the specific embodiments disclosed below.

[0036] Secondly, the term "one embodiment" or "embodiment" as used herein refers to a specific feature, structure, or characteristic that may be included in at least one implementation of the present invention. The phrase "in one embodiment" appearing in different places in this specification does not necessarily refer to the same embodiment, nor is it a single or selective embodiment that is mutually exclusive with other embodiments.

[0037] Unless otherwise specified, all raw materials used in the embodiments of this invention are commercially available.

[0038] Using the genome of the wheat variety *Chinese Spring* as a reference, this gene is located on wheat chromosome 4B, but there are two allelic variations in the gene's nucleic acid sequence that can cause changes in amino acids (sequence alignment see...). Figure 1 This gene is specifically expressed in the Fusarium head blight resistant variety Sumai 3. Semi-quantitative analysis of different tissue samples from Sumai 3 revealed that TaLAC58 is expressed in the outer glume, inner glume, glumes, rachis, and stem of wheat. Figure 2 These tissues are all infected and spread by Fusarium graminearum. Therefore, we extracted RNA from Sumai 3 and reverse transcribed it to obtain cDNA. We then amplified the CDS sequence of TaLAC58 and performed vector construction, genetic transformation, and Fusarium head blight phenotype identification. The nucleotide sequence of the TaLAC58 gene is shown in SEQ ID NO:1 in the sequence listing, and its protein amino acid sequence is shown in SEQ ID NO:2. Example

[0039] (1) Wheat RNA extraction and reverse transcription:

[0040] RNA extraction:

[0041] ① Preparation: Sample, 2 mL / 1.5 mL enzyme-free centrifuge tubes, enzyme-free pipette tips, 75% alcohol (prepared using DEPC-treated water), isopropanol, and centrifuge pre-cooled at 4°C.

[0042] ② Pre-cool the mortar and pestle with liquid nitrogen, quickly transfer the sample into the mortar, grind it into powder, transfer an appropriate amount of powder into a 2 mL enzyme-free centrifuge tube, place the centrifuge tube on ice, add 1 mL of Trizol, place it on a shaker, shake it thoroughly for 30 seconds to allow it to fully lyse, add 400 µL of chloroform, shake it thoroughly on a shaker for 15 seconds, let it stand for 3 minutes, and then place it in a centrifuge at 4℃, 12000 rpm for 15 minutes.

[0043] ③ Pipette 400 µL of supernatant into a 1.5 mL enzyme-free centrifuge tube, add isopropanol at a 1:1 ratio, mix by inverting the tube 5-10 times, and then place it in a -20℃ freezer for 30 min to precipitate RNA. After precipitation, place it in a centrifuge and centrifuge at 4℃, 12000 rpm for 15 min.

[0044] ④ Remove the centrifuge tube, discard the supernatant, add 1 mL of 75% ethanol (prepared using DEPC-treated water) to wash the RNA precipitate, then place it in a centrifuge, set it to 4℃, 12000 rpm, centrifuge for 5 min, discard the supernatant, and after centrifuging for 10-20 s, use an enzyme-free pipette tip to remove the remaining ethanol.

[0045] ⑤ Place the centrifuge tubes in a clean bench and air dry for 15-20 minutes until transparent. Add preheated DEPC water at 70°C and dissolve for 5 minutes.

[0046] ⑥ Store the extracted RNA in a -80°C freezer.

[0047] cDNA was reverse transcribed using a reverse transcription kit (Novizan, Nanjing):

[0048] ①Removal of genomic DNA:

[0049] Table 1

[0050] Components Dosage Extracted RNA 5µL 4× gDNA wiper Mix 4 µL <![CDATA[RNase-free ddH2O]]> 7µL Total 16µL

[0051] PCR program: 42℃, 2 min.

[0052] ②Reverse transcription of cDNA:

[0053] Table 2

[0054] Components Dosage The above reaction products 16µL HiScript III qRT supermix 4 µL Total 20 µL

[0055] PCR program: 50 ℃ for 15 min; 85 ℃ for 2 min. Reverse transcription products are stored at -20 ℃.

[0056] (2) Real-time quantitative PCR and semi-quantitative PCR:

[0057] Primers designed based on the reference genome for quantification and semi-quantification are as follows:

[0058] The forward primer is: AATTGTTAGAGACCGGCCGTTG (SEQ ID NO: 4);

[0059] The reverse primer is: AGCAAGCAAAGCATCAATGGC (SEQ ID NO: 5);

[0060] Real-time quantitative PCR: Prepare a 10 µL quantitative PCR system as follows:

[0061] Table 3

[0062] Components Dosage 2×ChamQ Universal SYBR qPCR Master Mix 5 µL Forward primer (SEQ ID NO: 4) 0.25 µL Reverse primer (SEQ ID NO: 5) 0.25 µL cDNA 0.3 µL <![CDATA[ddH2O]]> 4.2 µL Total 10 µL

[0063] PCR program: Pre-denaturation: 95 ℃ for 30 s; Cyclic reaction: 95 ℃ for 5 s, 60 ℃ for 34 s, 40 cycles; Melting curve: 95 ℃ for 15 s, 60 ℃ for 60 s, 95 ℃ for 15 s.

[0064] Semi-quantitative PCR: Prepare a 10 µL quantitative PCR system as follows:

[0065] Table 4

[0066] Components Dosage 2×Taq Mix 5µL Forward primer (SEQ ID NO: 4) 0.25µL Reverse primer (SEQ ID NO: 5) 0.25µL DNA 0.5µL <![CDATA[ddH2O]]> 4µL Total 10µL

[0067] PCR program: Pre-denaturation: 95℃ for 30 s; Cyclic reaction: 95℃ for 30 s, 58℃ for 30 s, 72℃ for 30 s, 30 cycles; Post-extension: 72℃ for 5 min. After semi-quantitative analysis, product size was determined using 2% agarose gel electrophoresis.

[0068] (3) Construction of transgenic vectors:

[0069] Primers for constructing transgenic overexpression vectors were designed using Primer Premier 5 primer design software. The primer sequences are as follows: forward primer: TCCCCGGGATGGGGGCACACCGCCT (SEQ ID NO: 6) and reverse primer: CCCAAGCTTACAGACGGGTAGATCGGACGG (SEQ ID NO: 7). The primers were synthesized by Nanjing GenScript Biotech Co., Ltd.

[0070] The TaLAC58 CDS sequence was amplified using SM cDNA as a template. The reaction system is as follows:

[0071] Table 5

[0072] Components Dosage 2×KOD Buffer 25 µL dNTP 4µL KOD enzyme 0.5µL Forward primer (SEQ ID NO: 6) 1.5µL Reverse primer (SEQ ID NO: 7) 1.5µL template 4µL <![CDATA[ddH2O]]> 13.5µL Total 50µL

[0073] PCR program: 94℃ for 3 min; 94℃ for 30 s, 58℃ for 30 s, 68℃ for 4 min, 30 cycles; 68℃ for 10 min; product stored at 4℃.

[0074] Agarose gel purification of PCR products:

[0075] ① Prepare a 2% agarose gel using TAE electrophoresis buffer, adding 1% (v / v) of 0.5 mg / mL EB during gel preparation;

[0076] ② Add 5 µL of 10× loading buffer to the PCR product, load all samples into the gel wells, spot Trans2k DNA Marker in the empty wells, and electrophoresis at 130 V for 15 min.

[0077] ③ Under ultraviolet light (Bio-RAD), cut off the gel block with a clean blade (the size of the band matches the size of the target fragment) and place it into a 2.0 mL centrifuge tube;

[0078] ④ Recover the target fragment according to the instructions of the gel recovery kit (Sangon Biotech, China).

[0079] Ligation cloning vector pEASY-Blunt3:

[0080] Preparation system:

[0081] Table 6

[0082] Components Dosage Recycle fragments 4µL pEasy-Blunt3 1µL Total 5µL

[0083] PCR program: 25℃ for 30 min

[0084] The ligation product was transformed into competent E. coli cells:

[0085] ① Take out the Fast-T1 competent cell suspension and thaw it on ice. Then, take 50 µL of competent cells and mix them with all the products from the previous step. Mix well and place on ice for 30 min.

[0086] ② Place it in a metal bath for heat shock at 42℃ for 1 min 30 s. After heat shock, immediately place it in an ice bath for 3-5 min. Then add 1 mL of LB liquid culture medium, mix well by pipetting, place it in a shaker, set it to 37℃ and 150 rpm, and incubate for 1 h.

[0087] ③ After the culture is completed, put it in a centrifuge at 5000 rpm for 5 min, discard the supernatant, and then use a pipette to gently mix the precipitate with the remaining liquid culture medium in the tube. Spread it on LB solid medium with Amp resistance. After there are no obvious water stains on the plate, seal the plate with sealing film, invert the plate and put it in a 37℃ incubator overnight.

[0088] ④ On the second day, 10 bacterial spots were randomly selected from LB solid medium and PCR was performed to detect positive strains;

[0089] The PCR reaction system is as follows:

[0090] Table 7

[0091] Components Dosage Monoclonal spots 2×Taq Master Mix 5 µL Forward primer (SEQ ID NO: 4) 0.25 µL Reverse primer (SEQ ID NO: 5) 0.25 µL <![CDATA[ddH2O]]> 4 µL

[0092] PCR program: 95℃, 3 min; 95℃, 30 s, 58℃, 30 s, 72℃, 2 min, 28 cycles; 72℃, 5 min;

[0093] ⑤ Identification using 2% agarose gel. Observe under UV light using a gel imaging system (Bio-RAD), select positive clones and place them in LB liquid medium (containing ampicillin), then incubate overnight at 37°C with a shaker at 180 rpm.

[0094] ⑥ After shaking culture of the identified positive strains, the bacterial culture was sent to Genewiz for sequencing (Suzhou, China).

[0095] ⑦ Comparison and analysis of sequencing results: DNAMAN software is used to compare and verify the sequencing results with the target sequence.

[0096] Select strains with correct sequencing results and extract plasmids according to the instructions of the plasmid DNA mini-extraction kit (China, Sangon Biotech) for enzyme digestion.

[0097] Prepare a 50µL enzyme digestion reaction system with the following components:

[0098] Table 8

[0099] Components Dosage SmaI 1µL HindIII 1 µL 10×QCut Buffer 2.5 µL <![CDATA[ddH2O]]> 35.5 µL vector plasmid 10 µL Total 50 µL

[0100] PCR program: 37℃ for 2 hours

[0101] The PCR products were purified by agarose gel extraction and the target fragment was recovered according to the instructions of the gel extraction kit (Sangon Biotech, China).

[0102] Connecting to the pCambia3300 vector:

[0103] Prepare a 10 µL connection system with the following components:

[0104] Table 9

[0105] Components Dosage 10×T4 Buffer 1 µL T4 Ligase 1 µL Target gene 6 µL Target carrier 3 µL Total 10 µL

[0106] The PCR program was 25°C for 2 hours.

[0107] The ligation product was transformed into *E. coli* Fast-T1 competent cells. After overnight plating, 20 single-clone spots from each plate were selected for PCR to detect positive strains. Plasmids were extracted from the positive strains and transformed into *Agrobacterium* EHA105 for the creation of transgenic materials. A simplified diagram of the constructed vector is shown below. Figure 3 As shown in SEQ ID NO:3, the nucleotide sequence of the recombinant vector is shown in SEQ ID NO:3, where CaMV35S represents the tobacco mosaic virus 35S strong promoter, and the BAR gene can confer herbicide resistance to plants.

[0108] (4) Genetic transformation: The creation of transgenic materials was completed by Tianjin Genov Biotechnology Co., Ltd.

[0109] (5) Positive identification of transgenic organisms:

[0110] DNA level identification:

[0111] Extraction of DNA from genetically modified wheat:

[0112] ① Grind wheat leaves in a mortar with liquid nitrogen, and transfer the thoroughly ground powder to a 1.5 mL centrifuge tube; add 650 mL of CTAB extraction solution (100 mM, Tris-HCl (pH 8.0), 4 mol / L NaCl, 20 mmol / L EDTA (pH 8.0), 2% CTAB, and add 2 mL / 100 mL β-mercaptoethanol before use), and mix well;

[0113] ② Incubate in a 65℃ water bath for 30 minutes, with gentle shaking a few times in between;

[0114] ③ Place on ice for 5 minutes;

[0115] ④ Add 400 μL of chloroform and mix gently;

[0116] ⑤ Let stand at room temperature for 10 min, then centrifuge at 12000 rpm for 15 min and collect the supernatant;

[0117] ⑥ Add 2 volumes of ice-cold ethanol, mix well, and let stand at -20℃ for 30 min;

[0118] ⑦ Centrifuge and discard the supernatant;

[0119] ⑧ Rinse twice with 1 mL of 70% ethanol and air dry;

[0120] ⑨ Dissolve in 100 μL of sterile water for later use.

[0121] BAR gene detection: The primers for BAR gene detection are as follows:

[0122] Forward primer: CTACATCGAGACAAGCACGGTCAA (SEQ ID NO: 8)

[0123] Reverse primer: AGAAAACCCACGTCATGCCAGTTC (SEQ ID NO: 9)

[0124] The following PCR procedure was used for detection. The PCR reaction system is as follows:

[0125] Table 10

[0126] Components Dosage Monoclonal spots 2×Taq Master Mix 5 µL Forward primer (SEQ ID NO: 8) 0.25 µL Reverse primer (SEQ ID NO: 9) 0.25 µL <![CDATA[ddH2O]]> 4 µL

[0127] PCR program: 95℃, 3 min; 95℃, 30 s, 58℃, 30 s, 72℃, 30 s, 35 cycles; 72℃, 5 min;

[0128] The PCR products were identified using a 2% agarose gel electrophoresis, and the results are shown in Figure 4. The gene detected was the BAR gene. 1#, 2#, and 3# represent three transforming lines.

[0129] The results of the expression level assessment are shown in Figure 5.

[0130] Phenotypic analysis of Fusarium head blight:

[0131] Experimental strains and preparation of bacterial culture:

[0132] The Fusarium graminearum strain used in this experiment was the sequenced strain PH-1, provided by Dr. Li Bing of Zhengzhou University. The strain and bacterial culture preparation steps are as follows:

[0133] ① Activate the strain on PDA solid medium and place the medium in a constant temperature incubator at 25℃ for 5 days to ensure the growth and reproduction of the strain.

[0134] ② After the culture is completed, use a sterile punch to take 4 bacterial blocks from the culture medium, transfer the obtained bacterial blocks to 50mL of mung bean soup liquid culture medium, set the shaking temperature and speed to 25℃ and 150 r / min respectively, and culture for 3-5 days.

[0135] ③ After cultivation, take 1 µL of spore solution and drop it onto a hemocytometer. Observe and count the spores using a microscope to determine the spore concentration. When the spore concentration reaches 1×10⁵ spores / mL, the spore solution can be used for inoculation experiments.

[0136] Fusarium head blight inoculation and phenotypic identification:

[0137] During the wheat flowering stage, the bacterial solution was injected using the double-floret drip method between the inner and outer glumes of the bilateral florets of the fifth spikelet. A label indicating the inoculation date was affixed to the rachis of the inoculated spikelet. Fusarium head blight identification was performed 14 days after inoculation. The diseased spikelet rate was calculated as: Diseased spikelet rate = Diseased spikelets / Total number of spikelets. Phenotypic identification and statistical results are as follows: Figure 6 , 7 As shown. Figure 6 Fielder is the transgenic recipient variety, EV represents the negative line in the transformation process, and 1#, 2#, and 3# represent three transforming lines. The scale bar is 2cm. The upper and lower parts of the image are front and side views of the same ear, respectively. Figure 7 In this context, "PSS" represents the percentage of symptom spikelets. Each transgenic line was inoculated with at least 7 spikelets for statistical phenotype analysis. The Student-t test was used for statistical analysis, with ns representing p>0.05 and *** representing p<0.001. Overexpression of the TaLAC58 gene reduced the symptom spikelet percentage of Fusarium head blight from 60% to approximately 10%.

[0138] Figure 1 This is a comparison diagram of the nucleic acid sequences of Sumai 3 and TaLAC58 from China Spring. In the diagram, SM represents Sumai 3, CS represents China Spring, and the blue arrows indicate amino acid mutation sites. Figure 2 The expression and tissue-specific expression of TaLAC58 in resistant and susceptible varieties are shown. "CSM" represents the control sample of Chinese Spring, "CSI" represents the inoculated sample of Chinese Spring, "SMM" represents the control sample of Sumai 3, and "SMI" represents the inoculated sample of Sumai 3. "TaACTIN" is the internal reference gene. Figure 2 B represents the expression pattern of TaLAC58 in different tissues of Sumai 3. "Lemma" represents the outer glume, "Palea" represents the inner glume, "Glume" represents the glumes, "Rachis" represents the rachis, "Overy" represents the ovary, "Seed" represents the seed, "Flower" represents the flower, "Stem" represents the stem, and "Leaf" represents the leaf. Figure 5 This is for the expression detection of positive lines, where Fielder is the transgenic recipient variety, EV represents the negative line in the transformation process, and 1#, 2# and 3# represent three transforming lines respectively.

[0139] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all such modifications or substitutions should be covered within the scope of the present invention.

Claims

1. Application of overexpression of TaLAC58 gene in greatly improving the resistance of wheat to scab, characterized in that: Including the following (A1) or (A2): (A1) The nucleotide sequence is the DNA molecule shown in SEQ ID No.

1. (A2) The coding region is the DNA molecule shown in SEQ ID No. 1 from position A to position 1710; The TaLAC58 protein of the TaLAC58 gene has the amino acid sequence SEQ ID NO. 2; The nucleotide sequence of the recombinant vector of the TaLAC58 gene is shown in SEQ ID No. 3, which is obtained by inserting the nucleotide sequence of SEQ ID No. 1 between the restriction endonucleases SmaI and HindIII at the multiple cloning site of the pCambia3300 backbone vector. The TaLAC58 gene is expressed in the outer glume, inner glume, glumes, rachis, and stem of wheat.