Application of Medicago truncatula gene STMP in improving salt tolerance of Medicago truncatula

Abstract

The present invention discloses the application of the Medicago truncatula gene STMP in improving the salt tolerance of Medicago truncatula, belonging to the technical field of biological genetic engineering. The present invention discovers for the first time that the Medicago truncatula gene STMP can improve the salt tolerance in Medicago truncatula. Experiments confirm that the salt tolerance ability of Medicago truncatula is significantly enhanced after the gene STMP is mutated, and the STMP gene can restore the salt tolerance phenotype of the mutant. The activity of the ion transport pathway in the mutant is increased, and the ROS and ABA pathways are activated. It is indicated that the application of the Medicago truncatula gene STMP described in the present invention in improving the salt tolerance of the leguminous forage alfalfa has important significance and economic value.

Description

Technical Field

[0001] The present invention belongs to the technical field of biological genetic engineering, and relates to the application of Medicago truncatula gene STMP, specifically to the application of Medicago truncatula gene STMP in improving the salt tolerance of Medicago truncatula, a leguminous plant. Background Art

[0002] Disclosing the information of this background art section is only intended to increase the understanding of the overall background of the present invention, and is not necessarily regarded as an admission or an implication in any form that this information constitutes the prior art already known to those of ordinary skill in the art.

[0003] Among leguminous forages, alfalfa (Medicago sativa) is the earliest cultivated and most widely distributed in the world. It is rich in various nutrients such as protein and vitamins, and is also the most important perennial high-quality forage, known as the "king of forages". With the development of animal husbandry, the demand for alfalfa products is increasing day by day. Therefore, breeding excellent forages has important agricultural and strategic significance. However, the genomic background of alfalfa is complex, and it is very difficult to study its developmental mechanism. Medicago truncatula, as its related species, has gradually become a model plant for the study of leguminous crop biology and genomics.

[0004] In actual production, there is a lack of high-quality salt-tolerant Medicago truncatula varieties. The traditional breeding cycle is long and the efficiency is low. To accelerate the breeding process, it is particularly important to explore and utilize salt-tolerant genes. Previous studies on the exploration and utilization of salt-tolerant genes in alfalfa are relatively few, and the number of screened salt-tolerant elements is seriously insufficient. Patent CN112626086A discloses the application of Medicago truncatula gene MtREVOLUTA and the dicotyledonous plant expression vector pEARLEYGATE100 containing Medicago truncatula gene MtREVOLUTA in improving the salt tolerance of alfalfa, a related leguminous forage. Patent CN112322600A discloses that the alfalfa salt-tolerant gene MsSnRK2.3 and the overexpression vector of the MsSnRK2.3 gene can be used for the genetic improvement of forest and grass plants to improve their ability to resist salt stress. These genes are highly expressed in plants to improve their salt tolerance, and there are no related genes that knock out or inhibit gene expression to improve the salt tolerance of Medicago truncatula. Therefore, further exploring genes related to the salt tolerance of Medicago truncatula and improving the salt tolerance of alfalfa, a related leguminous forage, has important significance and economic value. Summary of the Invention

[0005] To solve the deficiencies of the prior art, the object of the present invention is to provide the application of Medicago truncatula gene STMP in improving the salt tolerance of Medicago truncatula. The present invention screened out the salt tolerance gene STMP (Salt Tolerance and Multiple Pods) from a Medicago truncatula mutant library. After mutation in Medicago truncatula, it not only improves the activity of the ion transport pathway but also activates the ROS and ABA pathways.

[0006] To achieve the above object, the technical solution of the present invention is as follows:

[0007] In the first aspect of the present invention, there is provided the application of Medicago truncatula gene STMP or a biomaterial related to Medicago truncatula gene STMP in improving the salt tolerance of Medicago truncatula;

[0008] The Medicago truncatula gene STMP has:

[0009] Ⅰ. The nucleotide sequence shown in SEQ ID NO: 1; or

[0010] Ⅱ. A nucleotide sequence that encodes the same protein as the nucleotide sequence shown in Ⅰ but is different from the nucleotide sequence shown in Ⅰ due to the degeneracy of the genetic code; or

[0011] Ⅲ. A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence described in Ⅰ or Ⅱ, and having the same or similar function as the nucleotide sequence described in Ⅰ or Ⅱ; or

[0012] Ⅳ. A nucleotide sequence having at least 80% sequence homology with the nucleotide sequence shown in any one of Ⅰ to Ⅲ.

[0013] In some embodiments of the present invention, the biomaterial related to Medicago truncatula gene STMP includes but is not limited to:

[0014] The protein encoded by the Medicago truncatula gene STMP; and / or an expression cassette, expression vector, host cell, or recombinant bacterium containing the Medicago truncatula gene STMP.

[0015] In some embodiments of the present invention, the biomaterial related to Medicago truncatula gene STMP includes the dicotyledonous plant expression vector pEARLEYGATE100 containing the Medicago truncatula gene STMP.

[0016] In some embodiments of the present invention, the biomaterial related to Medicago truncatula gene STMP further includes an enhancer or inhibitor of the Medicago truncatula gene STMP.

[0017] In some embodiments of the present invention, the method for improving the salt tolerance of Medicago truncatula includes knocking out the Medicago truncatula gene STMP, knocking down the expression level of the Medicago truncatula gene STMP, or silencing one or more of the Medicago truncatula genes STMP.

[0018] In some embodiments of the present invention, improving the salt tolerance of Medicago truncatula includes increasing the gene expression of the ion transport pathway and / or activating one or more of the ROS and ABA pathways.

[0019] The second aspect of the present invention provides the application of the Medicago truncatula gene STMP or biomaterials related to the Medicago truncatula gene STMP in breeding salt-tolerant Medicago truncatula.

[0020] Among them, the breeding methods include, but are not limited to, transgenic, hybridization, backcross, self-cross, or asexual reproduction.

[0021] The third aspect of the present invention provides the application of the Medicago truncatula gene STMP or biomaterials related to the Medicago truncatula gene STMP in improving the salt-tolerant germplasm resources of Medicago truncatula.

[0022] The fourth aspect of the present invention provides the application of the Medicago truncatula gene STMP or biomaterials related to the Medicago truncatula gene STMP in increasing the survival rate of Medicago truncatula under salt stress.

[0023] The fifth aspect of the present invention provides a method for improving the salt tolerance of Medicago truncatula, including: using genetic engineering authorization to inhibit the expression of the Medicago truncatula gene STMP in Medicago truncatula;

[0024] The inhibition of the expression of the Medicago truncatula gene STMP includes: knocking out the Medicago truncatula gene STMP, knocking down the expression level of the Medicago truncatula gene STMP, or silencing the Medicago truncatula gene STMP.

[0025] The beneficial effects of the present invention are:

[0026] The present invention for the first time discovers that the Medicago truncatula gene STMP can improve salt tolerance in Medicago truncatula. Experiments confirm that the salt tolerance ability of Medicago truncatula is significantly enhanced after the mutation of the gene STMP, and the STMP gene can restore the salt-tolerant phenotype of the mutant. The activity of the ion transport pathway in its mutants is increased, and the ROS and ABA pathways are activated. It indicates that the application of the Medicago truncatula gene STMP described in the present invention in improving the salt tolerance of the leguminous forage alfalfa has important significance and economic value.

[0027] However, compared with other plant materials, the Medicago truncatula material itself has more obvious innate advantages: compared with the traditional model plant Arabidopsis thaliana, the whole genome sequence of Medicago truncatula not only has high-quality sequencing results, but also the number of elements itself is more abundant. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] The accompanying drawings of the specification, which form a part of the present invention, are used to provide a further understanding of the present invention. The schematic embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute an improper limitation of the present invention.

[0029] Figure 1 For the acquisition and identification of the stmp mutant in Example 1 of the present invention; wherein, A shows the phenotypes of the wild type (WT) and two salt-tolerant mutants inserted with the same gene under salt stress conditions (100 mM NaCl, 26 days), Bars = 10 cm; B shows the survival rate statistics under the salt stress conditions in Figure A; C shows the phylogenetic analysis of the gene STMP inserted in the mutant; D shows the transcriptional levels of STMP in WT and stmp detected by RT-PCR; E shows the schematic diagram of the STMP gene structure, the boxes represent exons, the horizontal lines represent introns, and the arrows show the insertion positions of the mutant Tnt1; F shows the multi-pod phenotype of stmp-1 under NaCl treatment, Bars = 4 mm; G shows the expression pattern of STMP; H shows the subcellular localization of STMP, Bars = 50 μm;

[0030] Figure 2 For the overexpression of STMP in Example 3 of the present invention to restore the phenotype of the stmp-1 mutant; wherein, A shows that stmp-1 is hybridized with the 35S:STMP-GFP transgenic plant and stmp-1; 35S:STMP#1 is obtained through two generations of screening. After salt treatment, the mutant shows salt tolerance relative to the wild type, while stmp-1; 35S:STMP#1 is similar to the wild type phenotype; B shows the survival rate statistics, indicating that stmp-1; 35S:STMP#1 restores the salt-tolerant phenotype of the mutant;

[0031] Figure 3 For the qRT-PCR detection of the expression of MtSOS3, MtABF1, and MtRbohB related to ion balance, ABA signaling pathway, and ROS homeostasis in Example 3 of the present invention, with three biological replicates; ** indicates P < 0.05, and there are 25 seedlings in each batch of plants. Detailed implementation manners

[0032] In order to enable those skilled in the art to more clearly understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below in conjunction with specific embodiments.

[0033] In the following examples, Medicago truncatula R108 (used as the wild type), and two mutants were all purchased from the Noble Research Institute Mutant collections. Escherichia coli DH5α and Agrobacterium tumefaciens EHA105 were purchased from Shanghai Weidi Biotechnology; the vector pENTR-TOPO and the expression vector pEARLYGATE100 were purchased from Invitrogen.

[0034] Other materials, reagents, etc. used were obtained from public commercial sources without special instructions.

[0035] In 2005, The Samuel Roberts Noble Foundation in the United States launched a project to construct a Medicago truncatula mutant library. The Tnt1 retrotransposon tagging technology was used to construct the Medicago mutant library. So far, more than 22,000 independent mutant lines have been obtained. These mutations cover approximately 90% of the Medicago genome, meeting the needs of forward and reverse genetic screening. Moreover, the gene knockout in this mutant library was caused by the insertion of the Tnt1 retrotransposon, and the flanking sequences could be quickly and conveniently identified by the TAIL-PCR technology, greatly reducing the difficulty of mapping. The Medicago truncatula gene STMP of the present invention was screened from this mutant library.

[0036] Example 1: Expression analysis of STMP

[0037] (1) Cultivation of materials

[0038] The hard outer skin of Medicago truncatula R108 seeds was moderately polished with sandpaper to break the seed dormancy. The seeds were cultured on moist filter paper at 4°C for about one week, and then the germinated seeds were transferred to a seedling tray and grown in an incubator. The environmental conditions of the incubator were: long-day (16h / 8h), temperature 23°C, humidity 65%, and light intensity 150 mmol m -2 s -1 . After growing in the seedling tray for about two weeks (the first compound leaf unfolds), they were transferred to a large pot and grown in a greenhouse. The normal growth conditions in the greenhouse were: long-day (16h / 8h), temperature 22°C - 25°C, humidity 60% - 70%, and light intensity 150 mmol m -2 s -1 . When they grew to one month old, salt treatment with 100 mM NaCl was started.

[0039] The treatment methods for two salt-tolerant mutants with the same gene insertion were the same as those for Medicago truncatula R108.

[0040] (2) RNA extraction

[0041] Preparation: RNase-free tips, RNase-free EP tubes (2.0 mL, with steel beads; 1.5 mL), liquid nitrogen, 75% ethanol; Instruments such as the desktop and centrifuge to be used are disinfected with 70% alcohol.

[0042] Preparation of DEPC water: Prepare 1000 mL of DEPC-treated water, add 1 mL of DEPC, make up to 1000 mL with ultrapure water, and stir overnight with a magnetic stirrer. Then autoclave at 123 °C for 40 min (DEPC is toxic, but decomposes into carbon dioxide and alcohol after sterilization). Try to avoid contamination and store at 4 °C or at room temperature for later use.

[0043] Extract total RNA from leaves using TrizoL RT. The main steps are as follows:

[0044] 1) Put the sample (≤100 mg) into a 2 mL EP tube with steel beads, immediately put it into liquid nitrogen, and break it with a grinder. Grinder parameters: 25 - 30 HZ for 60 seconds.

[0045] 2) Add 1 mL of TrizoL RT, vortex with a thermostatic mixer at 2000 rpm for 3 min.

[0046] 3) Add 400 μL of DEPC water, vortex with a thermostatic mixer at 2000 rpm for 3 min; let it stand for 5 min, centrifuge at 12000 rpm for 15 min at room temperature.

[0047] 4) Transfer the supernatant to a 1.5 mL EP tube (in duplicate, 600 μL / tube), add an equal volume of isopropanol, mix gently, let it stand at room temperature for 15 min, centrifuge at 12000 rpm for 10 min at room temperature, and discard the supernatant.

[0048] 5) Add 800 μL of 75% ethanol to wash the precipitate, gently resuspend the precipitate, centrifuge at 4000 rpm for 3 min at room temperature; repeat washing the precipitate with 75% ethanol again, pour out the supernatant, centrifuge briefly, and aspirate as much alcohol as possible with a tip, then place it in a laminar flow hood for 1 - 2 min until the edge is semi-transparent and take it out.

[0049] 6) Add 50 μL of DEPC water, flick gently, incubate in a 60 °C metal bath for 10 min;

[0050] 7) Let it stand at room temperature for 2 min, and measure the concentration on ice.

[0051] (3) Obtain cDNA by reverse transcription

[0052] Reverse transcription kit: 5×All-In-One RT MasterMix (with AccuRT Genomic DNARemoval Kit)

[0053] 1) Place the extracted RNA and the frozen reagents in the reverse transcription kit on ice. After dissolution, perform a brief centrifugation to collect the sample at the bottom of the tube. All subsequent steps are carried out on ice.

[0054] 2) Place 200 μL of RNase-free PCR tubes on a 96-well ice plate. Generally, three biological replicates are performed, and the total reaction volume for one reaction is 20 μL.

[0055] 3) First, add Reaction System 1 (Table 1) to the tubes.

[0056] Table 1 Composition of Reaction System 1

[0057]

[0058] 4) Place the above Reaction System 1 in a PCR instrument and incubate at 42 °C for 2 min. After the reaction is completed, place the tubes on ice to cool.

[0059] 5) Then, add Reaction System 2 (Table 2) to the tubes.

[0060] Table 2 Composition of Reaction System 2

[0061]

[0062] Denature the template and primer mixture to stop the reaction.

[0063] 6) Finally, add Reaction System 3 (Table 3) to the tubes.

[0064] Table 3 Composition of Reaction System 3

[0065]

[0066] 7) Carefully mix the above total system, perform a brief centrifugation to collect it at the bottom of the tube, and place it in a PCR instrument. The reaction program is shown in Table 4.

[0067] Table 4 Reaction Program

[0068]

[0069] After the reaction is completed, store the product in a -20 °C refrigerator.

[0070] (4) Real-time fluorescence quantitative PCR

[0071] BIO-RAD real-time fluorescence quantitative PCR instrument; SYBR green Mix.

[0072] The primer sequences are as follows:

[0073] MtUBQ-qF: CTGACAGCCCACTGAATTGTGA (SEQ ID NO:2); MtUBQ-qR: TTTTGGCATTGCTGCAAGC (SEQ ID NO:3).

[0074] STMP-qF: ATCTACTCTGCCTCATCCCCA (SEQ ID NO:4);

[0075] STMP-qR: TTCCAGATTCCACCCCGAAAG (SEQ ID NO:5). MtSOS3-qF: TGATCTGAGGCAAACAGGGT (SEQ ID NO:6); MtSOS3-qR: AGAAGTGCCAACACCATTTCC (SEQ ID NO:7). MtABF1-qF: CGGGAAGTAAAATGTCGCCG (SEQ ID NO:8); MtABF1-qR: TGACCTCGCAGCTGATTCTC (SEQ ID NO:9). MtRbohB-qF: GCTCGCTCTGCTCTTATTGC (SEQ ID NO:10); MtRbohB-qR: TGCGCTTGTAGACACTACGC (SEQ ID NO:11).

[0076] The cDNA was diluted to 15 ng / μL as the template; the forward primer and the reverse primer were premixed at 2.5 μM.

[0077] Real-time PCR system (10 μL):

[0078] SYBR 5 μL

[0079] primers 2 μL

[0080] cDNA template 3 μL

[0081] Real-time PCR program:

[0082]

[0083] The relative expression level was calculated according to the 2 -△△CT method. The t-test was used for statistical analysis; three biological replicates; * indicates P < 0.05, and the results are shown in Figure 1 . Figure 1 The expression levels of STMP in various tissues of Medicago truncatula detected by qRT-PCR are shown.

[0084] In previous laboratory work, two insertion mutants of a gene were screened. After four weeks of salt treatment, their leaves were greener than those of the wild type, and their survival rate was higher than that of the wild type, showing salt tolerance and a phenotype of having multiple pods after treatment ( Figure 1 A-B, F). After aligning this gene sequence with the Arabidopsis thaliana genome in NCBI and constructing an evolutionary tree, it was found that its similarity with genes in Arabidopsis thaliana was low and there was no homologous gene ( Figure 1 C). By detecting the expression levels of STMP in the wild type and its mutants through RT-PCR, it was found that the expression of STMP in its mutants was knocked out, belonging to knockout mutants ( Figure 1 D). This gene was named STMP (Salt Tolerance and Multiple Pods). Therefore, these two mutants were named stmp-1 and stmp-2 ( Figure 1 E), that is, mutants with salt tolerance and multiple pods ( Figure 1 F). To further explore the expression pattern of STMP, qRT-PCR was used to detect the transcriptional levels of STMP in various tissues of Medicago truncatula. The expression level of STMP was the highest in nodules and also had relatively high levels of expression in flowers and roots ( Figure 1 G). To determine the localization of STMP in cells, an STMP-GFP expression vector was constructed, and it was observed through tobacco transient transformation experiments that STMP-GFP was localized in the nucleus ( Figure 1 H).

[0085] The sequence of the gene STMP is as follows:

[0086] atggaacataacaacaacaacaacaacatgtcttcttcacaagacgaaatctctctttttcttcatca

[0087] aattcttctccgttcatcttcatcttcttccatgccaggatccattaaccagcttcaagatggaaagatctcag

[0088] cccttgattcaacttctagatcaaaccatgctataaatgtcacttcctcttctgttggagcaggaggaggact

[0089] cagtggtaatgacactgatgaatatgactgtgaaagtgaggagggtgttgaagcattgattgaagaagttc

[0090] caacaaagtcagttggtgcttctaggagttcttcaaaaagaagtagagcagctgaagttcataatttgtcag

[0091] aaaagagaagaaggagtaggatcaatgagaaaatgaaagctttacaaaatctaattccaaattctaacaa

[0092] gactgataaagcttcaatgctagatgaagctattgaataccttaaacagcttcagctccaagtacagatgct

[0093] gtcattgagaaatggattgagtttgcatcctatgtactttcatgaaggcttgcattctctgcctttgtctcggat

[0094] gagtacggagttgagtgaaggaaacggttctaatcctttaaatatgacatctactctgcctcatccccaaga

[0095] caaccccttgctctatccatcaaatctaccaaacaaaaacacattgccgagtcagccatcaatgtcttccta

[0096] tccttcatatattaacgacacggaaacttctttcggggtggaatctggaatcccagcacagaaagaacgtc

[0097] ttcaacgatcttcagagccaatgcacggcgaagacttgttgcagcaccagcaattgaatgcaataaattct

[0098] tttaccaatctattaggtggttctcaagttgtcaaagaatttcagtcgggcgcaatggctacatctactactaa

[0099] caatactttgcaaacttgtgtcgctggaagagatcagtcaggagtggtcatgagaaatagcgagcccaac

[0100] attatatttacatcgcagttaagtaggtaa(SEQ ID NO:1).

[0101] Example 2: Construction of Dicotyledonous Plant Expression Vector

[0102] PCR amplification system:

[0103]

[0104] 1) PCR procedure:

[0105] 95°C for 5 min; 25 - 30 cycles: 95°C for 30 s, 60°C for 30 s, 72°C for 30 s; 72°C for 5 min.

[0106] 2) Recovery, ligation and transformation

[0107] After agarose gel electrophoresis of the PCR products, cut the gel block at the position of the target fragment size into a 1.5 mL EP tube. Refer to the instructions of the ordinary agarose gel DNA recovery kit (TIANGEN, DP209) for the recovery of PCR products.

[0108] Ligate the recovered product to the pEntry-T vector (Thermo Fisher Scientific, catalog number 12536017). A large number of clones of this plasmid are obtained in Escherichia coli DH5α by transformation. After performing the LR reaction to ligate the gene STMP into the expression vector pEARLYGATE100, extract the plasmid and transfer the plasmid into the Agrobacterium strain EHA105.

[0109] Example 3: Transformation of Medicago truncatula and Screening of Transgenic Plants

[0110] (1) Reagents and culture medium preparation required:

[0111] Prepare the reagent formulations for the genetic transformation of Medicago truncatula as shown in Tables 5, 6 and 7.

[0112] Table 5

[0113]

[0114]

[0115] Table 6

[0116]

[0117] Table 7

[0118]

[0119] The culture medium formulations required for Medicago truncatula genetic transformation are shown in Table 8 below.

[0120] Table 8 Culture medium formulations required for Medicago truncatula genetic transformation

[0121]

[0122]

[0123] (2) Steps for genetic transformation (tissue culture):

[0124] 1. Sample collection: Select the leaves of Medicago truncatula that have not flowered and are growing vigorously (do not select leaves that are too young, too old, or damaged).

[0125] 2. Collect the taken leaves in a 50 mL centrifuge tube and place it on ice to prevent the leaves from wilting.

[0126] 3. The transformation experiment is carried out in a laminar flow hood. Transfer the taken leaves to a pre-sterilized 50 mL centrifuge tube, and wash them with ddH 2 O containing 20% NaClO and 0.1% TWEEN-20 for 15 min, and gently shake it horizontally. For the specific process, pour out the solution at about 7 min, and wash it again until 15 min. Then wash it 5 times with sterilized water, 1 min each time, to prevent NaClO residue.

[0127] 4. Collect the Agrobacterium tumefaciens cultured overnight (OD600 value is between 0.6 - 0.8) in a 50 mL centrifuge tube, centrifuge at 4000 rpm for 10 min, pour out the supernatant, and resuspend it with 3 mL of liquid SH3a medium to an OD600 of 0.1.

[0128] 5. Place the washed leaves in a sterile petri dish containing filter paper, stack the leaves of similar size together, cut off the leaf edges with a high-temperature sterilized blade, then cut the leaves into square leaf discs of appropriate size and put them into a 50 mL centrifuge tube. Then add the diluted bacterial solution, and invert it up and down to mix well so that the leaves are fully in contact with the bacterial solution.

[0129] 6. Place the centrifuge tube in a vacuum pump and evacuate for 10 min to reduce the cell gaps, so that the bacterial solution can fully invade the wounds and improve the transformation efficiency.

[0130] 7. Place it on a horizontal shaker and shake slowly for 10 min.

[0131] 8. Pour out the bacterial solution, lay the leaves flat on the SH3a (antibiotic-free) solid medium, and incubate them in the dark overnight to allow the Agrobacterium tumefaciens to grow together with the leaves.

[0132] 9. On the next day, wash the leaf discs with sterilized water at least three times, and wash once with water containing Cefotaxime for the last time. Then spread the leaves on the SH3a solid medium containing antibiotics (depending on plant resistance) and Cefotaxime, and culture in a dark incubator for 4 weeks (change the medium every 14 days).

[0133] 10. After growing on the SH3a medium for 4 weeks, transfer to the SH9BK medium (containing antibiotics) and culture under room temperature light for 2 weeks; then transfer to the SH9a medium (without antibiotics) and culture for about 2 - 4 weeks; after the materials take root, transfer to the 1 / 2MS medium (IBA can be added to promote rooting); after growing strong seedlings, transfer to the soil and grow in the greenhouse. After survival, the transgenic plants can be identified.

[0134] 11. DNA extraction of Medicago truncatula. Prepare 2×CTAB (pH 8.0) extraction buffer (1 L) in advance:

[0135]

[0136] Note: First make up the volume to 1 L, then add CTAB powder. After stirring and dissolving, it can be placed in an oven at 65 °C to accelerate dissolution and stored at room temperature.

[0137] 12. For the genomic DNA extracted from Medicago truncatula, use the vector primer GCACAATCCCACTATCCTTC (SEQ ID NO:12) and the gene reverse primer (STMP-qR: TTCCAGATTCCACCCCGAAAG (SEQ ID NO:5)) for PCR amplification detection.

[0138] Detect the expression of STMP in the leaves of 35S:STMP Medicago truncatula transgenic plants of different strains. One of the positive strains is named stmp-1; 35S:STMP#1. Specifically, cross stmp-1 with 35S:STMP transgenic plants and obtain stmp-1; 35S:STMP#1 through two generations of screening. Perform salt treatment on it. After treatment, the mutant shows salt tolerance compared with the wild type, while stmp-1; 35S:STMP#1 is similar to the wild type phenotype ( Figure 2 A), and count the survival rate ( Figure 2 B). The results show that stmp-1; 35S:STMP#1 can restore the phenotype of the mutant to a certain extent. Overexpression of STMP can restore the phenotype of the stmp-1 mutant.

[0139] To further study the overall impact of STMP mutation on the transcriptional level of plants, take materials of the wild type and stmp-1 to detect the Marker genes of ion, ABA and ROS pathways ( Figure 3) qRT-PCR was used to detect the expression of MtSOS3, MtRbohB, and MtABF1 related to ion homeostasis, ROS homeostasis, and ABA signaling pathway, and their expression was upregulated in the mutants.

[0140] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and changes. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.

Claims

1. Application of Medicago truncatula gene STMP or biological materials related to Medicago truncatula gene STMP in improving salt tolerance of Medicago truncatula; The nucleotide sequence of the Medicago truncatula gene STMP is shown in SEQ ID NO: 1; The biological materials related to the Medicago truncatula gene STMP include: The protein encoded by the Medicago truncatula gene STMP; And / or an expression cassette, expression vector, host cell or recombinant bacteria containing the Medicago truncatula gene STMP.

2. The use according to claim 1, characterized in that The biological material related to the Medicago truncatula gene STMP includes a Medicago truncatula gene STMP The dicotyledonous plant expression vector pEARLEYGATE100.

3. The use according to claim 1, characterized in that The method for improving the salt tolerance of Medicago truncatula comprises one or more of knocking out the Medicago truncatula gene STMP, knocking down the expression level of the Medicago truncatula gene STMP, or silencing the Medicago truncatula gene STMP.

4. The use according to claim 1, characterized in that The method of improving the salt tolerance of Medicago truncatula comprises improving the gene expression of ion transport pathways, activating ROS and ABA pathways or one or more thereof.

5. Application of Medicago truncatula gene STMP or biological materials related to Medicago truncatula gene STMP in breeding salt-tolerant Medicago truncatula; The Medicago truncatula gene STMP is the same as that described in claim 1; The biological materials related to the Medicago truncatula gene STMP include: The protein encoded by the Medicago truncatula gene STMP; And / or an expression cassette, expression vector, host cell or recombinant bacteria containing the Medicago truncatula gene STMP.

6. Application of Medicago truncatula STMP gene or biological materials related to Medicago truncatula STMP gene in improving salt-tolerant germplasm resources of Medicago truncatula; The Medicago truncatula gene STMP is the same as that described in claim 1; The biological materials related to the Medicago truncatula gene STMP include: The protein encoded by the Medicago truncatula gene STMP; And / or an expression cassette, expression vector, host cell or recombinant bacteria containing the Medicago truncatula gene STMP.

7. Application of Medicago truncatula STMP gene or biological materials related to Medicago truncatula STMP gene in improving the survival rate of Medicago truncatula under salt stress environment; The Medicago truncatula gene STMP is the same as that described in claim 1; The biological materials related to the Medicago truncatula gene STMP include: The protein encoded by the Medicago truncatula gene STMP; And / or an expression cassette, expression vector, host cell or recombinant bacteria containing the Medicago truncatula gene STMP.

8. A method for improving the salt tolerance of Medicago truncatula, characterized in that: include: Using genetic engineering, the expression of the Medicago truncatula gene STMP was inhibited in Medicago truncatula; The nucleotide sequence of the Medicago truncatula gene STMP is shown in SEQ ID NO: 1; The inhibiting the expression of the Medicago truncatula gene STMP comprises: knocking out the Medicago truncatula gene STMP, knocking down the expression level of the Medicago truncatula gene STMP or silencing the Medicago truncatula gene STMP.

Images