SNP8-117644135 molecular marker associated with ginsenoside Rg1 content in Panax notoginseng and its application

By developing SNP molecular markers SNP8-117644135 and KASP primers related to the content of ginsenoside Rg1 in Panax notoginseng, the problems of long breeding cycle and low efficiency of Panax notoginseng were solved, early molecular-assisted selection was realized, and breeding efficiency was improved.

CN118581260BActive Publication Date: 2026-05-26YUNNAN AGRICULTURAL UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
YUNNAN AGRICULTURAL UNIVERSITY
Filing Date
2024-06-12
Publication Date
2026-05-26

AI Technical Summary

Technical Problem

The existing Panax notoginseng varieties have long breeding cycles and low efficiency. They lack early selection and identification methods, and the hybridization breeding methods are limited, making it difficult to increase the content and types of ginsenosides, which affects the breeding efficiency.

Method used

We developed the SNP molecular marker SNP8-117644135, which is associated with the content of ginsenoside Rg1 in Panax notoginseng, and designed KASP primer pairs. The genotype was detected by a high-throughput genotyping system to achieve early molecular-assisted selection of ginsenoside Rg1 content.

Benefits of technology

It improved the selection efficiency of Panax notoginseng breeding, enabled early identification of ginsenoside Rg1 content and molecular-assisted breeding, shortened the breeding cycle and improved breeding efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118581260B_ABST
    Figure CN118581260B_ABST
Patent Text Reader

Abstract

This invention discloses a kit for detecting SNP molecular markers related to the content of ginsenoside Rg1 in Panax notoginseng, and its application in breeding for the ginsenoside Rg1 content trait in Panax notoginseng. The SNP molecular marker is SNP8-117644135, located at base 117644135 on chromosome Chr11, with a mutation type of C / T. The KASP primer combination developed in this invention can accurately distinguish between Panax notoginseng with high and low ginsenoside Rg1 content, and can be applied to molecular marker-assisted breeding of Panax notoginseng, shortening the breeding cycle of new varieties. Furthermore, the detection cost is low, it is not limited by the environment, and the detection results are highly accurate and easily reproducible. This has important theoretical and practical guiding significance for accelerating the genetic improvement process of breeding Panax notoginseng with high ginsenoside Rg1 content and improving breeding selection efficiency.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular genetics and breeding technology, and specifically relates to an SNP molecular marker related to the content of ginsenoside Rg1 in Panax notoginseng and its application. Background Technology

[0002] Panax notoginseng is a perennial herb belonging to the Araliaceae family of the ginseng genus. Its roots and rhizomes are used medicinally, possessing properties that disperse blood stasis, stop bleeding, reduce swelling, and relieve pain. It is one of my country's unique and precious traditional Chinese medicinal materials. Panax notoginseng is increasingly widely used clinically and is one of the main raw materials for several traditional Chinese medicine preparations, including Xue Sai Tong soft capsules, Yunnan Baiyao, Compound Danshen tablets, Compound Danshen dripping pills, and Zhangzhou Pian Zai Huang. Ginsenosides are the most important active ingredients in Panax notoginseng, and their content and types are important indicators for evaluating its quality.

[0003] Quality breeding is the core measure for selecting superior varieties. Studies have shown that identifying superior allelic variations of key genes controlling important agronomic traits and developing allelic-specific molecular markers can be effectively utilized for marker-assisted selection breeding. Currently, Panax notoginseng variety breeding mainly employs the group mixed selection method, relying primarily on phenotypic selection to obtain population varieties, which is the main breeding approach at present. However, each generation of Panax notoginseng requires at least 3 years, resulting in extremely slow phenotypic segregation and population construction. Furthermore, the lack of early selection and identification methods leads to a long breeding cycle and low efficiency, requiring 15-20 years to develop a new variety. Simultaneously, Panax notoginseng is a cross-pollinated plant, and to date, there are no pure-line breeding materials, severely limiting the application of hybridization breeding methods in Panax notoginseng variety selection. Distant hybridization is also difficult to use for Panax notoginseng germplasm improvement.

[0004] With the development of omics technologies, molecular genetic breeding of medicinal plants based on molecular markers can greatly improve breeding efficiency and make molecular design breeding for targeted enhancement of the effective components of medicinal plants possible. SNP markers (single nucleotide polymorphisms) mainly refer to DNA sequence polymorphisms caused by single nucleotide variations at the genome level, and are currently the molecular markers with the highest polymorphism coverage and density. Compared with traditional marker-assisted selection, high-throughput resequencing technology can generate large-scale SNP markers, promoting precise association analysis between markers and traits and improving the efficiency of molecularly assisted selection breeding. The content and types of saponins in Panax notoginseng should be the core target for Panax notoginseng variety selection. Therefore, utilizing known saponin biosynthesis genes and abundant Panax notoginseng germplasm resources, it is particularly important to identify SNPs significantly associated with the content of ginsenosides in Panax notoginseng, develop KASP molecular markers for assisted breeding, and achieve early molecularly assisted selection of target traits to improve breeding efficiency. Summary of the Invention

[0005] To address the above problems, the purpose of this invention is to provide an SNP molecular marker related to the content of ginsenoside Rg1 in Panax notoginseng and its application.

[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0007] This invention provides a kit for detecting SNP molecular markers related to the content of ginsenoside Rg1 in Panax notoginseng, and its application in breeding for the trait of ginsenoside Rg1 content in Panax notoginseng. The SNP molecular marker is SNP8-117644135, located at base 117644135 on chromosome Chr11, and its mutation type is C / T.

[0008] Preferably, in SNP8-117644135, the TT genotype has a higher content of ginsenoside Rg1 than the CC / CT genotype.

[0009] This invention also provides the application of KASP primer pairs for detecting SNP molecular markers related to the content of ginsenoside Rg1 in Panax notoginseng in the breeding of ginsenoside Rg1 content trait in Panax notoginseng. The KASP primers include upstream primers SNP8-F1 and SNP8-F2 for detecting SNP8-117644135, and downstream primer SNP8-R.

[0010] Preferred,

[0011] The SNP8-F1 is: 5'-GAAGGTGACCAAGTTCATGCTAGCAACAGTTAAGGACAACAACC-3';

[0012] The SNP8-F2: 5'-GAAGGTCGGAGTCAACGGATTAGCAACAGTTAAGGACAACAACT-3';

[0013] The SNP8-R is: 5'-GTGCCACACATTTTGGGTCC-3'.

[0014] This invention also provides a method for detecting the content of ginsenoside Rg1 in Panax notoginseng, comprising the following steps:

[0015] (1) Extract DNA from the Panax notoginseng sample to be tested as a template;

[0016] (2) Perform PCR amplification of the template using the KASP primers described in claim 3 or 4;

[0017] (3) After PCR amplification, the fluorescence signal was read and converted by the high-throughput genotyping system GeneMatrix. The SNP8-117644135 molecular marker site of the sample to be identified for the content of Panax notoginseng ginsenoside Rg1 was genotyped.

[0018] (4) The method for determining the phenotypic phenotype of ginsenoside Rg1 content in step (3) is as follows: If the identified genotype is TT, it is determined that the ginsenoside Rg1 content in the Panax notoginseng sample is high; if the identified genotype is CC / CT, it is determined that the ginsenoside Rg1 content in the Panax notoginseng sample is low.

[0019] Preferably, the PCR amplification program is as follows: pre-denaturation at 95℃ for 10 min; denaturation at 95℃ for 20 sec; annealing at 61–55℃ for 40 sec, decreasing by 0.6℃ per cycle, for 10 cycles; denaturation at 95℃ for 20 sec, annealing at 55℃ for 40 sec, for 35 cycles.

[0020] Preferably, the PCR amplification system is as follows: 1 μL of 15 ng / μL DNA template; 1 μL of 2×KASP Master mix; 0.01 μL of KASP mixed primers, wherein the volume ratio of upstream primer SNP8-F1, upstream primer SNP8-F2 and downstream primer SNP8-R is 1:1:3.

[0021] The present invention has the following beneficial effects:

[0022] The SNPs significantly associated with the content of ginsenoside Rg1 in Panax notoginseng provided by this invention were obtained through association analysis of 236 natural Panax notoginseng populations. The SNP loci were used as genotype data, and the ginsenoside Rg1 content was used as phenotypic data. Genome-wide association analysis (GWAS) was performed using EMMAX software with a mixed linear model (MLM). The SNP molecular marker SNP8-117644135, located at base 117644135 on chromosome Chr11, provides technical support for marker-assisted breeding of the ginsenoside Rg1 content trait in Panax notoginseng.

[0023] The KASP primer combination developed in this invention can directly and specifically distinguish and detect the C or T base mutation sites in SNP8-117644135. When using this KASP primer combination to identify the levels of ginsenoside Rg1, it can clearly separate the two genotypes. In the molecular marker SNP8-117644135, the dots near the Y-axis indicate TT allelic variant sites, with the genotype being TT, and the ginsenoside Rg1 content of Panax notoginseng is relatively high. The dots near the X-axis indicate CC allelic variant sites, with the genotype being CC, and the ginsenoside Rg1 content of Panax notoginseng is relatively low. The KASP primer combination developed in this invention has good application value, enabling pre-selection and molecular-assisted breeding of the ginsenoside Rg1 content trait in Panax notoginseng. It has important theoretical and practical guiding significance for the genetic improvement process of breeding for higher ginsenoside Rg1 content in Panax notoginseng, and for improving breeding selection efficiency. Attached Figure Description

[0024] Figure 1 Manhattan and QQ-plots of GWAS results for ginsenoside Rg1 in Panax notoginseng;

[0025] Figure 2 A statistical graph showing the allelic variation and phenotypic significance of ginsenoside Rg1 content in Panax notoginseng;

[0026] Figure 3 Genotyping results of different Panax notoginseng samples using KASP-specific primers. Detailed Implementation

[0027] The following description, in conjunction with specific embodiments of the present invention, provides further details. It should be noted that these descriptions are intended to aid in understanding the invention but do not constitute a limitation thereof. Furthermore, the technical features described in the various embodiments of the invention below can be combined with each other as long as they do not conflict with each other.

[0028] Example 1

[0029] Nucleotide mutation sites (SNPs) related to the content of ginsenoside Rg1 in Panax notoginseng were obtained.

[0030] (1) DNA extraction and high-throughput sequencing:

[0031] We collected 236 natural populations of Panax notoginseng, extracted genomic DNA using the CTAB method, and performed 10X whole-genome resequencing.

[0032] (2) Determination of ginsenoside Rg1 content:

[0033] The Panax notoginseng sample was dried at 50℃ to constant weight, pulverized using a pulverizer, and passed through a No. 4 sieve for later use. 0.6 g of the sample was accurately weighed using an analytical balance, 50 ml of methanol was added, and the mixture was weighed again. The bottle was sealed with sealing film, sonicated for 30 min, and allowed to stand for 20 h. The sealing film was removed, and the sample was weighed again. The lost weight was replenished with methanol, and the mixture was shaken well. 1 ml of the test solution was obtained by filtration through a 0.22 μm microporous membrane. Ginsenoside Rg1 was quantitatively analyzed using high-performance liquid chromatography (HPLC) with the external standard method. The chromatographic column was an Agilent ZORBAX SB-AQ (3.5 μm, 4.6 × 150 mm), the flow rate was 0.7 mL / min, the column temperature was 30 °C, and the injection volume was 10 μL. The detection wavelength was 203 nm. The mobile phase was acetonitrile (A) and H₂O (B), with the elution gradient as follows: 0–12 min, 19% (A); 12–60 min, 19–36% (A). Compounds were identified based on their retention time, and quantification was performed using the external standard method, with peak area as the quantification basis.

[0034] (3) Genome-wide association analysis (GWAS)

[0035] Using SNP loci as genotypic data and ginsenoside Rg1 content as phenotypic data, genome-wide association studies (GWAS) were performed using EMMAX software with a mixed linear model (MLM). The results are as follows: Figure 1 As shown. Using -log10(P)>6 as the threshold, the SNP molecular marker SNP8-117644135, which is significantly associated with ginsenoside Rg1, is located at base 117644135 on chromosome Chr11. By comparing with the Panax notoginseng reference genome, the sequence allelic variations of the SNPs were extracted, and combined with the ginsenoside Rg1 content of the population materials for joint analysis. SNP8-117644135 has three genotypes: CC, TT, and CT. After using the T-test, it was found that the TT genotype had a higher ginsenoside Rg1 content and was the dominant genotype. Figure 2 ).

[0036] The gene sequence containing 100 bp before and after the SNP8-117644135 site is shown in SEQ ID NO.1:

[0037] AGTTATGGGCGGTTACCAGATGTTGGGAAGGTGCTAGACAACAGTTGTCGCAGTTACCTTTGGTGGGTAAGCTAACCAAGCAACAGTTAAGGACAACAAC[C / T]AGTTCGTGGGAACATGGTCAGACATCAGATTGTAT AGTTGGGACCCAAAATGTGTGGCACTTGCTGACATGACCTGTTCATGGGCAATTTTGGGGGAACT(SEQ ID NO:1)

[0038] Example 2

[0039] Development of SNP-labeled KASP-specific primers

[0040] Using NCBI's Primer-BLAST function, three primers were designed based on the sequence SEQ ID NO.1: upstream primer SNP8-F1, upstream primer SNP8-F2, and downstream primer SNP8-R. SNP8-F1 and SNP8-F2 contain FAM and HEX fluorescent linker sequences (underlined), respectively. The sequences are as follows:

[0041] SNP8-F1: 5'- GAAGGTGACCAAGTTCATGC TAGCAACAGTTAAGGACAACAACC-3'

[0042] SNP8-F2: 5'- GAAGGTCGGAGTCAACGGAT TAGCAACAGTTAAGGACAACAACT-3'

[0043] SNP8-R: 5'-GTGCCACACATTTTGGGTCC-3'

[0044] Example 3

[0045] Genotyping of SNP loci in different Panax notoginseng samples and its application

[0046] The authenticity of SNP8-117644135 in the natural population of Panax notoginseng was verified using the high-throughput genotyping system GeneMatrix (GM). Genomic DNA was extracted from 94 randomly selected Panax notoginseng single plants. Using the genomic DNA as a template, PCR amplification was performed using the SNP marker KASP-specific primers developed in Example 2.

[0047] The PCR reaction system consisted of: 1 μL of 15 ng / μL DNA template; 1 μL of 2×KASP Master mix; and 0.01 μL of KASP mixed primers, with the volume ratio of upstream primer SNP8-F1, upstream primer SNP8-F2, and downstream primer SNP8-R being 1:1:3. The PCR amplification program was as follows: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 20 sec; annealing at 61–55℃ for 40 sec, decreasing by 0.6℃ per cycle, for 10 cycles; followed by 95℃ denaturation for 20 sec and 55℃ annealing for 40 sec, for 35 cycles. After PCR amplification, the fluorescence signal was read, analyzed, and converted. The fluorescence scan results were automatically converted into graphs, and both pairs of labeled primers clearly separated the two genotypes.

[0048] In molecular marker SNP8-117644135, the dots closer to the Y-axis represent TT allelic variant sites, indicating the TT genotype. Panax notoginseng with this genotype has a relatively high content of ginsenoside Rg1. The dots closer to the X-axis represent CC allelic variant sites, indicating the CC genotype. Panax notoginseng with this genotype has a relatively low content of ginsenoside Rg1. Figure 3 ).

[0049] The embodiments of the present invention have been described in detail above, but the present invention is not limited to the described embodiments. For those skilled in the art, various changes, modifications, substitutions, and variations can be made to these embodiments without departing from the principles and spirit of the present invention, and these variations still fall within the protection scope of the present invention.

Claims

1. The use of a kit for detecting a SNP molecular marker related to the content of ginsenoside Rg1 in Panax notoginseng in breeding of the content of ginsenoside Rg1 in Panax notoginseng, characterized in that: The SNP molecular marker is SNP8-117644135, located at base 117644135 on chromosome Chr11, and its mutation type is C / T. The gene sequence containing 100 bp before and after the SNP8-117644135 site is shown in SEQ ID NO.1 and SEQ ID NO.

2. In the SNP8-117644135, the TT genotype has a higher content of ginsenoside Rg1 than the CC / CT genotype. ​ 2. Use of the KASP primer pair for detecting the SNP8-117644135 molecular marker associated with the content of ginsenoside Rg1 in Panax notoginseng as claimed in claim 1 in breeding the content of ginsenoside Rg1 trait in Panax notoginseng, characterized in that: The KASP primers include upstream primer SNP8-F1, upstream primer SNP8-F2, and downstream primer SNP8-R for detecting SNP8-117644135; in SNP8-117644135, the content of ginsenoside Rg1 in the TT genotype is higher than that in the CC / CT genotype. The SNP8-F1 is: 5'-GAAGGTGACCAAGTTCATGCTAGCAACAGTTAAGGACAACAACC-3'; The SNP8-F2: 5'-GAAGGTCGGAGTCAACGGATTAGCAACAGTTAAGGACAACAACT-3'; The SNP8-R is: 5'-GTGCCACACATTTTGGGTCC-3'.

3. A method for detecting the content of ginsenoside Rg1 in Panax notoginseng, characterized in that: Includes the following steps: (1) Extract DNA from the Panax notoginseng sample to be tested as a template; (2) PCR amplification of the template using the KASP primers described in claim 2; (3) After PCR amplification, the fluorescence signal was read and converted by the high-throughput genotyping system GeneMatrix. The fluorescence signal was analyzed and converted to perform genotyping on the SNP8-117644135 molecular marker site as described in claim 1 in the sample of Panax notoginseng ginsenoside Rg1 content to be identified. (4) The method for determining the phenotypic phenotype of ginsenoside Rg1 content in step (3) is as follows: if the identified genotype is TT, then the ginsenoside Rg1 content in the Panax notoginseng sample is high; if the identified genotype is CC / CT, then the ginsenoside Rg1 content in the Panax notoginseng sample is low.

4. The method according to claim 3, characterized in that, The PCR amplification program was as follows: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 20 sec; 61-55℃ annealing for 40 sec, decreasing by 0.6℃ per cycle, for 10 cycles; 95℃ denaturation for 20 sec, 55℃ annealing for 40 sec, for 35 cycles.

5. The method according to claim 4, characterized in that, The PCR amplification system consisted of: 1 μL of 15 ng / μL DNA template; 1 μL of 2×KASP Master mix; and 0.01 μL of KASP mixed primers, wherein the volume ratio of upstream primer SNP8-F1, upstream primer SNP8-F2, and downstream primer SNP8-R was 1:1:3.

Citation Information

Patent Citations

  • Application of pseudo-ginseng SSR marker in determining ginsenoside Rb1 content

    CN109486997A

  • Distinction of Korean Ginseng from Foreign Ginsengusing Single Nucleotide Polymorphism

    KR1020040034332A