Development and application of a subunit vaccine for porcine contagious pleuropneumonia

Abstract

The present invention relates to the field of veterinary vaccines, and discloses the development and application of a subunit vaccine for porcine contagious pleuropneumonia. The TbpB-C truncated protein and the AdhE whole protein selected in the antigen protein combination of the vaccine of the present invention are highly homologous in all APP serotypes, and are prepared into subunit vaccines that can provide cross protection to porcine actinobacillus pleuropneumoniae of different serotypes, and the protection rates against APP1 type and APP3 type strains are both 100%. The truncated proteins selected in the antigen protein combination of the present invention are successfully expressed in a soluble form after optimization, and are easy to express and purify in large quantities, thereby reducing production costs. The present invention lays a foundation for the development of an efficient, low-cost, broad-spectrum subunit vaccine for porcine contagious pleuropneumonia, and provides an effective technical means for the prevention and treatment of the disease.

Description

Technical Field

[0001] The present invention relates to the field of veterinary vaccines, and more specifically, to the development and application of a porcine contagious pleuropneumonia subunit vaccine. Background Art

[0002] Porcine contagious pleuropneumoniae (PCP), also known as necrotizing pleuropneumonia, is a highly contagious and fatal respiratory infectious disease caused by Actinobacillus pleuropneumoniae (APP). Pigs of all ages are susceptible to this disease, which is common in growing pigs and adult pigs. It is mainly characterized by acute hemorrhagic fibrinous pneumonia and chronic fibrinous necrotizing pleurisy. The acute type has an morbidity and mortality rate of about 50%, and the most acute type has a mortality rate of 80% to 100%, which is very harmful to the breeding industry. The disease often occurs from April to May and from September to November, and is seasonal. In addition, various factors such as poor ventilation, crowding, group transfer, humidity, and long-distance transportation can induce this disease. In recent years, the clinical isolation rate of APP has been increasing year by year. It often causes mixed infection with other pathogens such as Haemophilus parasuis, Pasteurella multocida, Streptococcus suis, Escherichia coli, PCV2 and porcine reproductive and respiratory syndrome virus, causing porcine respiratory syndrome, which weakens the lung defense function of pigs and increases the difficulty of treatment. Therefore, the prevention and treatment of porcine contagious pleuropneumonia is of great significance to the healthy development of the pig industry.

[0003] There are 19 serotypes of porcine Actinobacillus pleuropneumoniae, and there is a lack of effective cross-immune protection between different serotypes. In 1987, the first clinical case was discovered in my country and proved the existence and prevalence of PCP in my country. The main serotypes prevalent in the country are 1, 2, 3, 5, and 7, and the serotypes prevalent in different provinces and cities are also different. At present, there are three major types of vaccines for porcine contagious pleuropneumonia: inactivated vaccines, live attenuated vaccines, and subunit vaccines. Inactivated vaccines have the worst protective effect against multiple serotypes, and the safety of live attenuated vaccines has yet to be verified. Subunit vaccines have become a hot spot in vaccine research and development due to their low cost and good safety and cross-protection. The existing commercial subunit vaccine consists of five antigen components and is currently dependent on imports, and the import cost is high. Therefore, a new and efficient domestic subunit vaccine for porcine contagious pleuropneumonia has become an urgent need in the industry. Summary of the invention

[0004] The purpose of the present invention is to overcome the shortcomings of the prior art, screen and reduce the types of antigens, optimize the composition ratio through bioinformatics methods, provide a porcine contagious pleuropneumoniae Actinobacillus antigen combination and its application in the preparation of subunit vaccines, so as to solve the problem of the lack of a low-cost and effective porcine contagious pleuropneumoniae subunit vaccine in the prior art.

[0005] The present invention is implemented by the following technical solutions:

[0006] A porcine contagious pleuropneumonia subunit vaccine, comprising TbpB-C protein and AdhE protein;

[0007] The amino acid sequence of the TbpB-C protein is shown in SEQ ID NO.1;

[0008] The amino acid sequence of AdhE protein is shown in SEQ ID NO.2.

[0009] Further: the nucleotide sequence encoding the TbpB-C protein is shown in SEQ ID NO.3;

[0010] Furthermore: the nucleotide sequence encoding the AdhE protein is shown in SEQ ID NO.4.

[0011] Furthermore: TbpB-C protein and AdhE protein are obtained by prokaryotic expression, the expression vector is preferably pET-32a vector, and the expression host is preferably E. coli BL21 (DE3).

[0012] A subunit vaccine for porcine contagious pleuropneumonia, wherein the ratio of TbpB-C protein and AdhE protein combination is 2:1.

[0013] The vaccine further comprises an adjuvant, and the adjuvant is preferably MontanideTM Gel 01 adjuvant.

[0014] The invention discloses an application of a porcine contagious pleuropneumonia subunit vaccine in preparing a medicine for preventing and treating porcine contagious pleuropneumonia.

[0015] The beneficial effects of the present invention are that the TbpB-C truncated protein and the AdhE full protein selected in the antigen protein combination of the present invention are highly homologous in all APP serotypes, and preparing them into subunit vaccines can provide cross-protection against different serotypes of porcine contagious Actinobacillus pleuropneumoniae, and the protection rates against APP1 and APP3 strains are both 100%.

[0016] The truncated proteins selected in the antigen protein combination of the present invention have been optimized to successfully achieve soluble expression, are easy to express and purify in large quantities, and reduce production costs.

[0017] The invention lays a foundation for the development of a highly effective, low-cost, broad-spectrum porcine contagious pleuropneumonia subunit vaccine and provides an effective technical means for the prevention and treatment of the disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 It is a graph of various immune simulation indicators of TbpB, the N-terminal truncated protein of TbpB (TbpB-N) and the C-terminal truncated protein of TbpB-C (TbpB-C) in Example 1 of the present invention;

[0019] Figure 2 is a diagram showing the expression of four proteins in Example 1 of the present invention;

[0020] Figure 3 is a line graph of the survival rate of each group of mice infected with serum type 1 APP in Example 2 of the present invention;

[0021] Figure 4 is a line graph of the survival rate of each group of mice infected with serum type 3 APP in Example 2 of the present invention;

[0022] Figure 5 This is a bar graph of serum specific antibody levels detected after each group of mice were infected with serum type 1 APP in Example 2 of the present invention;

[0023] Figure 6 This is a bar graph of serum specific antibody levels detected after each group of mice were infected with serum type 3 APP in Example 2 of the present invention;

[0024] Figure 7 It is the detection diagram in Example 3 of the present invention: (A) the survival rate of mice in each adjuvant group after infection with APP serotype 1 strain, (BC) the detection of serum specific antibody levels of mice in each group;

[0025] Figure 8 These are the examination diagrams in Example 4 of the present invention: (A) survival rate of mice in each group after infection with APP serotype 1 strain; (B) clinical status score of mice in each group after infection; (CD) detection of serum specific antibody levels of mice in each group. DETAILED DESCRIPTION

[0026] The subject matter described herein will now be discussed with reference to example embodiments. It should be understood that the discussion of these embodiments is only to enable those skilled in the art to better understand and implement the subject matter described herein, and the functions and arrangements of the elements discussed may be changed without departing from the scope of protection of the contents of this specification. Each example may omit, replace or add various processes or components as needed. In addition, the features described relative to some examples may also be combined in other examples.

[0027] In the early stage of the present invention, 8 candidate antigens of porcine Actinobacillus pleuropneumoniae were obtained through preliminary screening. Bioinformatics analysis showed that TbpB, AdhE, OmlA and Lip40 were highly conserved in different APP serotypes and belonged to nutrient intake-related proteins and bacterial surface membrane proteins respectively. RTA is an epitope protein constructed by the present invention and has a research basis.

[0028] By analyzing the domain structure of the candidate proteins, truncating them for expression and evaluating their immune effects, it was found that the subunit vaccine combined with rTbpB-C and rAdhE (optimal ratio 2:1) had a better immune protection effect on mice than the commercial subunit vaccine ( Epcot APP) were expressed in soluble form, and the best adjuvant was obtained by screening, which was SEPPIC MontanideTM Gel 01.

[0029] Example 1

[0030] 1.1 Immune simulation of TbpB

[0031] Computer immune simulations were run on the C--ImmSim simulation server (https: / / kraken.iac.rm.cnr.it / C-IMMSIM / index.php) to detect various immune simulation indicators of TbpB, the N-terminal truncated protein of TbpB (TbpB-N), and the C-terminal truncated protein of TbpB-C (TbpB-C).

[0032] As attached Figure 1 As shown, the results showed that the IgG antibody level, B cell antibody level and cytokine level induced by TbpB-C were much higher than those of TbpB and TbpB-N, making it a candidate protein for APP subunit vaccine.

[0033] 1.2 Construction of recombinant expression plasmid

[0034] The target fragment was amplified by PCR using the primers described in Table 1, using the genomic DNA of APP of serotype 1 as a template.

[0035] Table 1 Target gene PCR primer sequences

[0036]

[0037] After PCR amplification, the target gene was subjected to agarose gel electrophoresis and purified using a gel recovery kit. The purified target gene and pET-32a plasmid were double-digested with BamHI and XhoI respectively. The digested target gene was connected to the vector, mixed evenly, and placed in a 16°C low-temperature water bath for connection overnight.

[0038] Finally, the ligated recombinant plasmids were transformed into E. coli DH5α competent cells using a kit, and finally the recombinant expression plasmids peT32a-TbpB-C and peT32a-AdhE were constructed. These recombinant expression plasmids were identified by enzyme digestion and sequencing, and all were consistent with expectations, with no sequence mutations and successfully inserted into the pET32a vector.

[0039] 1.3 Protein expression and purification

[0040] Transform the constructed recombinant plasmid into competent E. coli BL21 (DE3). The next day, pick a single colony on the plate and inoculate it into 5ml Amp+ resistant LB medium, and culture it at 37℃, 180rpm for 8h. Take 2ml of culture solution and add it to 200ml LB liquid medium containing Amp+ resistance, and culture it at 37℃, 180rpm until OD600nm=0.6-0.8, then add 200μl IPTG with a final concentration of 1mM at 16℃ to induce expression for 16h, and collect 1ml of whole bacteria before and after induction. Centrifuge the remaining bacterial solution at 4℃, 6000rpm for 10min, discard the supernatant, and collect the bacteria. Add PBS to resuspend and ultrasonically disrupt the bacteria, and collect the supernatant and precipitate respectively. Add 5×SDS gel loading buffer to the whole bacteria, supernatant, and precipitate before and after induction, boil for 10min, and perform 12% SDS-PAGE to detect protein expression in different parts.

[0041] The supernatant collected after ultrasound was purified by nickel column affinity chromatography. After the bacteria were ultrasonically disrupted, they were centrifuged at 4°C and 8000rpm for 10 minutes, the supernatant was collected, and the pH was adjusted to 8.0 for purification. For specific operation steps, refer to the Cytiva Ni column purification instructions. Finally, 5×SDS gel loading buffer was added to the 500mM imidazole eluent, and 12% SDS-PAGE was performed to detect the protein expression in different parts after boiling for 10 minutes.

[0042] As attached Figure 2 As shown, the results showed that four proteins were abundantly expressed in the supernatant, and the sizes of TbpB-C, AdhE, Lip40 and OmlA were 41.76 kDa, 114.2 kDa, 55 kDa and 63.6 kDa, respectively.

[0043] Example 2 Screening of the Optimal Antigen Combination of Porcine Contagious Pleuropneumonia Subunit Vaccine

[0044] The safety and efficacy of the two recombinant subunit vaccines obtained in Example 1 were verified by clinical trials in mice, and the subunit inactivated vaccine of Actinobacillus pleuropneumoniae ( Epcot APP) as a control.

[0045] The mice were divided into 6 groups, 12 in each group. The mice were immunized subcutaneously at multiple points on the back with each group of proteins at 0d and 14d, respectively, according to the following table. On the 28th day, 6 mice in each group were infected with type 1 APP (containing 3*10^8CFU / mouse), and the other 6 mice were infected with type 3 APP (containing 7*10^8CFU / mouse). The morbidity and mortality of mice in each group were observed, and the antibody titers of each protein in the serum of mice at 0d, 14d and 28d after immunization were detected by ELISA.

[0046] like Figure 3-Figure 6 As shown, the results showed that the combination of TbpB-C + AdhE had a 100% protection rate (6 / 6) against APP serotype 1 and 3 strains, while the Merck commercial vaccine had only an 83% (5 / 6) protection effect. The results of mouse serum specific antibody titer showed that the specific antibody levels of TbpB-C and AdhE in the serum of mice in the TbpB-C + AdhE high-dose group were significantly higher than those in other groups. Therefore, TbpB-C + AdhE is the best candidate antigen combination for porcine contagious pleuropneumonia subunit vaccine.

[0047] Table 2 APP immune protection combination protein screening group information

[0048]

[0049] Example 3 Screening of candidate adjuvants for subunit vaccine of porcine contagious pleuropneumonia

[0050] Adjuvants are defined as ingredients added to vaccines to improve the immune response to antigens. The efficacy of the same adjuvant on different types of vaccines varies greatly (such as inactivated vaccines, subunit vaccines, etc.), and different adjuvants have different efficacy on different antigens of the same type. Therefore, this experiment screened the best adjuvant TbpB-C+AdhE. The specific groups are shown in Table 3. The infection dose is the same as 2.1. After infection, the survival rate and serum antibody titer of each group of mice were monitored, and the specific methods were the same as above.

[0051] like Figure 7 As shown, after attacking with APP serotype 1 strain, the protection rate of each group except the white oil adjuvant group was 100%, but Gel 01 had the least side effects on mice, the best clinical state, and the strongest levels of TbpB-C and AdhE specific antibodies in mouse serum. Therefore, Gel 01 is the best adjuvant for porcine contagious pleuropneumonia subunit vaccine.

[0052] Table 3 Grouping information for screening of candidate adjuvants for APP subunit vaccines

[0053]

[0054] Example 4 Optimization of the antigen ratio of porcine contagious pleuropneumonia subunit vaccine

[0055] The proportion of each antigen in the vaccine has a great influence on its immune effect. The optimization of the dosage ratio of TbpB-C and AdhE in the vaccine helps to enhance the efficacy of the vaccine. The specific grouping is shown in Table 4. The infection strain is APP1 and the dose is the same as 1.4. After infection, the survival rate and serum antibody titer of each group of mice were monitored.

[0056] like Figure 8 As shown, the results showed that when TbpB-C and AdhE were 1:1 and 2:1, they could provide complete protection against APP serotype 1 challenge, but the clinical symptom score of mice showed that the 2:1 dose was significantly lower than the other groups in terms of clinical status. Therefore, 2 parts of TbpB-C + 1 part of AdhE + Gel 01 adjuvant is the best combination of porcine contagious pleuropneumonia subunit vaccine.

[0057] Table 4 Grouping information of optimized ratios of antigens in APP subunit vaccines

[0058]

[0059]

[0060] Sequence Listing

[0061] SEQ ID NO.1TbpB-C

[0062] Glu Thr Lys Phe Asp Ala Arg Gln Ile Asp Leu Lys Asp Phe Lys GlnSerGlu Met Asp Ser Phe Gly Gln Ala Asn Leu Leu Val Ile Asp Gly HisIle Ile ProLeu Leu Lys Gln Asn Phe Asp His Gln Leu Ala Asn Lys SerVal Lys Val Thr AlaCys Cys Glu Asn Leu Ala Asp Val Lys Phe Gly ThrPhe Asp Val Ala Gly Glu GlyPro Lys Leu Tyr Leu Thr Gly Glu Arg ThrAla Val Asp Ala Ile Pro Lys Ser GlyVal Phe Ala Tyr Lys Gly Ser TrpGln Gly Gln Ile Ser Ser Gln Asp Gly Thr LysTrp Gln Thr Pro Glu AsnSer Ala Ala Tyr Leu Gln Val Asp Phe Asp Asn Lys ArgVal Asn Gly GlyPhe Gly Ser Gly Pro Thr Ser Gly Thr Val Leu Ser Leu Gln GluGly ValIle Asp Lys Asn Gly Phe Ser Gly Val Val Lys Thr Leu Lys Asp Gly PheSerAla Asn Gly Lys Thr Phe His Val Asp Gly Lys Val Ser Gly Gly PheTyr Gly LysThr Ala Ser Glu Ile Gly Gly Ser Leu Leu Ser Thr Glu GlnSer Gln Asp Lys AlaAla Gly Val Phe Gly Ala Lys Arg

[0063] SEQ ID NO.2AdhE

[0064] Met Ala Asn Asn Ala Lys Asn Ala Gln Pro Tyr Asp Ala Gln Thr GluValAsn Gln Leu Val Glu Asn Gly Leu Lys Ala Leu Glu Glu Phe Arg GlnLeu Asn GlnGlu Gln Val Asp Tyr Ile Val Ala Lys Ala Ser Val Ala AlaLeu Asp Lys His GlyVal Leu Ala Met His Ala Tyr Glu Glu Thr Gly ArgGly Val Phe Glu Asp Lys AlaThr Lys Asn Leu Phe Ala Cys Glu Tyr ValVal Asn Asn Met Arg His Leu Lys ThrAla Gly Ile Ile Ser Glu Asp AsnVal Thr Gly Ile Thr Glu Ile Ala Asp Pro ValGly Val Val Cys Gly IleThr Pro Thr Thr Asn Pro Thr Ser Thr Thr Ile Phe LysAla Leu Ile AlaLeu Lys Thr Arg Asn Pro Ile Val Phe Ala Phe His Pro Ser AlaGln GlnSer Ser Ala His Ala Ala Gln Val Val Tyr Asp Ala Ala Val Ala Ala GlyAlaPro Lys Asn Cys Val Gln Trp Ile Lys Thr Pro Ser Met Glu Gly ThrSer Ala LeuMet Lys His Pro Gly Ile Ala Thr Ile Leu Ala Thr Gly GlyAsn Ala Met Val GluAla Ala Tyr Ser Cys Gly Lys Pro Ala Leu Gly ValGly Ala Gly Asn Val Pro AlaTyr Val Glu Lys Thr Ala Lys Leu Glu GlnAla Val Tyr Asp Ile Val Met Ser LysSer Phe Asp Asn Gly Met Ile CysAla Ser GluGln Ala Ala Ile Val Asp Lys GluIle Tyr Ala Asp Phe ValLys Glu Met Gln Ser Tyr Gly Val Tyr Leu Val Asn LysLys

[0065] SEQ ID NO.3 TbpB-C

[0066] GAAACGAAGTTCGATGCACGACAAATCGACCTAAAAGACTTTAAGCAAAGTGAGATGGATTCGTTCGGGCAGGCGAATTTACTTGTGATTGACGGGCATATTTCCGTTACTCAAACAAAATTTTGATCATCAATTGGCAAATAAATCGGTAAAAGTAACC GCTTGTTGTGAGAACTTGGCAGATGTTAAATTCGGTACTTTTGACGTGGCAGGCGAAGGCCAAAACTATATTTAACCGGAGAACGCACCGCCGTAGATGCCATTCCGAAATCGGGAGTATTTGCTTATAAGGTAGCTGGCAAGGGCAAATCAGTAGCCAA GACGGTACGAAATGGCAAACACCGGAAAACAGGTGCGGCATATTTACAAGTGGATTTTGATAATAAGAGAGTAAACGGTGGTTTTGGTAGCGGACCGACTAGCGGTACCGTATTGTCGCTTCAAGAAGGCGTAATAGATAAACGGTTTTTCCGGCGTCGTA AAAACACTTAAAGACGGTTTTAGCGCAAATGGAAAAACATTCCATGTTGATGGCAAAGTATCAGGTGGTTTTTATGGTAAGACGGCTTCAGAGATCGGTGGTAGTTTGTTAAGTACTGAGCAAAGTCAAGATAAGGCTGCCGGTTATCGGTGCAAAACGT

[0067] SEQ ID NO.4 AdhE

[0068]

[0069] The above describes an embodiment of the present embodiment, but the present embodiment is not limited to the above-mentioned specific implementation methods. The above-mentioned specific implementation methods are merely illustrative and not restrictive. Under the guidance of the present embodiment, ordinary technicians in this field can also make many forms, all of which are within the protection of the present embodiment.

Claims

1. A porcine contagious pleuropneumonia subunit vaccine, characterized in that: Includes TbpB-C protein and AdhE protein; The amino acid sequence of the TbpB-C protein is shown in SEQ ID NO.1; The amino acid sequence of AdhE protein is shown in SEQ ID NO.

2.

2. A porcine contagious pleuropneumonia subunit vaccine according to claim 1, characterized in that: The nucleotide sequence encoding TbpB-C protein is shown in SEQ ID NO.

3.

3. A porcine contagious pleuropneumonia subunit vaccine according to claim 1, characterized in that: The nucleotide sequence encoding the AdhE protein is shown in SEQ ID NO.

4.

4. A porcine contagious pleuropneumonia subunit vaccine according to claim 1, characterized in that: TbpB-C protein and AdhE protein were obtained by prokaryotic expression.

5. A porcine contagious pleuropneumonia subunit vaccine according to claim 1, characterized in that: The ratio of the combination of TbpB-C protein and AdhE protein is 2:

1.

6. A porcine contagious pleuropneumonia subunit vaccine according to claim 5, characterized in that: An adjuvant is also included.

7. An application of the porcine contagious pleuropneumonia subunit vaccine according to any one of claims 1 to 6, characterized in that: Application in the preparation of medicines for preventing and treating porcine contagious pleuropneumonia.

Images