Application of the coat protein SlAV1-CP of the tomato stolonifer fungal virus in improving plant defense capabilities

Abstract

The present invention relates to the biological field, and in particular to the application of tomato creeping mold fungal virus coat protein SlAV1-CP in improving plant defense capabilities. The tomato creeping mold fungal virus coat protein SlAV1-CP, the encoding gene SlAV1-CP or the biological material containing the encoding gene SlAV1-CP provided by the present invention can activate plant immune response, increase the expression amount of defense-related genes in plants, thereby inducing plants to produce disease resistance, reduce the infection of pathogens, and provide a new way to improve plant resistance. At the same time, it also provides new materials for the research and development of new plant immune inducers (plant immune activators). Moreover, the protein has been verified in a variety of plants, and all have the effect of improving plant disease resistance, so it can be applied to the prevention and treatment of a variety of plant diseases.

Description

Technical Field

[0001] The invention relates to the biological field, and in particular to application of a tomato stolonifer fungal virus coat protein SlAV1-CP in improving plant defense capability. Background Art

[0002] Tomato gray leaf spot is a new and popular fungal disease in recent years, and the incidence rate is increasing year by year. The pathogen is a fungus of the genus Stemphylium of the class Hypocrea of ​​the subphylum Ascomycetes, mainly caused by infection by Stemphylium solani and S. lycopersici. The disease occurs worldwide, and is particularly serious in warm and humid areas. In recent years, it has been common in spring and summer in southern and northern my country, especially in protected cultivation in early spring, which can cause tomato quality to decline and yield to drop sharply by 20%-80%, causing serious impact on tomato production.

[0003] Traditional tobacco mosaic virus (TMV) is the pathogen of tobacco mosaic disease and belongs to the Tobamovirus group. TMV has a wide host range and can infect more than 400 plant species from 38 families. When TMV infects plants, its genetic material will rapidly replicate after invading tobacco plant cells. Since tobacco does not have the ability and system to completely resist the virus, the infected tobacco plants remain in a susceptible state. The chlorophyll of the diseased plants is destroyed, which weakens the photosynthesis of the plants and prevents them from growing healthily, resulting in deformities, dwarfing and even death. The tobacco leaves are basically no longer worth using, causing hundreds of millions of dollars in losses every year worldwide.

[0004] Tomato bacterial spot is a disease caused by Pseudomonas syringaepv.tomato, which occurs on tomatoes and is one of the major diseases that harm tomato production worldwide. It mainly harms leaves, stems, flowers, petioles and fruits, especially leaf margins and immature fruits. The diseased plants grow slowly, and the fruit expansion is hindered, which seriously affects the fruit quality. After the disease occurs, the yield is generally reduced by 10-30%, and the yield of severely affected plots is reduced by more than 50%.

[0005] The reduction in crop yields caused by pathogen infection has become a serious challenge to global food security. At present, the main method for preventing and controlling tomato gray leaf spot, tomato bacterial spot and tobacco mosaic virus is chemical control. The long-term and large-scale use of chemical pesticides will cause the pathogens to develop drug resistance and cause harm to the environment and human health. In addition, the drugs used to prevent and control bacterial diseases in production are mainly antibiotics and copper preparations, and there are few effective anti-plant virus preparations, and the control effect is not good. Therefore, biological control is becoming more and more important.

[0006] Fungal viruses are a type of virus that uses fungi as hosts and are widely found in fungi. A few of these viruses can significantly reduce the pathogenicity of fungi after infecting plant pathogenic fungi. This type of fungal virus is called a low-toxic fungal virus and has the potential to be used for biological control of plant diseases. In my country, the application of fungal viruses in biological control of plant diseases has entered the application stage. In 2023, Professor Jiang Daohong's team at Huazhong Agricultural University developed plant vaccines developed from fungal viruses into three microbial agents: "Green Oil Treasure" (for rapeseed), "Green Rice Treasure" (for rice), and "Green Wheat Treasure" (for wheat). Using them to mix seeds can achieve the integration of sowing and disease prevention and promote the healthy growth of crops. In recent years, with the in-depth study of molecular plant pathology, it has been found that many elicitors can activate plant immune responses and allow plants to develop strong and lasting resistance to pathogens. Based on this, the development of plant immune inducers (plant immune activators) for plant diseases has also become a research hotspot. The development and utilization of plant immune inducers (plant immune activators) is a green and environmentally friendly way to prevent and control plant diseases. The present invention intends to achieve effective prevention and treatment of plant diseases by developing the capsid protein of fungal virus as a new elicitor. Summary of the invention

[0007] The purpose of the present invention is to provide a method for improving the defense capability of plants by using a capsid protein SlAV1-CP of a tomato stolonifer fungal virus to solve the problems of the prior art. The capsid protein SlAV1-CP of a tomato stolonifer fungal virus provided by the present invention can effectively improve the defense capability of plants and ultimately achieve the prevention and control of diseases.

[0008] To achieve the above object, the present invention provides the following solutions:

[0009] The present invention provides a tomato stolonifer fungal virus coat protein SlAV1-CP, a coding gene SlAV1-CP or a biological material containing the coding gene SlAV1-CP for improving plant defense capability. The amino acid sequence of the tomato stolonifer fungal virus coat protein SlAV1-CP is shown in SEQ ID NO.1, or is a sequence with a homology of more than 50% to the sequence shown in SEQ ID NO.1; the nucleotide sequence of the coding gene SlAV1-CP is shown in SEQ ID NO.2, or is a sequence with a homology of more than 70% to the sequence shown in SEQ ID NO.2.

[0010] Preferably, the defense capability includes but is not limited to disease resistance.

[0011] Preferably, the disease resistance includes but is not limited to the ability to resist fungal diseases, bacterial diseases, viral diseases or oomycete diseases.

[0012] Preferably, the plant includes but is not limited to tomato, tobacco or pepper.

[0013] Preferably, the biological material includes but is not limited to a recombinant vector, an expression cassette or a recombinant bacterium.

[0014] Preferably, the fungal disease is tomato gray leaf spot; the bacterial disease is tomato bacterial spot; and the viral disease is tobacco mosaic.

[0015] The invention provides a method for improving the defense ability of plants, comprising the step of spraying plants with a solution containing tomato stolonifer fungal virus coat protein SlAV1-CP.

[0016] Further preferably, the concentration of the capsid protein SlAV1-CP of the tomato stolonifer fungal virus in the solution is 0.03 mg / mL.

[0017] Preferably, the plant comprises tomato, tobacco or pepper.

[0018] The present invention provides a tomato stolonifer fungal virus coat protein SlAV1-CP, a coding gene SlAV1-CP or a biological material containing the coding gene SlAV1-CP for use in preparing a plant immune activator, wherein the amino acid sequence of the tomato stolonifer fungal virus coat protein SlAV1-CP is shown in SEQ ID NO.1; the nucleotide sequence of the coding gene SlAV1-CP is shown in SEQ ID NO.2.

[0019] The present invention provides a plant immunity activator, wherein the effective component of the plant immunity activator comprises a tomato stolonifer fungal virus coat protein SlAV1-CP; the amino acid sequence of the tomato stolonifer fungal virus coat protein SlAV1-CP is shown in SEQ ID NO.1.

[0020] The present invention discloses the following technical effects:

[0021] The tomato creeping mold fungal virus coat protein SlAV1-CP, the encoding gene SlAV1-CP or the biological material containing the encoding gene SlAV1-CP provided by the present invention can activate the plant immune response, increase the expression of defense-related genes (SlNPR1, SlPR1, NtPR1 and CaPR1) in the plant, thereby inducing the plant to produce disease resistance, reduce the infection of pathogens, provide a new way to improve plant resistance, and also provide new materials for the research and development of new plant immune inducers (plant immune activators). Moreover, the protein has been verified in a variety of plants and has the effect of improving plant disease resistance, so it can be applied to the prevention and treatment of a variety of plant diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0023] Figure 1 The SDS-PAGE detection diagram after SlAV1-CP protein purification (A) and the SDS-PAGE detection diagram after empty protein EV purification (B); wherein, M is protein maker, S is precipitate after bacterial cell disruption, P is supernatant after bacterial cell disruption, FT is Ni column flow-through liquid, E0-E300 is 0-300mM imidazole concentration gradient elution liquid; SlAV1-CP is SlAV1-CP protein, EV is empty protein EV;

[0024] Figure 2 The WB detection image of SlAV1-CP protein and empty protein EV after purification; SlAV1-CP is SlAV1-CP protein, and EV is empty protein EV;

[0025] Figure 3 The diagrams are the expression of plant defense-related genes induced after different treatments; A is the expression diagram of SlNPR1; B is the expression diagram of SlPR1a; C is the expression diagram of CaPR1; D is the expression diagram of NtPR1; SlAV1-CP is SlAV1-CP protein, and EV is empty protein EV;

[0026] Figure 4 The results of spraying different proteins on tomato leaves to induce resistance to Stolonifera; A is spraying 1×PBS, B is spraying empty protein EV, C is spraying SlAV1-CP protein; SlAV1-CP is SlAV1-CP protein, EV is empty protein EV;

[0027] Figure 5 The incidence rate (A) and disease index (B) of tomatoes under different treatments; SlAV1-CP is SlAV1-CP protein, EV is empty protein EV;

[0028] Figure 6 The results of spraying different proteins on Arabidopsis leaves to induce Arabidopsis resistance to Pseudomonas syringae PstDc3000; A is spraying 1×PBS buffer, B is spraying empty protein EV, C is spraying SlAV1-CP protein; SlAV1-CP is SlAV1-CP protein, EV is empty protein EV;

[0029] Figure 7These are the results of inducing the resistance response of heartleaf tobacco to tobacco mosaic virus after spraying different proteins on the leaves of heartleaf tobacco; A represents spraying with 1×PBS buffer, B represents spraying with empty protein EV, and C represents spraying with SlAV1-CP protein; SlAV1-CP represents SlAV1-CP protein, and EV represents empty protein EV. DETAILED DESCRIPTION

[0030] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0031] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0032] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0033] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0034] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0035] The cystic Stolonifer strain SvHN-02 was isolated from lettuce leaves infected with leaf spot disease; the specific isolation method is detailed in Chinese patent application 202011153985.3; the above strain is preserved by Hunan Agricultural University, and it is promised to be open to the public within 20 years from the date of application of this invention.

[0036] In the early stage, our research group also discovered a new low-toxic fungal virus SlAV1 from tomato Sclerotium, which interferes with the biosynthesis of fungal pathogenicity-related toxin Altersolanol A, causing Sclerotium to lose its pathogenicity. Sclerotium carrying SlAV1 virus or Sclerotium with integrated SlAV1 virus capsid protein gene sequence can be transformed from pathogenic bacteria to biocontrol bacteria, and used as "plant vaccines" to improve plant resistance to highly toxic Sclerotium strains. However, if fungi carrying viruses are used directly for biological control, there is a risk that the fungus will lose the virus and restore its pathogenicity. The strains that cause fungi to lose their pathogenicity due to the transfer of viral genes involve the application of genetically modified microorganisms, which require safety evaluation and cannot be directly applied at present. With the deepening of the research on the subject, it was found that it is the capsid protein of the SlAV1 virus that activates the plant's immune function, which can be used as an elicitor to induce plants to produce disease resistance.

[0037] Example 1 Prokaryotic expression and purification of SlAV1-CP protein.

[0038] 1. Construction of SlAV1-CP prokaryotic expression vector

[0039] The specific operation process is as follows:

[0040] (1) Extraction of dsRNA from the S. stolonifer virus SlAV1

[0041] The extraction of viral dsRNA adopts cellulose CF-11 affinity chromatography. The specific extraction method is as follows:

[0042] A. After 5 days of shaking culture, the mycelium was filtered and dried, and then ground into powder using liquid nitrogen. 0.1 g of powder was placed in a 2 mL centrifuge tube, and 700 μL of STE buffer was immediately added and shaken for 3 min.

[0043] B. Add 700 μL RNA extraction phenol, shake for 3 min, and centrifuge at 12000 rpm at 4°C for 3 min;

[0044] C. Take the supernatant, add 700 μL of a mixture of chloroform and isoamyl alcohol (the volume ratio of chloroform to isoamyl alcohol in the mixture is 24:1), shake for 3 minutes, and centrifuge at 12000 rpm and 4°C for 3 minutes;

[0045] D. Take the supernatant, combine the two tubes into one tube (1 mL in total), add 0.1 g cellulose powder and 200 μL anhydrous ethanol, shake for 5 min, place on ice for precipitation for 5 min, continue shaking for 5 min, and centrifuge at 12,000 rpm and 4°C for 3 min;

[0046] E. Remove the supernatant, add 1 mL TE buffer and 200 μL anhydrous ethanol, shake for 2 min, and centrifuge at 12000 rpm and 4°C for 3 min;

[0047] F. Remove the supernatant, add 420 μL TE buffer, shake thoroughly for 3 min, and centrifuge at 12000 rpm and 4°C for 3 min;

[0048] G. Take 400 μL of the supernatant, add an equal volume of isopropanol and precipitate at -20°C for 1 h, and centrifuge at 12000 rpm and 4°C for 15 min;

[0049] H. Remove the supernatant, add 1 mL of 70% (volume percentage) ethanol, centrifuge at 12,000 rpm and 4°C for 10 min, remove the supernatant, and repeat once;

[0050] I. After the precipitate is air-dried, 50 μL of DEPC water is added to dissolve it, and 1 / 5 volume of DNA buffer, 2 μL DNase I and 1 μL S1 Nuclease are added, and the mixture is incubated at 37°C in a water bath for 40 min to obtain dsRNA extract;

[0051] J. Take 5 μL of dsRNA extract and run electrophoresis on 1% agarose gel to observe the dsRNA bands and take photos for preservation.

[0052] (2) cDNA synthesis

[0053] Reverse transcription refers to the instructions (MightyScript First-Strand cDNA Synthesis Master Mix Kit from Shanghai Bioengineering), the specific operation method is as follows:

[0054] A. Add 3 μL RNA, 1.5 μL Oligo dT, and 2 μL DMSO into a PCR tube;

[0055] B. After denaturation at 99℃ for 3 minutes, quickly take out the PCR tube and cool it on ice;

[0056] C. Add 5 μL of gDNA digester mix to the PCR tube, add 3 μL of ddH2O to 15 μL;

[0057] D. Briefly centrifuge to mix, and incubate at 42°C for 15 min;

[0058] E. Add 5 μL of 4×ⅢM-MLV RT Mix to the above PCR tube;

[0059] F. Reverse transcription reaction was performed at 25°C for 5 min, 55°C for 15 min, and 85°C for 5 min;

[0060] G. The cDNA obtained from the above reaction is stored at -20℃ for future use

[0061] (3) PCR product ligation and cloning sequencing

[0062] According to the SlAV1-CP gene sequence, specific primers SlAV1-CP-F and SlAV1-CP-R were designed, wherein the nucleotide sequence of SlAV1-CP-F was ATGGCGACGTTTGGAAGTG (SEQ ID NO.3), and the nucleotide sequence of SlAV1-CP-R was GATGACACCAGAAGCCCTAC (SEQ ID NO.4); the cDNA obtained above was used as a template, and SlAV1-CP-F and SlAV1-CP-R were used for PCR amplification, and the PCR product was purified and recovered and connected to the pMD18-T vector to obtain the pMD18-T-SlAV1-CP plasmid, which was transformed into Escherichia coli DH5α competent cells. Single colonies were picked, amplified and detected with M13 vector universal primers, and the sequence was verified by Sanger sequencing, and each viral fragment was guaranteed to have more than 3 repeats.

[0063] (4) SlAV1-CP gene cloning and vector construction

[0064] The nucleic acid sequence of the SlAV1-CP gene is shown in SEQ ID NO.2, and the sequence was synthesized by Shanghai Bioengineering. The pMD18-T-SlAV1-CP plasmid was used as a template, and the primers PET32a-SlAV1-CP-TF / R (the underlined part is the sequence at both ends of the ECORI restriction site of the PET32a prokaryotic expression vector added to the 5' end of the primer) were used to amplify the SlAV1-CP full sequence and sequence it.

[0065] The nucleotide sequence of the upstream primer PET32a-SlAV1-CP-F is shown in SEQ ID NO.5, specifically: 5'- TAT CGGATCCGAATTC ATGGCGACGTTTGGAAGTGC-3'; the underlined part is the homology arm of the PET32a vector;

[0066] The nucleotide sequence of the downstream primer PET32a-SlAV1-CP-R: is shown in SEQ ID NO.6, specifically: 5'- GA CGGAGCTCGAATTC GATGACACCAGAAGCCCTACCAAC-3'; the underlined part is the homology arm of the pET32a vector.

[0067] PCR amplification reaction system (50 μL): 2×PhantaMax Buffer 25 μL, dNTP Mix (10 μm each) 1 μL, upstream primer (10 μM) 2 μL, downstream primer (10 μM) 2 μL, PhantaMax Super-Fidelity DNA Polymerase 1 μL, template cDNA 80 ng, add water to 50 μL;

[0068] Amplification was performed under the following conditions: pre-denaturation at 94°C for 5 min, denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 90 s, for 35 cycles, and finally extension at 72°C for 10 min.

[0069] Among them, the full-length protein sequence of the SlAV1-CP protein is shown in SEQ ID NO.1, specifically: MATFGSAEAYRAAQLAAIELMTRGDWGDFGGLGETSDVFAEHERFPEDPFDAPDHVDPGTAWASVATGSADDLSREVAPTAVDYVPRSEPYSVRGVDIVEPVTAFCSPADLGMANFPGNVLKGSATTLRRAGSAAANAGAILGTDMLMAPKASVQAIMARVIAALEMLQSGWDVGGPPDVGLDVRHAARDDFDVASARHPQHAWLYIPSDWTEEEVAALVSLMVEGGPAAYRWGYADGDPGGDEGVNGNPLPRDGVMPAGALWRWPGGWSNYLLIGERDRGWNVAFGGDALSVSSLSAVLRRMVEAYGQRVYLDAARAAAVANRAYCAPAYQGGGGERDIGTAFTSDRVSVRREDGTSGRLAVPARNVVKDHPGPLPDPAAGYDGGFGGVVPGGCGGRVWAAPVVPSPGDAD LVGATLAPGIDDRGPGGAGRAPPHFRTADASPAGLLVVSNHGRQLFEWAWDPPAMEVDDPREAYAVANAWVRLASCFLRHGGQVREEMRDYSVRTRAGATRTVYGTVAHATSLIMPRLNLDGWWPALIGLSVLRHDRIVPKLDRRLLRPAFTKYAADVHLLTHRTLYESGNSLADLKDALVGAKVVSRFPPAYRAGVWPHVFSDTCMPYGNYECLESGVLLGGGNETEGVGFGVQGSWKWDGAQRRAAVDGAGAPAVRQSLRALDSVARKVYFLGGSFRLDATPDRRVYVVRPPGSRLYHPYFVPVRVLEDGLPSEVRYTAIGNGALLLASGRAAEVGRASGVI;

[0070]

[0071] The sequencing result was the same as SEQ ID NO.2, indicating that the SlAV1-CP gene was successfully cloned.

[0072] (5) Vector activation and construction of recombinant vector

[0073] The pET32a vector preserved with glycerol was streaked on an LB plate and cultured overnight at 37°C. A single colony was picked in LB liquid culture medium and cultured in a shaker at 180rpm and 37°C for 14 hours for plasmid extraction. The plasmid extraction step was referred to the high-purity plasmid mini-extraction kit (DP104) of Tiangen Biochemical Technology (Beijing) Co., Ltd. The PET32a plasmid after ECORI digestion was purified and recovered, and after homologous recombination and connection with the SlAV1-CP gene fragment (SEQ ID NO.2) with the homologous arm of the pET32A vector, it was transformed into Escherichia coli DH5α, and the recombinant prokaryotic expression vector PET32a-SlAV1-CP was obtained after sequencing verification, and then transformed into the Escherichia coli prokaryotic expression strain BL21, and confirmed by PCR detection.

[0074] 2. Induction and purification of SlAV1-CP protein

[0075] (1) SlAV1-CP protein induction

[0076] The positive clone of BL21 strain of PET32a-SlAV1-CP was cultured in LB medium containing 100 μg / mL ampicillin resistance at 37°C for 12 hours. The cultured bacterial solution was transferred into 1L LB medium at a volume ratio of 1:100, and 0.01M IPTG was added to induce at 16°C for 14 hours. The resulting culture was centrifuged at 8000 rpm for 10 minutes to obtain bacterial precipitates containing SlAV1-CP and empty protein EV, respectively. The bacterial precipitate was resuspended in 1× PBS buffer, broken under an ultrasonic disruptor, and centrifuged to obtain a supernatant containing the recombinant protein SlAV1-CP protein.

[0077] (2) SlAV1-CP protein purification

[0078] The recombinant protein SlAV1-CP and empty protein EV were purified using Ni-NTA purification resin prepacked columns (Qiagen) according to the instructions.

[0079] The specific elution steps are:

[0080] A. Add 200 mL of the supernatant obtained by centrifugation into a 5 mL Ni-NTA purification resin column and flow through.

[0081] B. Add 1×PBS buffer with 10 times the volume of Ni-NTA filler to elute the impurities.

[0082] C. Add 15 times the volume of Ni-NTA filler material and 1× PBS elution buffer with 20 mM imidazole concentration to elute the impurities.

[0083] D. Add 1×PBS elution buffer with 300mM imidazole concentration which is 2 times the volume of Ni-NTA filler to elute the target protein.

[0084] Collect the eluate of each component and perform SDS-PAGE and Western blot identification. The specific steps are as follows:

[0085] A. The purified SlAV1-CP protein and the purified empty protein EV were mixed evenly with the protein loading buffer, and then boiled in a boiling water bath for 5 minutes to denature the protein.

[0086] B. Install the electrophoresis device and add an appropriate amount of electrophoresis solution. Then add 20uL of protein sample and 5μL of protein marker to the protein gel well. When SDS-PAGE electrophoresis, first use 80V voltage, and when the sample runs to the junction of the upper gel and the lower gel, change the voltage to 120V.

[0087] C. After the electrophoresis is completed, remove the upper layer of gel and place it in the transfer solution, then assemble the transfer device in the correct order. After assembly, place it in the electrophoresis tank, add the transfer solution, and transfer the membrane at 80V under ice bath conditions for 2.5 hours (the PVDF membrane should be soaked in methanol for about 15 seconds before use).

[0088] D. After the transfer is completed, rinse the protein membrane with PBST solution for 1-2 minutes, then pour off the PBST, add PBST containing 4% skimmed milk powder, shake slowly on a shaker, and block at room temperature for 1 hour.

[0089] E. Add primary antibody (purchased from abmart Shanghai) and incubate at room temperature for 1.5 h.

[0090] F. Add fluorescent secondary antibody (purchased from abmart Shanghai) and incubate at room temperature in the dark for 0.5 h.

[0091] G. Develop the color with color developing solution and take photos.

[0092] The results showed that the PET32a-SlAV1-CP plasmid was successfully constructed and transformed into E. coli, and positive transformants were obtained. After IPTG induction, the Ni strain was purified to obtain pure SlAV1-CP protein. Empty protein EV was used as the control group, and the band size was correct after SDS-PAGE and WB detection ( Figure 1-Figure 2 ).

[0093] Example 2 SlAV1-CP protein induces the expression of plant resistance-related genes

[0094] The purified SlAV1-CP was diluted to 0.03 mg / mL and sprayed on the plants at a spraying volume of 2 mL / plant. Empty protein EV was used as a control. Samples were taken at regular intervals and quick-frozen in liquid nitrogen. The plant RNA was extracted and reverse-transcribed into cDNA, and then the changes in resistance gene expression were determined.

[0095] The specific operations are as follows:

[0096] 1. SlAV1-CP protein inoculation

[0097] The SlAV1-CP protein and empty protein EV purified by Ni column and detected by SDS-PAGE and WB were inoculated into different plants (tomato, tobacco and pepper) respectively. The inoculation method was spraying. The concentration of SlAV1-CP protein was 0.03 mg / mL, the concentration of empty protein EV was 0.03 mg / mL, the spraying amount was 2 mL / plant, samples were taken at fixed time periods, and quick-frozen in liquid nitrogen for subsequent RNA extraction.

[0098] 2. Plant RNA Extraction and cDNA Preparation

[0099] Plant RNA was extracted using the Polysaccharide and Polyphenol Plant Total RNA Extraction Kit (TIANGEN), and RNA concentration and purity were measured by The analysis was performed using a ND-2000 spectrophotometer (Thermo Fisher Scientific). Complementary cDNA was synthesized using 1 μg of total RNA using HiScript IIQ RT SuperMix according to the manufacturer's instructions for subsequent qPCR experiments.

[0100] 3.qPCR Assay

[0101] The qPCR experiment used SYBR Green Pro Taq HS premixed qPCR kit (Aikerui Biotechnology). The ABIprism 7900 was used for determination. The qPCR experiment was repeated 3 times biologically and 3 times technically. The expression of plant resistance genes was normalized to the expression at 0 h. An appropriate amount of reverse transcription product was taken to detect the expression of tomato defense-related genes (SlNPR1, SlPR1a), tobacco defense gene NtPR1 and pepper defense gene CaPR1 by RT-qPCR. The real-time quantitative PCR primer sequences are shown in Table 1.

[0102] Table 1 qPCR primers

[0103] Primers sequence SEQ ID NO. SlNPR1-F GGGAAAGATAGCAGCACG 7 SlNPR1-R GTCCACACAAACACACACATC 8 SlPR1-F GAGGGCAGCCGTGCAA 9 SlPR1-R CACATTTTTCCACCAACACATTG 10 NtPR1-F GGCTCGCTGTTTCGTTTGAA 11 NtPR1-R GCAACACGGAGTTCGTTGTA 12 CaPR1-F TGGAGACTGCAGGATGCAACACT 13 CaPR1-R TACCACCCATTGTTGCACCGAAC 14

[0104] The results are as follows Figure 3As shown, compared with the control (empty protein EV), the expression levels of resistance genes in tomato, tobacco and pepper leaves sprayed with SlAV1-CP protein were upregulated within 24 hours, indicating that SlAV1-CP can activate the expression of plant disease resistance-related genes.

[0105] Example 3 Spraying SlAV1-CP protein improves plant resistance to pathogenic fungi

[0106] In order to evaluate the resistance-inducing ability of SlAV1-CP, an experiment was carried out in the greenhouse to control tomato gray leaf spot using SlAV1-CP protein.

[0107] The specific operations are as follows:

[0108] 1 egg white spray

[0109] Tomato plants with consistent growth for about 30 days were selected and sprayed with SlAV1-CP protein, empty protein EV and 1×PBS buffer respectively; the concentration of SlAV1-CP protein was 0.03 mg / mL, the concentration of empty protein EV was 0.03 mg / mL, and the spraying amount was 2 mL / plant.

[0110] 2. Inoculation of Sclerotium cysticola

[0111] 24 hours after the protein spraying, 20 mL of mycelial suspension of S. vesiculosus strain SvHN-02 was sprayed and inoculated. The OD of the mycelial suspension was 600 =2.0, the disease was observed within 14 days and the mortality of the plants was recorded. After 5 days of inoculation with the S. vesiculosus strain SvHN-02, photos were taken every day. All inoculated plants were placed in an inoculation box at 28°C and 100% relative humidity. All experiments were repeated 3 times, with at least 6 plants per treatment per repetition.

[0112] The cystic stipes strain SvHN-02 was cultured in 40 mL of PDB liquid medium at 28 °C and 180 rpm for 5 days, and then the mycelia were collected, rinsed with sterile water for 3 times, and then broken into small mycelial fragments with a juicer. The concentration was adjusted to OD 600 =2.0, and a mycelial suspension of the Sphaerotheca capsularis strain SvHN-02 was obtained.

[0113] 3. Disease index and morbidity statistics

[0114] After spraying SlAV1-CP protein, empty protein EV or 1×PBS buffer for 1 day, the cystic stolonifer strain SvHN-02 was inoculated, and the disease of tomatoes was continuously observed and photographed. The degree of susceptibility of tomatoes was divided into the following five levels according to the degree of leaf lesions of tomatoes: 0: healthy, the whole plant leaves are green; 1: a few leaves have small lesions; 2: half of the leaves have lesions; 4: most of the leaves have lesions, and the whole tomato begins to wilt; 5: all leaves have lesions and fall off, and the tomatoes wilt.

[0115] The calculation of incidence rate, disease index and prevention and treatment effect refers to the following formula:

[0116] Incidence rate = (number of cases / total number of plants) × 100%;

[0117] Disease index = ∑ (number of susceptible plants at each level × disease level) / (total number of plants × highest disease level) × 100;

[0118] Control effect (%) = (control disease index - control disease index) / control disease index × 100%.

[0119] The results are as follows Figure 4 and Figure 5 It can be seen that compared with the plants sprayed with empty protein EV and 1×PBS buffer, the tomatoes sprayed with SlAV1-CP protein showed no obvious symptoms on the 12th day, while the tomatoes sprayed with empty protein EV and 1×PBS showed obvious disease. The incidence and disease index of the treatment sprayed with SlAV1-CP protein were significantly reduced, and the control effect reached 76%. It shows that spraying SlAV1-CP protein can improve the resistance of plants to fungi.

[0120] Example 4 SlAV1-CP protein induction improves plant resistance to bacterial diseases

[0121] In order to evaluate the resistance-inducing ability of SlAV1-CP, an experiment was carried out in the greenhouse to control Pseudomonas syringae Pst Dc3000 using SlAV1-CP protein.

[0122] The specific operations are as follows:

[0123] 1. Cultivation of Pseudomonas syringae

[0124] The strain stored at -80℃ was inoculated on a KB medium plate containing rifampicin by the streaking method, and incubated upside down in a constant temperature incubator at 28℃ for 48h. When the colony grew to an appropriate size, a single colony was picked and transferred to a liquid culture medium of KB containing rifampicin, and cultured in a shaker at 28℃, 280rpm, for 48h for use.

[0125] 2 egg whites for sprinkling

[0126] Arabidopsis thaliana with the same growth for about 20 days were selected and sprayed with equal amounts of SlAV1-CP protein, empty protein EV and 1×PBS buffer respectively; the concentration of SlAV1-CP protein was 0.03 mg / mL, the concentration of empty protein EV was 0.03 mg / mL, and the spraying amount was 2 mL / plant.

[0127] 3. Pseudomonas syringae infection

[0128] Transfer the bacterial suspension activated at 28℃ for 48h into a 1.5mL centrifuge tube, centrifuge at 12000×g for 1min, remove the supernatant, resuspend with sterile deionized water, repeat centrifugation once, remove the supernatant, add 1mL sterile deionized water and suspend evenly. Dilute the resuspended bacterial suspension to 10 7 CFU / mL(OD 600 =0.5, corresponding to OD 600 The value is calculated by measuring the OD value by gradient dilution of the bacterial solution and applying the culture medium to count the number of samples and then making a standard curve. The Arabidopsis leaves were injected with a sterile syringe without the needle. One leaf of each Arabidopsis plant was selected and injected with 20 μL of bacterial suspension. The leaves were marked after injection. Samples were taken 3 days after inoculation. Infection and sampling were carried out at 12 noon every day.

[0129] 4 Colony count

[0130] Cut off the Arabidopsis leaves injected with bacterial solution, cut small pieces with a hole puncher, add 1mL sterile deionized water to grind, dilute 10 times and then spread on the plate. Place the culture medium plate in a 28℃ incubator for 48h, take it out and observe the number of Pseudomonas syringae colonies growing on it.

[0131] The results are as follows Figure 6 As shown, Arabidopsis leaves sprayed with SlAV1-CP protein had fewer Pseudomonas syringae colonies than Arabidopsis leaves sprayed with 1× PBS buffer and empty protein EV, with a control effect of 80.3%, indicating that spraying SlAV1-CP can improve plant resistance to bacteria.

[0132] Example 5 SlAV1-CP protein induction improves plant resistance to viruses

[0133] In order to evaluate the resistance-inducing ability of SlAV1-CP protein, an experiment on using SlAV1-CP protein to control tobacco mosaic virus was carried out in a greenhouse.

[0134] The control effect is calculated according to the following formula:

[0135] Control effect (%) = (number of lesions on control leaves - number of lesions on control leaves) / number of lesions on control leaves × 100%.

[0136] The specific operations are as follows:

[0137] 1 egg white spray

[0138] Heartleaf tobacco plants with the same growth for about 20 days were selected and sprayed with equal amounts of SlAV1-CP protein, empty protein EV and 1×PBS buffer respectively; the concentration of SlAV1-CP protein was 0.03 mg / mL, the concentration of empty protein EV was 0.03 mg / mL, and the spraying amount was 2 mL / plant.

[0139] 2 Tobacco mosaic virus inoculation

[0140] 24 hours after spraying SlAV1-CP protein, empty protein EV and 1×PBS buffer, quartz sand was used to smear the heart leaf tobacco leaves, and then sprayed with tobacco mosaic virus. The inoculation amount of tobacco mosaic virus was 2mL. The disease was observed within 5 days and the spot rate was recorded. All inoculated plants were placed in an inoculation box at 28°C and 100% relative humidity. All experiments were repeated 3 times, with at least 6 plants per treatment in each repetition.

[0141] The tobacco mosaic virus used for inoculation was extracted from tobacco infected with tobacco mosaic virus and diluted 10 times after extraction to a concentration of 20 mg / mL.

[0142] The results are as follows Figure 7 As shown, the heartleaf tobacco sprayed with SlAV1-CP protein had fewer virus spots than the heartleaf tobacco sprayed with empty protein EV and 1×PBS buffer, with a control effect of 60.8%, indicating that spraying SlAV1-CP can improve plant resistance to viruses.

[0143] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. Application of the tomato stolonifer fungal virus coat protein SlAV1-CP, the coding gene SlAV1-CP or the biomaterial containing the coding gene SlAV1-CP in improving the plant's resistance to stolonifer, Pseudomonas syringae and tobacco mosaic virus, characterized in that: The amino acid sequence of the tomato stolonifer fungal virus coat protein SlAV1-CP is shown in SEQ ID NO.1; the nucleotide sequence of the coding gene SlAV1-CP is shown in SEQ ID NO.2; and the biological material includes a recombinant vector or a recombinant bacterium.

2. The use according to claim 1, characterized in that: The plants include tomatoes, tobacco or peppers.

3. A method for improving the resistance of plants to Sclerotium sphaeroides, Pseudomonas syringae and tobacco mosaic virus, characterized in that: The method comprises the step of spraying plants with a solution containing the tomato stolonifer fungal virus coat protein SlAV1-CP; the amino acid sequence of the tomato stolonifer fungal virus coat protein SlAV1-CP is shown in SEQ ID NO.

1.

4. The method according to claim 3, characterized in that The plants include tomatoes, tobacco or peppers.

Images