SpyC / T-based indirect surface display system of pichia pastoris and construction and application thereof

By constructing a SpyC/T system on the surface of Pichia pastoris and utilizing the interaction between SED1 protein and SpyC, the problem of unstable target protein display on the Pichia pastoris surface was solved, achieving efficient and stable target protein display and improving the display volume and functional performance.

CN118652922BActive Publication Date: 2026-01-27HUBEI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202410645833.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-05-23
Publication Date
2026-01-27
Estimated Expiration
2044-05-23

AI Technical Summary

Technical Problem

In existing Pichia pastoris surface display systems, some target proteins cannot be effectively displayed on the cell surface due to steric hindrance or inability to be secreted, resulting in an unstable and inefficient display platform.

Method used

A SpyC/T-based indirect surface display system for Pichia pastoris was constructed. Using SED1 protein from Saccharomyces cerevisiae as an anchoring protein, SpyC from Streptococcus pyogenes was immobilized on the surface of Pichia pastoris cells. Through the strong interaction between SpyCatcher and SpyTag, target proteins containing SpyTag were indirectly displayed on the cell surface.

Benefits of technology

The stability and display efficiency of the target protein were improved, enabling efficient display of SpyC on the surface of Pichia pastoris, enhancing the functional performance of the target protein, and further increasing the display volume through multi-copy expression cassettes.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118652922B_ABST
    Figure CN118652922B_ABST
Patent Text Reader

Abstract

The present application relates to a Pichia pastoris indirect surface display system based on SpyC / T, construction and application thereof, and relates to the technical field of bioengineering. The Pichia pastoris indirect surface display system uses SED1 protein from Saccharomyces cerevisiae as an anchor protein, and fixes SpyC from Streptococcus pyogenes on the anchor protein on the surface of Pichia pastoris cells. The present application uses SED1 protein from Saccharomyces cerevisiae as an anchor protein, displays SpyC on the surface of Pichia pastoris, fixes various target proteins containing SpyTag on the cell surface through strong interaction of SpyC / T, so as to indirectly display the target proteins containing SpyTag on the surface of Pichia pastoris, exert the function of the target proteins containing SpyTag, and improve the stability of the target proteins.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of bioengineering technology, specifically to a SpyC / T-based Pichia pastoris indirect surface display system and its construction and application. Background Technology

[0002] Microbial surface display technology utilizes specific genetic engineering techniques to bind target proteins to specific molecules on the cell wall, enabling them to be displayed on the cell surface. This technology can establish a display platform, improve the stability of the displayed proteins, and has wide applications in library screening, biocatalysis, and biosensing.

[0003] Currently, the most commonly used host bacteria in microbial surface display systems include Pichia pastoris and Gram-negative bacteria (Escherichia coli). Among them, Pichia pastoris has become an important strain for industrial protein production due to its ease of genetic manipulation, high secretion, and post-translational modification. Compared with other display systems, Pichia pastoris has high expression efficiency, high secretion efficiency, high fermentation density, and strong resistance to chemical reagents and environmental tolerance, thus giving it significant advantages in the field of biotechnology applications.

[0004] Pichia pastoris exhibits three types of anchoring proteins on its surface: GPI, Flo, and Pir. SED1, a GPI-type anchoring protein, is a highly glycosylated cell wall protein that accounts for up to 30% of extractable cell wall proteins during the stationary phase of gene expression. By fusing target proteins with anchoring proteins, target proteins can be specifically displayed on the cell surface. However, when directly displaying target proteins on the cell surface, some proteins cannot be effectively displayed due to steric hindrance or lack of secretion. Therefore, constructing an efficient and stable indirect display platform is crucial, providing strong support for solving the problem of target proteins not being directly displayed on the cell surface. Summary of the Invention

[0005] The technical problem to be solved by this invention is to provide a SpyC / T-based Pichia pastoris indirect surface display system, its construction, and its application. The aim is to display SpyC on the Pichia pastoris cell surface using the SED1 anchoring protein, thereby providing a basis for the indirect display of target proteins with Spy-Tag tags on the cell surface.

[0006] The technical solution of the present invention to solve the above-mentioned technical problems is as follows:

[0007] Firstly, a Pichia pastoris indirect surface display system based on SpyC / T, wherein the Pichia pastoris indirect surface display system uses SED1 protein from Saccharomyces cerevisiae S228C as an anchoring protein to immobilize SpyC from Streptococcus pyogenes on the anchoring protein on the surface of Pichia pastoris cells.

[0008] The beneficial effects of this invention are as follows: This invention utilizes the SED1 protein derived from Saccharomyces cerevisiae as an anchoring protein to display SpyC on the surface of Pichia pastoris; through the strong interaction between SpyCatcher / SpyTag (abbreviated as SpyC / T), various target proteins containing SpyTag are immobilized on the cell surface, thereby indirectly displaying the target proteins containing SpyTag on the surface of Pichia pastoris, enabling the proteins to perform their own functions and improving the stability of the proteins.

[0009] The SpyC / T interaction pair described above was obtained by dividing the Streptococcus pyogenes adhesion protein FbaB into two parts (SpyC, 113aa; SpyTag, 13aa). Under the catalysis of Glu77, SpyTag and SpyC bind and spontaneously undergo amidation to form intermolecular isopeptide bonds, achieving specific binding. The interaction between SpyTag and SpyC is subject to a wide range of conditions and has broad applications in protein functional modification, artificial scaffolds, surface display, and the development of functional biomaterials.

[0010] Furthermore, the nucleotide sequence encoding the SED1 protein derived from *Saccharomyces cerevisiae* is shown in SEQ NO: 1; and the nucleotide sequence encoding the SpyC peptide derived from *Streptococcus pyogenes* is shown in SEQ NO: 2.

[0011] Furthermore, in the Pichia pastoris indirect surface display system, the copy number of the expression cassette of the SED1 protein from Saccharomyces cerevisiae and the SpyC fusion gene from Streptococcus pyogenes is 1 to 4.

[0012] The further beneficial effects of the present invention are as follows: In order to further increase the display amount on the surface of Pichia pastoris, a multi-copy expression cassette is constructed to increase the display amount of SpyC on the surface of Pichia pastoris, thereby indirectly increasing the amount of target protein displayed on the surface.

[0013] Furthermore, in the Pichia pastoris indirect surface display system, the copy number of the expression cassette of the fusion gene of the SED1 protein from Saccharomyces cerevisiae and the SpyC from Streptococcus pyogenes is 4.

[0014] Furthermore, in the Pichia pastoris indirect surface display system, the target protein is a protein or peptide containing a Spy-Tag tag; the target protein is indirectly displayed on the surface of Pichia pastoris by interacting with SpyC derived from Streptococcus pyogenes. Various proteins or peptides to be displayed on Pichia pastoris are fused with Spy-Tag tags and expressed in other hosts to obtain proteins or peptides containing Spy-Tag tags.

[0015] Secondly, the construction method of the Pichia pastoris indirect surface display system based on SpyC / T includes the following steps:

[0016] (1) The gene sequence encoding SpyC from Streptococcus pyogenes is cloned upstream of the gene sequence of SED1 protein from Saccharomyces cerevisiae, and the (G4S)3Linker gene is added in the middle to form a fusion gene;

[0017] (2) Transform Pichia pastoris cells and screen positive transformants according to the screening markers on the expression vector to obtain the Pichia pastoris indirect surface display system.

[0018] Furthermore, step (2) includes the following specific steps:

[0019] (2-1) The fusion gene was digested with EcoRI and NotI enzymes and cloned into the pPICZαA vector to obtain a single-copy recombinant plasmid.

[0020] (2-2) The single-copy recombinant plasmid obtained in step (2-1) is linearized with Sac I and then transformed into Pichia pastoris cells. Positive transformants are screened according to the screening markers on the expression vector to obtain the Pichia pastoris single-copy indirect surface display system.

[0021] The construction of single-copy recombinant plasmids can be achieved through the following specific methods:

[0022] ① The plasmid backbone is pPICZαA. The linearized backbone is obtained by double digestion of the plasmid backbone with EcoRI and NotI.

[0023] ②The primers used for PCR amplification of the SED1 fragment (SEQ NO: 1) from the Saccharomyces cerevisiae strain are as follows:

[0024] SED-F: GGTGGTGGTGGTTCTATGAAATTATCAACTGTCCTATTATCTGCCGG (SEQ NO: 6);

[0025] SED-R: GTTCTAGAAAGCTGGCGGCCCGCCGCGGTTATAAGAATAACATAGCA

[0026] ACACCAGCCAAA(SEQ NO: 7);

[0027] ③The primers for PCR amplification of the SpyC-(G4S)3 (SEQ ID No: 2) fragment from the synthesized pUC19-SpyC plasmid are as follows:

[0028] SC-F: CGAGAAAAGAGAGGCTGAAGCTGAATTCGATAGTGCTACCCATATTAAAT TCTCAAAAC (SEQNO: 8);

[0029] SC-R1: CAGAACCACCACCACCAGAACCACCACCACCAATATGAGCGTCACCT TTAGTTGC (SEQNO: 9);

[0030] SC-R2: AGTTGATAATTTCATAGAACCACCACCACCAGAACCACCACCACCA

[0031] GAAC (SEQ NO: 10);

[0032] ④ The obtained SpyC-(G4S)3 and SED1 fragments were amplified by splicing PCR to obtain the SpyC-(G4S)3-SED1 fusion gene fragment. The primers used are as follows:

[0033] SC-F: CGAGAAAAGAGAGGCTGAAGCTGAATTCGATAGTGCTACCCATATTA

[0034] AATTCTCAAAAC(SEQ NO: 8);

[0035] SED-R: GTTCTAGAAAGCTGGCGGCCCGCCGCGGTTATAAGAATAACATAGCAA CACCAGCCAAA (SEQNO: 7);

[0036] The linear pPICZαA plasmid backbone and the SpyC-(G4S)3-SED1 fragment were transformed into *E. coli* DH5α via homologous recombination to obtain the recombinant plasmid pPICZαA-SpyC-(G4S)3-SED1. The recombinant plasmid was linearized with SacI and electroporated into *Pichia pastoris* GS115 to obtain a surface-display strain.

[0037] Furthermore, to evaluate the effectiveness of immobilizing the SpyT-containing target protein on the Pichia pastoris indirect surface display system, this invention employs flow cytometry detection. The construction and preparation of the SpyT-containing target protein eGFP-SpyT are as follows:

[0038] ① The plasmid backbone is pET28a. The linearized backbone is obtained by double digestion of the plasmid backbone with NcoI and XhoI.

[0039] ②The primers for PCR amplification of the eGFP-G4S-SpyT fragment from the synthesized pUC19-eGFP-G4S-SpyT plasmid are as follows:

[0040] eGFP-F:CCATGGGCCACCATCATCATCATCATGTGAGCAAGGGCGAGGAGC (SEQ NO: 11);

[0041] eGFP-ST-R:TGGTGGTGGTGGTGCTCGAGTTACTTGGTGGGCTTGTAGGC (SEQ NO: 12);

[0042] ③ The linear pET28a plasmid backbone and the eGFP-G4S-SpyT fragment were transformed into *E. coli* DH5α via homologous recombination to obtain a recombinant plasmid; the plasmid was then transformed into *E. coli* BL21(DE3) to obtain an eGFP-G4S-SpyT expression strain. The gene sequence of eGFP is shown in SEQ ID No: 4; the nucleotide sequence of SpyTag (SpyT) is shown in SEQ ID No. 3.

[0043] Furthermore, step (2-1) also includes preparing the single-copy recombinant plasmid into a multi-copy recombinant plasmid; the multi-copy recombinant plasmid includes at least one of two-copy recombinant plasmid, three-copy recombinant plasmid, and four-copy recombinant plasmid.

[0044] The method for constructing multi-copy recombinant plasmids described above is as follows: The single-copy plasmid pPICZαA-SpyC-(G4S)3-SED1 was digested with BglII and AvrII, and the expression cassette fragment was recovered via gel electroporation. The plasmid was then digested with AvrII and BamHI to obtain a linearized vector. The vector was ligated overnight at 4°C using Solution I, transformed into *E. coli* DH5α, and screened on SLBZ plates. Plasmid samples were extracted and run on a gel electroporation plate to verify size comparison. The target fragment was digested with enzymes, and its size was compared to verify successful multi-copy construction. The verified plasmid was linearized with AvrII, recovered via gel electroporation, and then electroporated into *GS115* strain. It was screened on YPDZ plates to obtain the multi-copy recombinant plasmid.

[0045] Furthermore, the Pichia pastoris cells are Pichia pastoris GS115.

[0046] Thirdly, the application of the SpyC / T-based Pichia pastoris indirect surface display system involves using this system to immobilize target proteins containing SpyTag. Target proteins containing SpyTag include, for example, organophosphorus hydrolases. Attached Figure Description

[0047] Figure 1 This is a surface display plasmid diagram constructed in Embodiment 1 of the present invention;

[0048] Figure 2 This is an indirect surface illustration of Pichia pastoris in Example 1 of the present invention; wherein, the left image is a flow cytometry detection image of GS115 binding with eGFP-G4S-SpyT as a reference, and the right image is a flow cytometry detection image of GS115-pPICZαA-SpyC-G4S3-SED1 binding with eGFP-G4S-SpyT.

[0049] Figure 3 This is a flowchart of constructing a multi-copy plasmid in Embodiment 2 of the present invention;

[0050] Figure 4 This is a gel verification diagram of the construction of multiple-copy nucleic acid in Example 2 of the present invention;

[0051] Figure 5 This is a diagram illustrating the trend of efficiency as the gene copy number increases, as shown in Embodiment 2 of the present invention.

[0052] Figure 6 This is a graph showing the results of the thermal stability determination of the organophosphorus hydrolase OPH immobilized on the surface of Pichia pastoris in Example 3 of the present invention.

[0053] Figure 7 The graph shows the results of the recovery rate determination of the organophosphorus hydrolase OPH immobilized on the surface of Pichia pastoris in Example 3 of the present invention. Detailed Implementation

[0054] The principles and features of this invention are described below. The examples given are for illustrative purposes only and are not intended to limit the scope of the invention. Where specific techniques or conditions are not specified in the embodiments, they should be performed according to the techniques or conditions described in the literature in this field, or according to the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased through legitimate channels.

[0055] Description of the materials and reagents used in the following examples:

[0056] PCR reagents, plasmid extraction and purification DNA gel recovery kits, and seamless cloning kits were all purchased from Novizan. All gene synthesis, primer synthesis, and sequencing involved in the experiments were performed by Sangon Biotech Co., Ltd. Restriction endonucleases EcoRI, NotI, SacI, XhoI, BglII, AvrII, and BamHI were purchased from Takara. Saccharomyces cerevisiae S228C strain was purchased from Novagen. Pichia pastoris GS115 was purchased from Invitrogen. Escherichia coli DH5α and BL21(DE3) were purchased from Invitrogen. pPICZαA plasmid was purchased from Invitrogen. pET28a plasmid was purchased from Takara. Detailed instructions for use of reagents can be found in the instruction manuals.

[0057] The microplate reader used for fluorescence detection was an MD SpectraMax M2e, with an absorption wavelength of 488 nm and an emission wavelength of 511 nm.

[0058] Example 1: Construction and Application of a Single-Copy Surface Display System

[0059] 1. Construction of a single-copy surface display system

[0060] This implementation demonstrates the construction of a single-copy surface display system; this system contains the AOX1 promoter, α-signal peptide, bait protein SpyC, anchoring protein SED1, and AOX1 terminator. The specific steps are as follows:

[0061] (1) Using primers SED-F, SED-R, and SC-F, SC-R1, SC-R2, SED1 protein and SpyC-G4S3 were amplified by PCR using Saccharomyces cerevisiae S228C containing SED1 protein and the synthesized pUC19-SpyC plasmid as templates. The PCR amplification conditions were: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 10 s, 55℃ annealing for 10 s, 72℃ extension for 10 s, 30 cycles of amplification, and a final extension at 72℃ for 10 min. The PCR products were subjected to agarose gel electrophoresis, and the DNA fragments were recovered using a gel extraction kit to obtain the SED1 fragment and the SpyC-(G4S)3 fragment. Then, using primers SC-F and SED-R, the SED1 fragment and the SpyC-(G4S)3 fragment were used as templates for PCR amplification. The PCR products were subjected to agarose gel electrophoresis, and the DNA fragments were recovered using a gel extraction kit to obtain the SpyC-(G4S)3-SED1 fragment.

[0062] The primers used are as follows:

[0063] SED-F: GGTGGTGGTGGTTCTATGAAATTATCAACTGTCCTATTATCTGCCGG (SEQ NO: 6);

[0064] SED-R: GTTCTAGAAAGCTGGCGGCCCGCCGCGGTTATAAGAATAACATAGCA

[0065] ACACCAGCCAAA(SEQ NO: 7);

[0066] SC-F: CGAGAAAAGAGAGGCTGAAGCTGAATTCGATAGTGCTACCCATATTAAAT TCTCAAAAC (SEQNO: 8);

[0067] SC-R1: CAGAACCACCACCACCAGAACCACCACCACCAATATGAGCGTCACCT TTAGTTGC (SEQNO: 9);

[0068] SC-R2: AGTTGATAATTTCATAGAACCACCACCACCAGAACCACCACCACCA

[0069] GAAC (SEQ NO: 10);

[0070] (2) The plasmid pPICZαA was linearized using restriction endonucleases EcoRI and NotI, and then subjected to agarose gel electrophoresis. The linearized plasmid was recovered using a gel recovery kit.

[0071] (3) The SpyC-(G4S)3-SED1 fragment was ligated with the vector pPICZαA, which was linearized using restriction endonucleases EcoR I and Not I, using a seamless cloning kit. The ligation product was introduced into E. coli DH5α by chemical transformation. 5 μL of the ligation product was mixed with 50 μL of competent E. coli DH5α cells, incubated on ice for 20-30 min, placed in a 42℃ water bath for 45 s, and then incubated on ice for 1-2 min. After revival culture for 1 h, 400 μL of LB incubation medium was added, and the cells were collected and plated on solid LB plates containing 25 μg / mL bleomycin. After overnight culture, single colonies were picked and PCR was performed using primers SC-F and SED-R to obtain the recombinant plasmid pPICZαA-SpyC-(G4S)3-SED1( Figure 1 ).

[0072] (4) The recombinant plasmid was linearized with restriction endonuclease Sac I and electroporated into Pichia pastoris GS115. 10 μL of the linearized DNA fragment was mixed with 100 μL of competent Pichia pastoris GS115 cells and incubated on ice for 5 min. The mixture was then pipetted into an electroporation cuvette. Electroporation conditions: 1.5 kV, 25 μF, 5 ms. Immediately after electroporation, a 1:1 mixture of 600 μL LYPD and 1 M sorbitol was added to the cuvette. The mixture was incubated at 30 °C on a shaker for 2 h. An appropriate amount was plated on a YPDZ plate, and the recombinant strain was screened. Colony PCR was performed using two primers, PIC-SC-cx-F and PIC-SC-cx-R, for verification.

[0073] The primers used are as follows:

[0074] PIC-SC-cx-F: ACTACTATTGCCAGCATTGCTGCT (SEQ NO: 13);

[0075] PIC-SC-cx-R: CAGTGGTTGGAGCCTCTGTT (SEQ NO: 14).

[0076] 2. Surface display effect verification

[0077] 2.1 Construction of the BL21(DE3)-eGFP-G4S-SpyT expression strain

[0078] The method for constructing the expression strain BL21(DE3)-eGFP-G4S-SpyT includes the following steps:

[0079] (1) Using eGFP-F and eGFP-ST-R primers, the synthesized pUC19-eGFP-G4S-SpyT plasmid was used as a template for PCR amplification. The PCR product was subjected to agarose gel electrophoresis, and the DNA fragment was recovered using a gel recovery kit to obtain the sfGFP-G4S-SpyT fragment.

[0080] The primers used are as follows:

[0081] eGFP-F: CCATGGGCCACCATCATCATCATCATGTGAGCAAGGGCGAGGAGC (SEQ NO: 11);

[0082] eGFP-ST-R: TGGTGGTGGTGGTGCTCGAGTTACTTGGTGGGCTTGTAGGC (SEQ NO: 12);

[0083] (2) The plasmid pET28a was linearized with restriction endonucleases Nco I and Xho I, and then subjected to agarose gel electrophoresis. The linearized plasmid was recovered using a gel recovery kit.

[0084] (3) The eGFP-G4S-SpyT fragment was ligated with the linearized vector pET28a containing restriction endonucleases Nco I and Xho I using a seamless cloning kit. The ligation product was introduced into *E. coli* DH5α via chemical transformation, and the bacterial cells were collected and plated on solid LB agar plates containing 50 μg / mL kanamycin. After overnight culture, single colonies were picked and PCR was performed using eGFP-F and eGFP-ST-R to obtain the recombinant plasmid pET28a-eGFP-G4S-SpyT. The recombinant plasmid was transformed into *E. coli* BL21(DE3) to obtain the expression strain. The strain was induced at 28°C with 0.2 mM IPTG, collected, and purified by nickel column chromatography to obtain the eGFP-G4S-SpyT protein.

[0085] 2.2 The display capabilities of the constructed surface display system were verified.

[0086] The display capabilities of the constructed single-copy surface display system were verified. The specific steps are as follows:

[0087] Collect 500 μL of Pichia pastoris cells induced with 2% methanol for 3 days in a shake flask, centrifuge at 4000 rpm for 2 min to collect the cells. Discard the supernatant, weigh the cells (wet weight 0.02 g), wash the cells twice with PBS solution containing 1% BSA at pH 7.4, then resuspend the cells in 500 μL of eGFP protein at a concentration of 0.6 mg / mL. Mix thoroughly on a mixer and incubate at room temperature for 30 min. After incubation, collect the cells, wash them twice with PBS solution containing 1% BSA at pH 7.4, and resuspend them in PBS solution containing 1% BSA at pH 7.4. Take 1 mL of the sample and analyze the efficiency using flow cytometry.

[0088] Experimental results: such as Figure 2 As shown, the left image is a flow cytometry image of GS115 binding to eGFP-G4S-SpyT, serving as a blank reference; the right image is a schematic diagram of the binding of surface-displaying strain (GS115-pPICZαA-SpyC-G4S3-SED1) to eGFP-G4S-SpyT. The indirect display efficiency of Pichia pastoris was 59.99%, and the display efficiency of the strain needs to be improved.

[0089] Example 2: Construction and Application of a Multi-Copy Surface Display System

[0090] 1. Construction of a multi-copy surface display system

[0091] The method for constructing a multi-copy surface display system includes the following steps ( Figure 3 ):

[0092] (1) The pPICZαA-SpyC-(G4S)3-SED1 plasmid constructed in Example 1 was digested with Bgl II and Avr II to obtain the SpyC-(G4S)3-SED1 fragment. The pPICZαA-SpyC-(G4S)3-SED1 plasmid was digested with Avr II and BamHI to obtain a multi-copy plasmid backbone. Agarose gel electrophoresis was performed, and the digested products were recovered using a gel recovery kit. The vector and fragment were reacted with T4 DNA ligase at a ratio of 1:3 and incubated overnight at 4°C. The ligation product was introduced into Escherichia coli DH5α by chemical transformation. The bacterial cells were collected and plated on solid LB plates containing 25 μg / mL bleomycin. The size of the plasmid was compared with that of a one-copy plasmid to obtain a two-copy plasmid, and so on to obtain three- and four-copy recombinant plasmids. The obtained plasmid was double-digested with Bgl II and Avr II enzymes, and verified by agarose gel electrophoresis. The multi-copy plasmid was constructed as shown in the diagram. Figure 3 As shown.

[0093] like Figure 4 As shown: 1 is a single-copy plasmid, 2 is the vector and fragment after double digestion, 3 is a two-copy plasmid, 4 is a two-copy plasmid digested with Bgl II and Avr II, 5 is a three-copy plasmid, 6 is a three-copy plasmid digested with Bgl II and Avr II, 7 is a four-copy plasmid, 8 is a four-copy plasmid digested with Bgl II and Avr II, and M is the maker.

[0094] (2) The multi-copy recombinant plasmid was linearized with Avr II, recovered by gel, and transformed into Pichia pastoris GS115 competent cells to obtain a multi-copy recombinant strain on the surface. Colony PCR was performed using primers PIC-SC-cx-F and PIC-SC-cx-R to verify the results.

[0095] 2. Effect Verification

[0096] The display efficiency and display ability of the constructed Pichia pastoris multicopy surface display strain were determined. The protocol was as follows: 500 μL of Pichia pastoris cells induced with 2% methanol for 3 days were collected by centrifugation at 4000 rpm for 2 min, the supernatant was discarded, and the wet weight of the cells was weighed to be 0.02 g. The cells were washed twice with PBS solution containing 1% BSA at pH 7.4, and then resuspended with 500 μL of eGFP protein at a concentration of 0.6 mg / mL. The mixture was thoroughly mixed on a mixer and incubated at room temperature for 30 min. After incubation, the supernatant was collected by centrifugation. 200 μL of the eGFP supernatant before and after incubation were transferred to black ELISA plates, and the fluorescence value was detected using a multi-functional ELISA reader (excitation wavelength 488 nm, emission wavelength 511 nm). The fluorescence value of the remaining eGFP in the supernatant indicated the amount of eGFP bound to the surface of Pichia pastoris cells. The bacterial cells were washed twice with PBS solution containing 1% BSA at pH 7.4, and then resuspended in PBS solution containing 1% BSA at pH 7.4. A 1 mL sample was taken and analyzed by flow cytometry to demonstrate the efficiency.

[0097] Experimental results are as follows Figure 5 As shown, the display efficiency of the one-copy strain was 53.87%, the two-copy strain was 64.87%, the three-copy strain was 72.37%, and the four-copy strain was 98.67%. These results indicate that the display efficiency of SpyC on the surface of Pichia pastoris increases with the increase of gene expression cassette copy number, leading to an increase in the amount of target protein bound to SpyC. The display efficiency of Pichia pastoris reached its highest at four copies. Calculations showed that 1g of wet yeast cells can bind 1.6mg of eGFP protein, meaning that the average number of eGFP molecules that can be indirectly displayed on the surface of each Pichia pastoris cell is 1.1×10⁻⁶. 6 indivual.

[0098] Example 3: Surface display application of organophosphorus hydrolase OPH

[0099] 1. Bacterial activity detection

[0100] The OPH-(G4S)3-SpyT protein expressed by Pichia pastoris, whose gene sequence is shown in SEQ NO: 5, was bound to a four-copy surface-display strain, and the activity of the OPH-bound bacteria was measured. The protocol was as follows: 500 μL of the four-copy surface-display cell pellet was collected by centrifugation, and 200 μL of OPH-(G4S)3-SpyT fermentation supernatant was added. After incubation for 30 min, the cells were collected by centrifugation at 4000 rpm for 2 min. The cells were washed twice with PBS and then diluted with 1 mL of Ly-NaOH (pH 9, purchased from Thermo Fisher Scientific) solution for later use. Take 900 μL of Gly-NaOH (pH 9) containing 50 mmol / L methyl parathion substrate and preheat at a certain temperature for 5 min. Add 100 μL of diluted bacterial solution to the system and react for 10 min. Stop the reaction by adding 1 mL of 10% trichloroacetic acid, and then add 1 mL of 10% sodium carbonate for color development. Measure the specific absorption peak of the generated p-nitrophenol at 410 nm using a microplate reader, and calculate the enzyme activity based on the absorbance. One enzyme activity unit (U) is defined as the amount of enzyme required to generate 1 μmol of p-nitrophenol per minute.

[0101] The experimental results are as follows: Based on the amount of eGFP protein bound by the four-copy strain, the amount of organophosphorus hydrolase bound to the surface of Pichia pastoris was calculated to be 1.882 mg of organophosphorus hydrolase bound to 1 g of wet weight cell, thus determining that the specific enzyme activity of the strain exhibiting organophosphorus hydrolase on the surface is 22.56 U / mg.

[0102] Under pH 9 (Gly-NaOH) conditions, the relative enzyme activities of immobilized and dissociated enzymes on the cell surface were measured at 30℃, 35℃, 40℃, 45℃, 50℃, 55℃, 60℃, 65℃, and 70℃. Figure 6 As shown, the immobilized enzyme exhibited the highest activity at 45℃, followed by a slight decrease in activity with increasing temperature, but still maintained 60% activity at 70℃. The free enzyme showed the highest activity at 50℃, but only 25% activity at 60℃, and virtually no activity at 70℃. These results indicate that immobilization lowers the optimal temperature for OPH, but immobilization on the cell surface significantly improves the thermal stability of OPH.

[0103] 2. Cell recovery rate

[0104] The recovery rate of the displayed cells was simultaneously determined under two conditions: the optimal reaction temperature and room temperature. The protocol was as follows: After reacting for 10 min, the bacteria were centrifuged, and the supernatant was used to determine the amount of p-nitrophenol produced. The bacterial pellet was resuspended in 500 μL of Gly-NaOH (pH 9), transferred to another new centrifuge tube, centrifuged, resuspended in 995 μL of Gly-NaOH (pH 9), and 5 μL of methyl parathion substrate was added. The enzyme activity was measured again. The enzyme activity measured the first time was taken as 100% relative enzyme activity.

[0105] The results are as follows Figure 7 As shown, under room temperature and 45°C conditions, the enzyme activity decreased slightly after each cycle, but still had more than 50% enzyme activity after 5 cycles. However, with the increase of washing times, the bacterial cells were also lost, and the actual number of cycles that can be recycled may be higher, providing a basis for practical applications.

[0106] In summary, this Pichia pastoris indirect surface display system integrates the SED1 anchoring protein from Saccharomyces cerevisiae S228C and the specific affinity SpyC from Streptococcus pyogenes into its genome, enabling stable expression of SED1 and SpyC in Pichia pastoris cells. Furthermore, by constructing multiple copies, the anchoring protein is expressed at high levels, improving display efficiency. The constructed strain, through SpyC / T interaction, can specifically bind to target proteins containing the SpyTag tag, and then display them on the surface of Pichia pastoris cells to perform the target protein function. The system successfully immobilizes organophosphorus hydrolases on the surface of Pichia pastoris cells, improving their stability and allowing for recycling.

[0107] Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those skilled in the art can make changes, modifications, substitutions and variations to the above embodiments within the scope of the present invention.

Claims

1. A SpyC / T-based indirect surface display system for Pichia pastoris, characterized in that, The Pichia pastoris indirect surface display system uses SED1 protein from Saccharomyces cerevisiae as an anchoring protein to immobilize SpyC from Streptococcus pyogenes on the anchoring protein on the surface of Pichia pastoris cells. The nucleotide sequence encoding the SED1 protein derived from *Saccharomyces cerevisiae* is shown in SEQ NO: 1; the nucleotide sequence encoding the SpyC protein derived from *Streptococcus pyogenes* is shown in SEQ NO: 2; the gene sequence encoding the SpyC protein derived from *Streptococcus pyogenes* is cloned upstream of the gene sequence encoding the SED1 protein derived from *Saccharomyces cerevisiae*, and the gene of the SpyC protein derived from *Streptococcus pyogenes* is linked to the gene of the SED1 protein derived from *Saccharomyces cerevisiae* via the (G4S)3 gene.

2. The Pichia pastoris indirect surface display system based on SpyC / T according to claim 1, characterized in that, In the Pichia pastoris indirect surface display system, the copy number of the expression cassette of the SED1 protein from Saccharomyces cerevisiae and the SpyC fusion gene from Streptococcus pyogenes is 1 to 4.

3. The Pichia pastoris indirect surface display system based on SpyC / T according to claim 1, characterized in that, In the Pichia pastoris indirect surface display system, the target protein is a protein or peptide containing a Spy-Tag tag; the target protein is reacted with SpyC derived from Streptococcus pyogenes to indirectly display the target protein on the surface of Pichia pastoris.

4. A method for constructing a SpyC / T-based Pichia pastoris indirect surface display system according to any one of claims 1 to 3, characterized in that, Includes the following steps: (1) The gene sequence encoding SpyC from Streptococcus pyogenes is cloned upstream of the gene sequence of SED1 protein from Saccharomyces cerevisiae, and the gene of SpyC from Streptococcus pyogenes is linked to the gene of SED1 protein from Saccharomyces cerevisiae through the (G4S)3 gene. (2) Transform Pichia pastoris cells and screen positive transformants according to the screening markers on the expression vector to obtain the Pichia pastoris indirect surface display system.

5. The method for constructing the Pichia pastoris indirect surface display system based on SpyC / T according to claim 4, characterized in that, Step (2) includes the following specific steps: (2-1) The fusion gene was digested with EcoRI and NotI enzymes and cloned into the pPICZαA vector to obtain a single-copy recombinant plasmid; (2-2) Linearize the single-copy recombinant plasmid described in step (2-1) with SacI and transform it into Pichia pastoris cells. Select positive transformants according to the screening markers on the expression vector to obtain the Pichia pastoris single-copy indirect surface display system.

6. The method for constructing the Pichia pastoris indirect surface display system based on SpyC / T according to claim 5, characterized in that, In step (2-1), the single-copy recombinant plasmid is prepared into a multi-copy recombinant plasmid; The multi-copy recombinant plasmid includes at least one of two-copy recombinant plasmids, three-copy recombinant plasmids, and four-copy recombinant plasmids.

7. The method for constructing the Pichia pastoris indirect surface display system based on SpyC / T according to claim 6, characterized in that, The multi-copy recombinant plasmid was prepared by the following method: the single-copy recombinant plasmid was digested with BglII and AvrII enzymes to recover the expression cassette fragment; the single-copy recombinant plasmid was digested with AvrII and BamHI enzymes to obtain a multi-copy plasmid backbone; the expression cassette fragment and the plasmid backbone were ligated to obtain the multi-copy recombinant plasmid.

8. The method for constructing the Pichia pastoris indirect surface display system based on SpyC / T according to any one of claims 4 to 7, characterized in that, The Pichia pastoris cells were Pichia pastoris GS115.

9. The application of the SpyC / T-based Pichia pastoris indirect surface display system, characterized in that, The SpyC / T-based Pichia pastoris indirect surface display system according to any one of claims 1 to 3 is used to immobilize target proteins containing SpyTag.