Application of a SNP molecular marker and its detection reagent in the breeding of disease-resistant fish varieties

Abstract

The present invention discloses an application of a SNP molecular marker and a detection reagent thereof in the breeding of disease-resistant fish varieties. In order to promote the breeding of Su's round-bellied catfish varieties resistant to bacterial septicemia, the present invention provides a SNP molecular marker, the SNP site of which is located at position 16886517 of the Su's round-bellied catfish reference genome CM018562.1, and the polymorphism is A or T. The SNP molecular marker of the present invention is related to the bacterial septicemia resistance trait of Su's round-bellied catfish and can be used in molecular marker-assisted breeding of Su's round-bellied catfish-related resistant varieties. The present invention also provides a detection reagent for the SNP molecular marker. By using the provided detection reagent to detect the SNP molecular marker, the bacterial septicemia resistance trait of Su's round-bellied catfish can be identified, and Su's round-bellied catfish individuals with relatively stronger resistance can be screened to obtain Su's round-bellied catfish individuals with relatively stronger resistance, thereby accelerating the breeding of Su's round-bellied catfish varieties resistant to bacterial septicemia.

Description

Technical Field

[0001] This invention belongs to the field of molecular marker screening and disease-resistant breeding technology. More specifically, it relates to the application of an SNP molecular marker and its detection reagent in the breeding of disease-resistant fish varieties. Background Technology

[0002] Fish farming is a pillar industry of my country's aquaculture sector. However, with its rapid development, the lack of superior breeds and the degradation of farmed species have become increasingly prominent, severely hindering the long-term and stable development of the fish farming industry. Furthermore, the expansion of farming scale, increased intensification, and deterioration of the farming environment have led to frequent outbreaks of aquatic diseases, causing significant economic losses to the fish farming industry.

[0003] Pangasianodon hypophthalmus is an important aquaculture fish. Bacterial septicemia caused by Aeromonas hydrophila is one of the bottlenecks restricting the sustainable development of Pangasianodon hypophthalmus aquaculture. Although the use of antibacterial drugs has a certain effect in treating bacterial septicemia, its effectiveness is limited and cannot fundamentally solve the problem. Moreover, antibacterial drugs pose potential health hazards to consumers and are prone to drug resistance, failing to meet people's demand for green aquatic products. Therefore, it is urgent to breed varieties resistant to bacterial septicemia.

[0004] While molecular markers associated with resistance to Aeromonas hydrophila infection have been reported, they are specific to Yellow River carp and Chinese soft-shelled turtles, and not applicable to *Culter albopictus*. Furthermore, the number of reported molecular markers related to resistance to *Aeromonas hydrophila* infection in *Culter albopictus* is limited and insufficient to meet the needs of screening resistant strains; therefore, it is necessary to continuously explore molecular markers associated with resistance to bacterial septicemia in *Culter albopictus*. Obtaining molecular markers related to resistance to bacterial septicemia in *Culter albopictus* from the vast genome is the primary challenge that needs to be overcome. Summary of the Invention

[0005] This invention provides a SNP molecular marker and its detection reagent to enrich the molecular markers associated with the bacterial septicemia resistance trait of the catfish *Culter albopictus*, and to better meet the needs of screening resistant varieties. It also provides the application of the SNP molecular marker and its detection reagent in the breeding of disease-resistant fish varieties.

[0006] The first objective of this invention is to provide an SNP molecular marker.

[0007] A second objective of this invention is to provide a detection reagent for the SNP molecular marker.

[0008] A third object of the present invention is to provide the use of the detection reagent in identifying the antibacterial septicemia trait of *Catella suis* or in the preparation of products for identifying the antibacterial septicemia trait of *Catella suis*.

[0009] A fourth object of the present invention is to provide the use of the detection reagent in screening for antibacterial sepsis in catfish (Cetus thuringiensis) or in the preparation of products for screening for antibacterial sepsis in catfish (Cetus thuringiensis).

[0010] A fifth objective of this invention is to provide the application of the detection reagent in molecular marker-assisted breeding of a cultivar of *Catella suis* resistant to bacterial septicemia.

[0011] The sixth object of the present invention is to provide a product for identifying antibacterial septicemia traits in catfish or for screening catfish with antibacterial septicemia.

[0012] The seventh object of the present invention is to provide a method for screening catfish (Cetus thuringiensis) for resistance to bacterial sepsis.

[0013] The above-mentioned objective of this invention is achieved through the following technical solution:

[0014] This invention identifies a single-nucleotide polymorphic molecule (SNP) marker associated with antibacterial septicemia in the MYD88 gene of *C. suis*, and provides a detection reagent for this SNP marker. By using the detection reagent provided by this invention to detect the SNP marker, the antibacterial septicemia trait in *C. suis* can be identified, and individuals with relatively stronger resistance (i.e., *C. suis* with the SNP genotype TT at the SNP site) can be screened, thereby accelerating the breeding of *C. suis* varieties resistant to bacterial septicemia. Therefore, this invention seeks protection for the SNP marker, the detection reagent, and their applications.

[0015] This invention provides an SNP molecular marker that is associated with bacterial septicemia resistance in catfish (Catfish suis).

[0016] Specifically, the bacterial sepsis is caused by infection with Aeromonas hydrophila.

[0017] Specifically, the SNP site of the SNP molecular marker is located at position 16886517 of the reference genome of Catfish suis CM018562.1, and the polymorphism is A or T (SNP1 A>T).

[0018] The present invention also provides a detection reagent for the SNP molecular marker.

[0019] Specifically, the detection reagent includes primers for detecting the SNP molecular marker or primers for detecting the genotype of the SNP molecular marker.

[0020] Specifically, the primers are designed with sequences containing the SNP molecular markers described in this invention as targets, and their amplified sequences contain the SNP sites of the SNP molecular markers.

[0021] As one alternative implementation, the nucleotide sequence of the primer used to detect the SNP molecular marker is shown in SEQ ID NO.2-3.

[0022] As one alternative implementation, the nucleotide sequence of the primer used to detect the genotype of the SNP molecular marker of claim 1 is shown in SEQ ID NO. 4-5.

[0023] Using the detection reagent for the SNP molecular marker described in this invention, combined with sequencing, the genotype of the SNP molecular marker can be obtained, and then the antibacterial septicemia trait of *Catella suis* can be identified or screened to obtain *Catella suis* with antibacterial septicemia.

[0024] Therefore, this invention seeks protection for the use of the detection reagent in identifying the antibacterial septicemia trait of *Catella suis* or in the preparation of products for identifying the antibacterial septicemia trait of *Catella suis*.

[0025] The present invention also claims protection for the use of the detection reagent in screening for antibacterial sepsis in catfish (Catfish thuringiensis) or in the preparation of products for screening for antibacterial sepsis in catfish (Catfish thuringiensis).

[0026] The present invention also claims protection for the use of the detection reagent in molecular marker-assisted breeding of a cultivar of *Catella suis* resistant to bacterial septicemia.

[0027] The present invention also provides a product for identifying antibacterial septicemia traits in catfish or for screening catfish with antibacterial septicemia, the product containing the detection reagent described in the present invention.

[0028] Specifically, among the SNP molecular markers described in this invention, the probability of *C. suis* populations with the SNP allele of T being resistant to bacterial septicemia is significantly higher than that of *C. suis* populations with the SNP allele of A (P<0.05). Therefore, when identifying the antibacterial septicemia trait in *C. suis*, if the tested *C. suis* SNP allele is T or the SNP genotype is TT, it may possess the antibacterial septicemia trait. When screening for *C. suis* resistant to bacterial septicemia, *C. suis* with the SNP genotype TT should be selected.

[0029] The present invention also provides a method for screening catfish scoparia surii resistant to bacterial septicemia, the method comprising: detecting the genotype of the SNP molecular marker in the tested catfish scoparia surii, and selecting catfish scoparia surii resistant to the SNP site with the genotype TT.

[0030] Optionally, the SNP molecular markers can be amplified using the primers shown in SEQ ID NO.2 and 3 of this invention.

[0031] Optionally, the genotype of the SNP molecular marker can be obtained using the SNaPshot typing primers shown in SEQ ID NO.4 and 5 of the present invention in conjunction with a SNaPshot sequencing analyzer.

[0032] The present invention has the following beneficial effects:

[0033] This invention provides a SNP molecular marker to promote the breeding of *C. suis* resistant to bacterial septicemia. The SNP site of the molecular marker is located at position 16,886,517 of the *C. suis* reference genome CM018562.1, with a polymorphism of A or T. This SNP molecular marker is associated with the bacterial septicemia resistance trait of *C. suis* and can be used in marker-assisted breeding of resistant *C. suis* varieties. This invention also provides a detection reagent for the SNP molecular marker. Using the provided reagent to detect the SNP molecular marker, the bacterial septicemia resistance trait of *C. suis* can be identified, and individuals with stronger resistance, specifically those with the genotype TT at the SNP site, can be screened, thereby accelerating the breeding of *C. suis* varieties resistant to bacterial septicemia. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 This is the sequencing information of the SNP site 1A>T of the SNP molecular marker described in this invention; in the figure, genotype a corresponds to TT type; genotype b corresponds to TA type; and genotype c corresponds to AA type. Detailed Implementation

[0035] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the embodiments do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in this technical field.

[0036] Unless otherwise specified, all reagents and materials used in the following examples are commercially available.

[0037] Example 1: Amplification of the MYD88 gene sequence of Catfish suis and screening and genotyping of SNP sites.

[0038] 1. Sample collection

[0039] Catfish weighing approximately 100g each were collected from aquaculture farms. After being transferred from rearing tanks to smaller tanks and kept stable, artificial infection was induced by injecting Aeromonas hydrophila. The concentration of Aeromonas hydrophila injected was 1×10⁻⁶. 7 The concentration of cfu / mL was 0.2 mL / fish, and the culture water temperature was maintained at 27–29℃. Individuals of *C. suis* that died within 24 hours of infection were collected as the susceptible group, and 20 individuals were collected. Individuals of *C. suis* that showed no symptoms of infection 7 days after infection were collected as the resistant group, and 20 individuals were collected. Fin samples were taken from the susceptible and resistant groups of *C. suis* and preserved in anhydrous ethanol.

[0040] 2. Amplification of the MYD88 gene sequence

[0041] This invention designs PCR primers for amplifying the MYD88 gene sequence from the catfish MYD88 gene sequence (NCBI Gene ID: 113541356) published in the GenBank database. The MYD88 gene sequence (5'-3') shown in SEQ ID NO.1 was obtained through PCR amplification and sequencing. The MYD88 gene sequences obtained by amplifying and sequencing different samples using the aforementioned PCR primers may differ from the sequence shown in SEQ ID NO.1 by a few bases; these differences may be SNP sites. Details are as follows:

[0042] (1) Design of PCR primers

[0043] The PCR primer sequences for amplifying the MYD88 gene sequence, designed based on the MYD88 gene sequence of Catfish suis published in the GenBank database (NCBI Gene ID: 113541356), are shown in Table 1.

[0044] Table 1 PCR primers

[0045]

[0046] (2) PCR amplification of the MYD88 gene sequence

[0047] Genomic DNA was extracted from the susceptible and resistant catfish samples collected above. The concentration of the extracted genomic DNA was detected by ultraviolet spectrophotometer and then diluted to 100 ng / μL.

[0048] Using diluted genomic DNA as a template, the MYD88 gene sequence was amplified using the PCR primers shown in Table 1. The reaction system used for PCR amplification is shown in Table 2.

[0049] Table 2. Reaction system used for PCR amplification

[0050]

[0051] The reaction conditions used for PCR amplification were as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 35 cycles; 72℃ extension for 5 min.

[0052] The purity and integrity of the PCR amplification products were checked by 1% agarose gel electrophoresis. Products with single and bright bands were selected and sent to Guangzhou Tianyi Huiyuan Gene Technology Co., Ltd. for Sanger sequencing. The sequencing platform was an ABI 3730xl DNAAnalyzer sequencer.

[0053] 3. Screening and genotyping of SNP loci

[0054] The sequencing results of PCR amplification products from 40 susceptible and resistant catfish (C. suis) were compared with the reference sequence (NCBI Gene ID: 113541356). Sites with a difference of more than 1 / 3 at the same locus were identified as SNP sites. Through comparative analysis, one SNP site was obtained in the sequence shown in SEQ ID NO.1, located at position 84, named SNP site 1, with polymorphism A>T (SNP1 A>T). Using the reference genome CM018562.1 of *C. suis* as a reference, the SNP site is located at nucleotide position 16,886,517. This SNP site is located in the intron region of the MYD88 gene and does not encode amino acids. The relevant information for this SNP site is summarized in Table 3.

[0055] Table 3. Information on the SNP sites of the MYD88 gene in Catfish suis.

[0056]

[0057] Note: "-" indicates none (SNP sites are not located in the CDS region and do not encode amino acids).

[0058] This invention determined the genotype of the SNP locus (SNP1 A>T) through sequencing peak analysis. The sequencing peak diagram of SNP1A>T is shown below. Figure 1 As shown. By Figure 1 It is known that SNP1 A>T has three genotypes: TT / TA / AA. It should be noted that, to ensure the accuracy of the results, this invention used the R-direction sequence (3'-5') of the sequence shown in SEQ ID NO.1 during sequencing peak analysis; the sequence shown in the figure is also the R-direction sequence.

[0059] The R-direction sequence (3'-5') is shown below:

[0060] TGCCCTCAGCCTTTGCCCAGGTCTGTTTCTAAATATTAATTTTGCCTGATTGTTGATGTGTTTTGAAAATAAAATCACTTTACTACACGTCTAGTCACACAGACACACTACAGCTACAGTTTATTGACTG TGGTGCTTTCCAGCATTTTATGTTTCTCACTCTTTTCTTAAAATAGAAATATATCCACCTCATGGAAACTTCCTGTGGCTGCTTGCCACTTCCTGCCATGCTCTGATGTGTTGTTTTGAACTTATATT TTTTCCACACAGGGGCTCGGACCAAACGGCTGATTCCTGTGGTCTACAAGCCCATGACGAAGCCTTTTCCCAGCATTCTGCGCTTCCTGACAGTGTGTGACTACACCAGGCCATGCACACAGTCCTGGT TCTGGGTTCGACTGGCCAAAGCCCTGTCCCTGTCCTGAACACCGTACATCCAGCTCGCTCACTGCCACAACTGTAATTATTGTTTACATGCACTGCTACACGTCCTGAACATTTCTGGTTTCAGTTATT T CAGTTATTCATCATCTTTTTCTAGCTGCAGTGCCTGGTTCTTTTACTGCAAAAGTCACAGCTGTTGCCAAATTGATGCCTTAT

[0061] Furthermore, based on the results shown in the genotype statistics table, this invention used the General Linear Model (GLM) program and t-test of SPSS analysis software to verify the association between the genotype of the SNP locus and the antibacterial sepsis trait of *Catfish suis*. The results showed a significant difference after analysis of variance, and multiple comparisons were performed using Duncan's method.

[0062] The alleles and genotypes of the SNP locus described in this invention in susceptible and resistant populations of *Culter albopictus* are shown in Table 4. Table 4 shows that *Culter albopictus* with the SNP locus allele T exhibited significantly increased resistance to bacterial septicemia (p < 0.05), and *Culter albopictus* with the SNP locus genotype TT showed significantly higher resistance than those with genotypes TA or AA.

[0063] Table 4. Alleles and genotypes of SNP loci in the susceptible and resistant groups of Aeromonas hydrophila.

[0064]

[0065] Example 2: Genotyping of SNP loci and verification of their association with antibacterial sepsis

[0066] 1. Genotyping of SNP loci

[0067] The present invention uses the same method as in Example 1, and collects 201 susceptible catfish samples and 213 disease-resistant catfish samples. Genomic DNA is extracted from the samples. Using the obtained genomic DNA as a template, the genotype of the SNP site in the above samples is detected by SNaPshot typing method.

[0068] Based on the sequence information of the SNP sites described in Example 1, the present invention designed corresponding SNaPshot genotyping primers, including amplification primer SNP1-P1F and extension primer SNP1-E, the sequences of which are shown in Table 5.

[0069] Table 5. SNaPshot typing primers

[0070]

[0071] Using the extracted genomic DNA as a template, PCR amplification was performed using the primers shown in Table 5. The reaction system used for PCR amplification is shown in Table 6.

[0072] Table 6. PCR amplification reaction system of SNaPshot

[0073]

[0074]

[0075] The reaction conditions used for PCR amplification were as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 20 s, 60℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 35 cycles; 72℃ final extension for 3 min.

[0076] After the PCR amplification reaction was completed, the PCR amplification products were treated with SAP (shrimp alkaline phosphatase) to remove free dNTPs from the system. A single-base extension reaction was then performed after the shrimp alkaline phosphatase treatment, and the reaction system is shown in Table 7.

[0077] Table 7. Reaction system for monobasic extension reaction.

[0078]

[0079] The reaction conditions for the single-base extension reaction are as follows: pre-denaturation at 95°C for 30 s; denaturation at 95°C for 5 s, annealing at 52°C for 5 s, extension at 60°C for 5 s, for a total of 35 cycles; final extension at 72°C for 3 min. The reaction products were subjected to sequencing analysis using a 96-channel fully automatic ABI 3730xL genetic analyzer.

[0080] The original data in.fsa format was exported from the 3730xL instrument. After being classified and archived according to the detection reactions, they were respectively imported into the GeneMarker analysis software. According to the signal values and peak emergence situations of each locus, the primer ratios of each locus were adjusted to ensure that the signal values and peak emergence situations of each locus were basically the same. Statistics were carried out according to the samples and locus situations to obtain the genotyping results of each locus of the samples, and the genotype statistical table was exported.

[0081] 2. Association verification

[0082] According to the results shown in the genotype statistical table, the Generalized Linear Model (GLM) program and t-test of the SPSS analysis software were used to conduct an association verification on the genotype of the SNP locus and the trait of anti-bacterial septicemia of Pangasianodon hypophthalmus. For the characteristics with significant differences shown by the analysis of variance test, the Duncan method was used for multiple comparisons.

[0083] The allele and genotype situations of the SNP locus in the susceptible population and resistant population of Aeromonas hydrophila in Pangasianodon hypophthalmus are shown in Table 8. It can be seen from Table 8 that the resistance of Pangasianodon hypophthalmus with the allele T of the SNP locus to bacterial septicemia is significantly improved (p < 0.05). The disease resistance of Pangasianodon hypophthalmus with the genotype TT of the SNP locus is significantly higher than that of Pangasianodon hypophthalmus with the genotype TA or AA.

[0084] Table 8 Allele and genotype situations of the SNP locus in the susceptible population and resistant population

[0085]

[0086] Example 3 Genetic analysis of the SNP locus

[0087] The results of the genetic analysis of SNP locus 1 of the MYD88 gene of Pangasianodon hypophthalmus described in the present invention are shown in Table 9. It can be seen from Table 9 that SNP1 A>T is moderately polymorphic (0.15 < PIC < 0.5) in both the susceptible population and the disease-resistant population, indicating that SNP1 A>T can provide relatively reasonable genetic information as a genetic marker.

[0088] Table 9 Genetic information of SNP locus 1 of the TLR2 gene of Pangasianodon hypophthalmus

[0089]

[0090] Note: Na is the number of alleles; He is the observed heterozygosity; Ne is the expected heterozygosity; PIC is the polymorphism information content.

[0091] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. Use of a detection reagent for SNP molecular markers in identifying the bacterial septicemia resistance trait of Su's round-bellied catfish or in preparing a product for identifying the bacterial septicemia resistance trait of Su's round-bellied catfish, characterized in that: The SNP site of the SNP molecular marker is located at position 16886517 of the Su's round-bellied catfish reference genome CM018562.1, and the polymorphism is A or T.

2. Use of a detection reagent for SNP molecular markers in screening for S. sutschmidtii that is resistant to bacterial sepsis or in preparing a product for screening for S. sutschmidtii that is resistant to bacterial sepsis, characterized in that: The SNP site of the SNP molecular marker is located at position 16886517 of the Su's round-bellied catfish reference genome CM018562.1, and the polymorphism is A or T.

3. Application of a SNP molecular marker detection reagent in molecular marker-assisted breeding of a Su's round-bellied catfish variety resistant to bacterial sepsis, characterized in that: The SNP site of the SNP molecular marker is located at position 16886517 of the Su's round-bellied catfish reference genome CM018562.1, and the polymorphism is A or T.

4. The use according to any one of claims 1 to 3, characterized in that: The detection reagent includes a primer for detecting the SNP molecular marker or a primer for detecting the genotype of the SNP molecular marker.

5. The application according to claim 4, characterized in that: The nucleotide sequences of the primers used to detect the SNP molecular markers are shown in SEQ ID NOs. 2-3.

6. The application according to claim 4, characterized in that: The nucleotide sequences of the primers used to detect the genotype of the SNP molecular marker are shown in SEQ ID NOs. 4-5.

7. A method for screening catfish resistant to bacterial sepsis, characterized in that: The genotype of the SNP molecular marker according to claim 1 in the tested catfish is detected, and the catfish with the SNP site genotype of TT is selected.

Images