Promoter for controlling maize kernel dehydration, ethylene signal pathway gene and application thereof
By identifying and utilizing the ethylene signaling pathway genes ZmEIL1 and ZmEIL3 controlled by the maize gene ZmRPG, and combining them with gene editing technology, the problem of controlling maize kernel moisture content and dehydration rate was solved, achieving efficient kernel variety improvement and enhancing harvest quality and economic benefits.
Patent Information
- Application Number
- CN202410534587.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2024-01-25
- Filing Date
- 2024-04-30
- Publication Date
- 2026-03-24
- Estimated Expiration
- 2044-04-30
AI Technical Summary
Existing technologies are insufficient to effectively control the moisture content and dehydration rate of corn kernels, which affects the quality of mechanical harvesting, safe storage, and economic benefits. Furthermore, different harvesting purposes have different requirements for kernel moisture content.
By identifying and utilizing the ethylene signaling pathway genes ZmEIL1 and ZmEIL3 controlled by the maize gene ZmRPG, as well as their corresponding promoters, gene editing technology was used to regulate the water content and dehydration rate of maize kernels, including gene editing target sequences and RNA interference methods.
It has enabled precise control of the moisture content of corn kernels, and has bred new corn varieties with different dehydration rates to meet the needs of different harvesting purposes, thereby improving harvesting quality and economic benefits.
Smart Images

Figure CN118531044B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to promoters for controlling dehydration of maize kernels, genes involved in the ethylene signaling pathway, and their applications, and belongs to the field of molecular genetics. Background Technology
[0002] Grain moisture content is a key factor affecting the quality of mechanized corn harvesting, safe storage, and economic benefits. The moisture content of the grains at harvest has a significant impact on corn harvesting, drying, storage, transportation, and processing. Excessive moisture content often causes economic losses for corn growers and operators, reduces economic benefits, and easily leads to grain mold, affecting corn quality. In addition, mechanized grain harvesting has become one of the main factors limiting corn production in my country, and the most critical link in mechanized corn grain harvesting is that the moisture content of corn grains at harvest cannot reach the standard moisture content of ≤25% for mechanized grain harvesting (Wang Z, Wang X, Zhang L, Liu X, Di H, Li T, Jin X. QTL underlying field grain drying rate after physiological maturity in maize (Zea Mays L.) [J]. Euphaitica, 2012, 185(3): 521-528.). Therefore, the breeding of corn varieties with low grain moisture content at harvest is very important. In addition, low grain moisture content can shorten the growth cycle of corn, which is of great significance for pre-frost harvesting in high-latitude regions of my country and for not affecting wheat planting in the Huang-Huai-Hai region.
[0003] On the other hand, the appropriate harvest moisture content varies depending on the harvesting purpose. For example, corn kernels intended for silage require a high moisture content during harvest, generally controlled above 30%; while for fresh corn, to maintain better taste and nutritional value, the moisture content can be as high as 75%. Therefore, QTLs or functional genes that can control the moisture content and dehydration rate of corn kernels have significant industrial value. Summary of the Invention
[0004] To address the aforementioned issues, the inventors previously identified a gene, ZmRPG, in maize that influences the rate of kernel dehydration. This invention further provides the ethylene signaling pathway genes ZmEIL1 and ZmEIL3, which are controlled by ZmRPG, and discloses three promoters highly expressed in the kernels. These genes and promoters can be used to breed new maize varieties with rapid kernel dehydration.
[0005] To achieve the above objectives, the present invention adopts the following technical solution:
[0006] This invention provides the application of a maize gene in improving the moisture content or dehydration rate of maize kernels, characterized in that the LOC number of the maize gene in the B73 reference genome is Zm00001d047563 or Zm00001d028974.
[0007] In some implementations, the nucleotide sequence of the maize gene described above is shown in SEQ ID NO.3 or SEQ ID NO.4.
[0008] The present invention also provides a method for reducing the moisture content of corn kernels or increasing the dehydration rate, characterized in that: corn kernels are treated with ethylene in the later stage of corn kernel development.
[0009] The present invention also provides a method for increasing the moisture content of corn kernels or reducing the dehydration rate, characterized in that: the above-mentioned genes in corn are inhibited, and plants with increased corn kernel moisture content or reduced dehydration rate are selected;
[0010] In some implementations, the target sequence for gene editing is as follows:
[0011] Any one of the following is shown: TCGCCTGGTTCGCCAGTCCA, CGCCAGTGACTACAGCTACGG, GAGCTGCAGGACACCACACT, and CCCTACAAGAAGCCCCATGA.
[0012] In some implementations, the methods for inhibiting gene expression and / or activity include gene editing or RNA interference.
[0013] This invention also provides a kit for increasing the moisture content of corn kernels or reducing the dehydration rate, characterized in that it comprises Cas9 protein and any one of the following RNA molecules:
[0014] (1) An RNA molecule capable of recognizing the above target sequence; optionally, the sequence of the RNA molecule is shown in any one of SEQ ID NO. 5 to 8;
[0015] (2) The DNA molecule encoding the RNA described in (1);
[0016] (3) Vectors that express the RNA described in (1).
[0017] The present invention also provides a mutant gene, characterized in that: the nucleic acid sequence of the mutant gene is shown in any one of SEQ ID NO. 9 to SEQ ID NO. 13.
[0018] The present invention also provides a promoter, characterized in that the nucleotide sequence of the promoter is shown in any one of SEQ ID NO. 14 to SEQ ID NO. 16:
[0019] The present invention also provides an expression box, characterized in that the expression box contains the promoter as described in claim 6.
[0020] The present invention also provides an expression vector, characterized in that the expression vector contains the expression cassette as described in claim 7.
[0021] The present invention also provides a host cell, characterized in that the host cell contains the expression vector as described in claim 8;
[0022] In some implementations, the host cell is a prokaryotic cell or a non-renewable plant cell.
[0023] In some implementations, the aforementioned prokaryotic cells are Escherichia coli or Agrobacterium cells.
[0024] The present invention also provides the application of the above-mentioned method, kit, mutant gene, promoter, expression cassette, expression vector, and host cell in improving the water content or dehydration rate traits of maize kernels.
[0025] Compared with the prior art, the beneficial effects of the present invention are: the ZmEIL1 and ZmEIL3 genes and the three promoters provided by the present invention can all be used to improve the dehydration trait of maize and to cultivate new maize varieties with different grain dehydration rates. Attached Figure Description
[0026] Figure 1 microRPG1 peptides inhibit the expression of the EIL gene. A: ZmEIL1 expression increases in knockout lines and decreases in overexpression lines. ORF1-KO represents microRPG1 knockout, and ORF1-OE represents microRPG1 overexpression. B: ZmEIL3 expression increases in knockout lines and decreases in overexpression lines. ORF1-KO represents microRPG1 knockout, and ORF1-OE represents microRPG1 overexpression.
[0027] Figure 2The dehydration rate was slowed by knocking out ZmEIL1 and ZmEIL3. A: ZmEIL1, KO1, and KO2 represent different knockout lines; B: ZmEIL3, KO1, KO2, and KO3 represent different knockout lines. WT: recipient control; n: number of samples. Grain moisture content was measured using the AUDDC (Moisture Content Change Index); the evaluation method was based on: Yang J, Carena M and Uphaus J. Area under the dry down curve (AUDDC): a method to evaluate rate of dry down inmaize[J]. Crop Sci., 2010, 50(6): 2347-2354.)
[0028] Figure 3 Moisture content of grains in ethylene-treated materials. A: F1 of ethylene-treated SK and KN5585; B: F1 of ethylene-treated SK and Zheng58; C: KN5585 ethylene-treated. Pre-tre: before treatment; Post-tre: after treatment; Control: equal water treatment; Ethylene: ethylene treatment; NS.: no significant difference; *number: degree of significance.
[0029] Figure 4 PCR was used to verify the expression of the ZmRPG gene in grains. *: P < 0.05, NS: no significant difference. Figure 5 Dry weight, fresh weight, and moisture content of grains in near-isogenic lines (NIL). MC: moisture content; FW: fresh weight; DW: dry weight.
[0030] Figure 6 Expression of ZmRPG, ZmEIL1, and ZmEIL3 genes in different tissues at different developmental stages of maize. The expression levels of ZmRPG, ZmEIL1, and ZmEIL3 genes are shown from top to bottom. The horizontal axis represents different tissues, and the vertical axis represents the expression level. Detailed Implementation
[0031] The following definitions and methods are provided to better define this application and to guide those skilled in the art in its practice. Unless otherwise stated, the terms are to be understood in accordance with their conventional usage by those skilled in the art. All patent literature, academic papers, industry standards, and other publicly available publications cited herein are incorporated herein by reference in their entirety.
[0032] As used herein, “maize” means any maize plant and includes all plant varieties that can be bred with maize, including the whole plant, plant cells, plant organs, plant protoplasts, plant cell tissue cultures from which the plant can regenerate, plant callus, and complete plant cells in a plant or plant part, such as embryo, pollen, ovule, seed, leaf, flower, branch, fruit, stem, root, root tip, anther, etc. Unless otherwise indicated, nucleic acids are written from left to right in a 5' to 3' direction; amino acid sequences are written from left to right in the amino to carboxyl direction. Amino acids may be represented herein by their commonly known three-letter symbols or by the single-letter symbols recommended by the IUPAC-IUB Committee on Biochemistry Nomenclature. Similarly, nucleotides may be represented by commonly accepted single-letter codes. Numerical ranges include numbers that define the range. As used herein, “nucleic acid” includes deoxyribonucleotides or ribonucleotide polymers in single-stranded or double-stranded form, and, unless otherwise limited, includes known analogs (e.g., peptide nucleic acids) that have the basic properties of natural nucleotides and hybridize with single-stranded nucleic acids in a manner similar to that of naturally occurring nucleotides. As used herein, the term “encoding” or “encoded” in the context of a particular nucleic acid means that the nucleic acid contains the essential information to guide the translation of that nucleotide sequence into a particular protein. Codons are used to represent the information encoding the protein. As used herein, “full-length sequence” referring to a particular polynucleotide or the protein it encodes means the entire nucleic acid sequence or the entire amino acid sequence having a natural (non-synthetic) endogenous sequence. Full-length polynucleotides encode the full-length, catalytically active form of that particular protein. The terms “polypeptide,” “polypeptide,” and “protein” are used interchangeably herein to refer to polymers of amino acid residues. This term is used for amino acid polymers in which one or more amino acid residues are artificial chemical analogs of the corresponding naturally occurring amino acids. This term is also used for naturally occurring amino acid polymers. The terms “residue” or “amino acid residue” or “amino acid” are used interchangeably in this document to refer to an amino acid incorporated into a protein, polypeptide, or peptide (collectively, “protein”). Amino acids can be naturally occurring amino acids, and unless otherwise limited, may include known analogs of naturally occurring amino acids that can function in a similar manner to naturally occurring amino acids.
[0033] The term "trait" refers to the physiological, morphological, biochemical, or physical characteristics of a plant or a particular plant material or cell. In some cases, this trait is visible to the human eye, such as seed or plant size, or can be measured by biochemical techniques, such as detecting the protein, starch, or oil content of seeds or leaves, or by observing metabolic or physiological processes, such as by measuring tolerance to water deprivation or specific salt, sugar, or nitrogen concentrations, or by observing the expression levels of one or more genes, or by agronomic observations such as tolerance to osmotic stress or yield.
[0034] "Plant" includes indexes for whole plants, plant organs, plant tissues, seeds, and plant cells, as well as their offspring. Plant cells include, but are not limited to, cells from seeds, suspension cultures, plumules, meristematic regions, callus, leaves, roots, seedlings, gametophytes, sporophytes, pollen, and microspores. "Offspring" includes any subsequent generations of a plant.
[0035] In this application, the terms "comprising," "including," or variations thereof should be understood to include other elements, numbers, or steps besides those described. "Test plant" or "test plant cell" refers to a plant or plant cell in which genetic modification has taken effect, or a progeny cell of such a modified plant or cell containing the modification. "Control," "control plant," or "control plant cell" provides a reference point for measuring phenotypic changes in the test plant or plant cell.
[0036] Negative or control plants may include, for example: (a) wild-type plants or cells, i.e., plants or cells with the same genotype as the genetic modification starting material, the genetic modification producing the test plants or cells; (b) plants or plant cells with the same genotype as the starting material but transformed with an empty construct (i.e., a construct with no known effect on the target trait, such as a construct containing the target gene); (c) plants or plant cells that are non-transformed isomers of the test plants or plant cells; (d) plants or plant cells that are genetically identical to the test plants or plant cells but not exposed to conditions or stimuli that would induce the expression of the target gene; or (e) the test plants or plant cells themselves, which are under conditions where the target gene is not expressed.
[0037] Those skilled in the art will readily recognize that advances in molecular biology, such as site-specific and random mutagenesis, polymerase chain reaction methods, and protein engineering techniques, have provided a wide range of appropriate tools and procedures for modifying or engineering the amino acid sequences and potential gene sequences of proteins of interest in agriculture.
[0038] In some embodiments, the nucleotide sequence of this application may be modified to perform conserved amino acid substitutions. Principles and examples of conserved amino acid substitutions are further described below. In some embodiments, the nucleotide sequence of this application may be substituted without altering the amino acid sequence according to disclosed monocotyledonous codon preferences; for example, a codon encoding the same amino acid sequence may be substituted with a codon preferred by monocotyledons without changing the amino acid sequence encoded by the nucleotide sequence. In some embodiments, a portion of the nucleotide sequence in this application may be substituted with a different codon encoding the same amino acid sequence, thereby changing the nucleotide sequence without altering the encoded amino acid sequence. Conserved variants include those sequences that encode an amino acid sequence of one of the proteins of the embodiments due to genetic codon degeneracy. In some embodiments, a portion of the nucleotide sequence in this application may be substituted according to a codon preferred by monocotyledons. Those skilled in the art will recognize that amino acid additions and / or substitutions are generally based on the relative similarity of amino acid side-chain substituents, such as the hydrophobicity, charge, size, etc., of the substituents. Exemplary amino acid substituents having the various properties considered above are well known to those skilled in the art and include arginine and lysine; glutamic acid and aspartic acid; serine and threonine; glutamine and asparagine; and valine, leucine, and isoleucine. Guidance on appropriate amino acid substitutions that do not affect the biological activity of the target protein can be found in the model of Dayhoff et al. (1978) Atlas of Protein Sequence and Structure (Natl. Biomed. Res. Found., Washington, DC) (incorporated herein by reference). Conserved substitutions, such as replacing one amino acid with another amino acid having similar properties, can be performed. Sequence identity verification includes hybridization techniques. For example, a known nucleotide sequence, in whole or in part, can be used as a probe for selective hybridization with other corresponding nucleotide sequences present in cloned genomic DNA fragments or cDNA fragment groups (i.e., genomic libraries or cDNA libraries) from a selected organism. The hybridization probe may be a genomic DNA fragment, cDNA fragment, RNA fragment, or other oligonucleotide, and may be labeled with a detectable group such as 32P or other detectable markers. Thus, for example, hybridization probes can be prepared by labeling synthetic oligonucleotides based on sequences from the embodiment. Methods for preparing hybridization probes and constructing cDNA and genomic libraries are generally known in the art. Hybridization of the sequences can be performed under stringent conditions. As used herein, the terms "stringent conditions" or "stringent hybridization conditions" refer to conditions under which the probe will hybridize with its target sequence to a detectable extent (e.g., at least 2, 5, or 10 times the background) relative to hybridization with other sequences.Harsh conditions are sequence-dependent and vary across different environments. By controlling hybridization harshness and / or washing conditions, target sequences 100% complementary to the probe can be identified (homologous probe method). Alternatively, harsh conditions can be adjusted to allow for some sequence mismatches in order to detect lower similarities (heterologous probe method). Typically, probe lengths are less than about 1000 or 500 nucleotides. Typically, harsh conditions are those where the salt concentration is less than about 1.5 M Na ions at pH 7.0 to 8.3, typically about 0.01 M to 1.0 M Na ion concentration (or other salts), and the temperature conditions are: at least about 30 °C for short probes (e.g., 10 to 50 nucleotides) and at least about 60 °C for long probes (e.g., greater than 50 nucleotides). Harsh conditions can also be achieved by adding a destabilizing agent such as formamide. Exemplary low-threshold conditions include hybridization at 37°C using 30% to 35% formamide buffer, 1M NaCl, and 1% SDS (sodium dodecyl sulfate), followed by washing at 50°C to 55°C in 1× to 2× SSC (20× SSC = 3.0M NaCl / 0.3M trisodium citrate). Exemplary medium-threshold conditions include hybridization at 37°C using 40% to 45% formamide, 1.0M NaCl, and 1% SDS, followed by washing at 55°C to 60°C in 0.5× to 1× SSC. Exemplary high-threshold conditions include hybridization at 37°C using 50% formamide, 1M NaCl, and 1% SDS, followed by a final wash at 60°C to 65°C in 0.1× SSC for at least about 20 minutes. Optionally, the wash buffer may contain about 0.1% to about 1% SDS. Hybridization duration is typically less than about 24 hours, typically from about 4 hours to about 12 hours. Specificity typically depends on post-hybridization washing, with key factors being the ionic strength and temperature of the final washing solution. The Tm (thermodynamic melting point) of DNA-DNA hybrids can be approximated by the formula from Meinkoth and Wahl (1984) Anal. Biochem. 138:267-284: Tm = 81.5℃ + 16.6 (logM) + 0.41 (%GC) - 0.61 (%formamide) - 500 / L; where M is the molar concentration of monovalent cations, %GC is the percentage of guanosine and cytosine nucleotides in the DNA, "formamide%" is the percentage of formamide in the hybridization solution, and L is the base pair length of the hybrid. Tm is the temperature at which 50% of the complementary target sequence hybridizes with a perfectly matched probe (at a given ionic strength and pH). Washing is typically performed at least until equilibration is reached and a low hybridization background level is achieved, such as for 2 hours, 1 hour, or 30 minutes. Each 1% mispairing should lower Tm by approximately 1°C; therefore, Tm, hybridization, and / or washing conditions can be adjusted to hybridize with the desired sequence of homology. For example, if a sequence with ≥90% homology is required, Tm can be lowered by 10°C.Typically, the stringency conditions are selected to be approximately 5°C lower than the Tm of the specific sequence and its complementary sequence at the defined ionic strength and pH. However, under very stringent conditions, hybridization and / or washing can be performed at 4°C lower than the Tm; under moderately stringent conditions, hybridization and / or washing can be performed at 6°C lower than the Tm; and under low stringency conditions, hybridization and / or washing can be performed at 11°C lower than the Tm.
[0039] In some embodiments, a fragment of a nucleotide sequence and the amino acid sequence it encodes is also included. As used herein, the term "fragment" refers to a portion of the nucleotide sequence of a polynucleotide of an embodiment or a portion of the amino acid sequence of a polypeptide. A fragment of the nucleotide sequence may encode a protein fragment that retains the biological activity of the native or corresponding full-length protein and thus has protein activity. Mutant proteins include biologically active fragments of native proteins containing consecutive amino acid residues that retain the biological activity of the native protein. Some embodiments also include transformed plant cells or transgenic plants containing a nucleotide sequence of at least one embodiment. In some embodiments, plants are transformed using an expression vector containing a nucleotide sequence of at least one embodiment and a promoter operatively linked thereto that drives expression in plant cells. Transformed plant cells and transgenic plants represent plant cells or plants whose genome contains a heteropolynucleotide. Generally, the heteropolynucleotide is stably integrated into the genome of the transformed plant cell or transgenic plant to pass the polynucleotide to offspring. The heteropolynucleotide may be integrated into the genome alone or as part of an expression vector. In some embodiments, the plants involved in this application include plant cells, plant protoplasts, plant cell tissue cultures capable of regenerating plants, plant callus, plant masses, and plant cells that are whole plants or parts of plants, such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruits, kernels, ears, rachis, husks, straw, roots, root tips, anthers, etc. This application also includes plant cells, protoplasts, tissues, callus, embryos, flowers, stems, fruits, leaves, and roots derived from transgenic plants of this application or their progeny, and thus at least partially containing the nucleotide sequences of this application.
[0040] In the context of nucleic acid amplification, the term "amplification" refers to any process in which an additional copy of a selected nucleic acid (or its transcribed form) is produced. Common amplification methods include replication methods based on various polymerases, including polymerase chain reaction (PCR), ligase-mediated methods such as ligase chain reaction (LCR), and RNA polymerase-based amplification methods (e.g., via transcription).
[0041] An allele is “associated” with a trait when it is linked to the trait, and when the presence of an allele is an indicator that the desired trait or the form of the trait will occur in a plant containing the allele.
[0042] As used in this article, the term "quantitative trait locus" or "QTL" refers to a polymorphic locus that has at least one allele associated with differential expression of a phenotypic trait in at least one genetic context (e.g., in at least one breeding population or offspring). QTLs can function through single-gene or multi-gene mechanisms.
[0043] The term "QTL mapping" used in this article refers to the method of locating QTLs on a genetic map using methods similar to single-gene mapping, determining the distance between the QTL and the genetic marker (expressed as recombination rate). Depending on the number of markers, it can be divided into single-marker, double-marker, and multi-marker methods. Depending on the statistical analysis method, it can be divided into variance and mean analysis, regression and correlation analysis, moment estimation, and maximum likelihood estimation. Depending on the number of marker intervals, it can be divided into zero-interval mapping, single-interval mapping, and multi-interval mapping. In addition, there are comprehensive analysis methods that combine different methods, such as QTL composite interval mapping (CIM), multi-interval mapping (MIM), multiple QTL mapping, and multi-trait mapping (MTM).
[0044] The term "molecular marker" as used in this article refers to a specific DNA segment that reflects a certain difference in the genome of an individual or population.
[0045] The term "major gene" used in this article refers to a gene that determines a trait by a single gene. The term "minor gene" refers to several non-allelic genes that each has only a partial influence on the phenotype of the same trait; such genes are called additive genes or polygenes. In additive genes, each gene has only a small phenotypic effect, hence the name minor gene.
[0046] The term "inbred line" used in this article refers to a line obtained by self-pollinating under artificially controlled self-pollination for several generations, continuously eliminating undesirable rows of ears, and selecting individual plants with better agronomic traits for self-pollination, thereby obtaining a line with more uniform agronomic traits and a simpler genetic basis.
[0047] The term "backcross" as used in this article refers to the method of hybridizing the F1 generation with either of the two parents.
[0048] As used herein, the term "hybridization" or "hybrid" refers to the fusion of gametes (e.g., cells, seeds, or plants) that produce offspring through pollination. This term includes sexual hybridization (one plant being pollinated by another) and self-pollination (self-pollination, such as when pollen and ovules come from the same plant). The term "hybridization" refers to the gamete fusion that produces offspring through pollination.
[0049] The term "backcross" as used in this article refers to the process in which the hybrid offspring are repeatedly backcrossed with one of the parents. In a backcross scheme, the "donor" parent refers to the parental plant that possesses the desired gene or locus to be infiltrated. The "recipient" parent (used once or multiple times) or "recurrent" parent (used twice or multiple times) refers to the parental plant into which the gene or locus is infiltrated. The initial hybridization produces the F1 generation; then, the term "BC1" refers to the second use of the recurrent parent, "BC2" refers to the third use of the recurrent parent, and so on.
[0050] The term "genotype" is the genetic makeup of an individual (or group of individuals) at one or more loci, as opposed to an observable trait (phenotype). A genotype is defined by the alleles at one or more known loci that an individual has inherited from their parents. The term genotype can be used to refer to an individual's genetic makeup at a single locus, at multiple loci, or more generally, to refer to the genetic makeup of all the genes in an individual's genome.
[0051] "Germium" refers to the genetic material of an individual (e.g., a plant), a group of individuals (e.g., a plant strain, variety, or family), or a clone derived from or obtained from a strain, variety, species, or culture. Germium can be a part of an organism or cell, or can be isolated from an organism or cell. Germium typically provides genetic material and specific molecular structure that provides the physical basis for some or all of the heritable traits of an organism or cell culture. As used herein, germplasm includes cells, seeds, or tissues from which new plants can grow, or plant parts such as leaves, stems, pollen, or cells that can be cultured into a whole plant.
[0052] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Any modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and essence of the invention are within the scope of this application. Unless otherwise specified, the examples are conducted under conventional experimental conditions, such as those described in Sambrook et al.'s *Molecular Cloning: A Laboratory Manual* (Sambrook J & Russell DW, 2001), or according to the conditions recommended in the manufacturer's instructions. Unless otherwise specified, the chemical reagents used in the examples are all commercially available conventional reagents, and the technical means used in the examples are conventional means well known to those skilled in the art.
[0053] Example 1: The effect of microRPG1 peptide on EIL gene expression.
[0054] Using previous work of this invention, a gene, ZmRPG, affecting the dehydration rate of maize kernels was identified in maize. This gene is located in Chromosome 1:20,019,106-20,021,118 in the B73 V4 genome, with a full length of 2013 bp. The ZmRPG gene is not annotated on the B73-V4.0 reference genome, but a transcriptional signal is present. ORF functional identification results show that only ORF1 (named microRPG1) is functional. The nucleotide sequence encoding microRPG1 is 96 bp in length (sequence as shown in SEQ ID NO.1), and the amino acid sequence is 31 amino acids in length (sequence as shown in SEQ ID NO.2).
[0055] Analysis of differentially expressed genes using RNA-seq of microRPG1 peptide knockout, overexpression, and exogenous microRPG1 peptide (applied at a concentration of 2 μM, chemically synthesized microRPG1, named ORF1p) yielded 505 differentially expressed genes. Among these 505 differentially expressed genes, those co-expressed with the ZmRPG gene in grains were screened, revealing 11 co-expressed genes, with Zm00001d047563 showing the highest expression level. Therefore, the microRPG1 peptide may regulate the expression of Zm00001d047563 (named ZmEIL1). Zm00001d047563 is a key gene in the ethylene signaling pathway, with four homologous genes in maize. ZmEIL1 (Zm00001d047563) and ZmEIL3 (Zm00001d028974) are highly expressed in grains. These two genes were selected for further analysis.
[0056] The nucleic acid sequences of ZmEIL1 and ZmEIL3 are shown in SEQ ID NO.3 and SEQ ID NO.4, respectively.
[0057] The inventors further analyzed the expression levels of ZmEIL1 and ZmEIL3 genes in maize materials with microRPG1 peptide knockout and overexpression, and found that the expression levels of ZmEIL1 and ZmEIL3 increased in the knockout materials and decreased in the overexpression materials. Figure 1 This indicates that the expression levels of the ZmEIL1 and ZmEIL3 genes in maize are inhibited by the microRPG1 peptide.
[0058] Example 2 Cloning of the corn kernel moisture content gene
[0059] Because the expression of the EIL gene is inhibited by the microRPG1 peptide, in order to clarify the specific functions of the ZmEIL1 and ZmEIL3 genes, the inventors used a CRISPR-Cas9 tool to knock out the ZmEIL1 and ZmEIL3 genes in maize. The target sequences for ZmEIL1 are TGCCTGGTTCGCCAGTCCA and CGCAGGACTACAGCTACGG, with gRNA sequences of SEQ ID NO. 5 and SEQ ID NO. 6. The target sequences for ZmEIL3 are GAGCTGCAGGACACCACACT and CCCTACAAGAAGCCCCATGA, with gRNA sequences of SEQ ID NO. 7 and SEQ ID NO. 8. For other maize gene editing procedures, please refer to Example 2 of CN112646013A.
[0060] ZmEIL1-edited plants ZmEIL1-KO1 and ZmEIL1-KO2 were obtained, with sequences shown in SEQ ID NO. 9-10, respectively; ZmEIL3-edited plants ZmEIL3-KO1, ZmEIL3-KO2 and ZmEIL3-KO3 were obtained, with sequences shown in SEQ ID NO. 11-13, respectively.
[0061] The phenotypes of maize materials after ZmEIL1 and ZmEIL3 gene knockout were investigated, and the results showed that the dehydration rate of maize kernels was slowed down after ZmEIL1 and ZmEIL3 gene knockout. Figure 2 This indicates that ZmEIL1 and ZmEIL3 control the rate of dehydration of maize kernels. Knocking out ZmEIL1 and ZmEIL3 can slow down the dehydration of maize kernels.
[0062] Example 3: Effect of ethylene treatment on corn kernel dehydration
[0063] Since ZmEIL1 and ZmEIL3 are key genes in the ethylene signaling pathway, we further treated maize kernels with exogenous ethylene. Specifically, we sprayed 277 mM ethephon directly onto maize ears during the later stages of kernel development (5-10 mL per ear), and then examined changes in kernel dehydration. We found that in maize materials with three different backgrounds, ethylene treatment accelerated the rate of kernel dehydration. Figure 3 ).
[0064] Example 4: Identification of three seed-specific expression promoters
[0065] In studying the three genes (ZmRPG, ZmEIL1, and ZmEIL3), the inventors discovered that they all exhibit high expression in kernels and specifically high expression during the later stages of kernel development. To further clarify their expression patterns, the inventors used qPCR experiments to detect gene expression in maize kernels 5 to 45 days after pollination, finding that the ZmRPG gene began to express at 35 days post-pollination. Figure 4 To further investigate the effect of the ZmRPG gene on grain development, near-isogenic maize line NIL was used from 15 days (15 DAP) to 45 days (45 DAP) post-pollination. DAN340 and NIL K22 The fresh weight, dry weight, and moisture content of the grains were analyzed. Results showed that at harvest (45 DAP), NIL... DAN340 and NIL K22 The dry weights were the same, but the moisture content differed significantly. Figure 5 Therefore, knockout of the microRPG1 peptide does not affect grain yield because the ZmRPG gene begins to express in the later stages of grain development, when dry matter accumulation in the grain has been completed. This also indicates that genes expressed in the later stages of grain development that control the dehydration rate of maize grains are more important for improving the dehydration rate. The ZmEIL1 and ZmEIL3 genes also exhibit high expression in grains. The expression of these three genes in different developmental stages and tissues of maize is shown in [reference needed]. Figure 6 .
[0066] The characteristics of the ZmRPG, ZmEIL1, and ZmEIL3 genes allow for accelerated dehydration without affecting flowering time, agronomic traits, or yield-related traits. Therefore, the promoters of the ZmRPG, ZmEIL1, and ZmEIL3 genes driving the expression of other genes affecting dehydration in the later stages of grain development is of great significance for improving the dehydration rate. The inventors cloned and determined the promoter sequences of the above three genes, as shown in SEQ ID NO.14 to SEQ ID NO.16, respectively.
[0067] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.
Claims
1. A method for increasing the moisture content of corn kernels or reducing the dehydration rate, characterized in that, Knock out the B73 reference genome LOC number Zm00001d047563 gene in maize and select maize plants with increased kernel water content or decreased dehydration rate. The nucleotide sequence of the maize gene is shown in SEQ ID NO.
3.
2. The method according to claim 1, characterized in that, The method of knocking out genes is gene editing.
3. The method according to claim 2, characterized in that, The target sequence for gene editing is a combination of TGCCTGGTTCGCCAGTCCA and CGCAGGACTACAGCTACGG.
Citation Information
Patent Citations
Corn flowering period gene and application thereof
CN112646013A