A high-sweetness amino acid content flammulina velutipes variety, and an mnp molecular identification method and application thereof
Through ambient temperature pressure plasma mutagenesis and single-spore hybridization, a new enoki mushroom variety 'Shangyan A111' with high sweet amino acid content was cultivated. This solved the problems of homogenization of existing enoki mushroom products and easy cap opening, and achieved high yield, high-quality commercial traits, and efficient molecular identification.
Patent Information
- Application Number
- CN202411250104.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-06
- Publication Date
- 2025-12-19
- Estimated Expiration
- 2044-09-06
AI Technical Summary
The existing enoki mushroom production products are highly homogenized, and the caps of the main cultivated varieties are prone to opening, which affects their commercial characteristics and makes them less competitive in the market.
A new enoki mushroom variety, ‘Shangyan A111’, with high sweet amino acid content was developed through ambient temperature pressure plasma mutagenesis and single-spore hybridization. Its MNP molecular fingerprint spectrum was constructed for specific identification.
It increases the content of sweet amino acids, improves the characteristics of thick caps that are not easy to open, and enhances the yield and marketability of enoki mushrooms. It is suitable for industrial production and has the advantages of high throughput, multiple targets, high sensitivity and high accuracy in identification.
Smart Images

Figure CN119040146B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the technical field of Flammulina velutipes breeding and strain molecular identification, and particularly relates to a Flammulina velutipes variety with high sweet amino acid content and a MNP molecular identification method and application thereof. BACKGROUND
[0002] In the past decade, the edible mushroom industry has entered a period of rapid development, and the output and value of edible mushrooms have undergone great changes. Among them, Flammulina velutipes, as the first variety to achieve factory production, ranks first in factory cultivation varieties. The total output of Flammulina velutipes reached 2.0254 million tons in 2022 (data from China Edible Fungus Association). The concentration of Flammulina velutipes factory cultivation has been continuously improved with the development of economy and technology, making factory Flammulina velutipes one of the most industrialized and most competitive varieties in the world.
[0003] The main Flammulina velutipes cultivation varieties have been introduced mainly by the white series of short production cycle and high yield. The market competition of white Flammulina velutipes products is becoming increasingly fierce, and there is almost no difference in appearance, nutritional quality, taste, shelf life, etc. The current problem of easy opening of the cap has seriously limited the development of the Flammulina velutipes industry. Therefore, it is necessary to develop new Flammulina velutipes germplasm and cultivate new Flammulina velutipes varieties with unique characteristics (high nutritional value), great market competition potential (cap not easy to open, high A-grade rate, etc.), which can lead the development of the Flammulina velutipes industry. SUMMARY
[0004] The present application aims to provide a Flammulina velutipes variety with high sweet amino acid content and the construction of its MNP molecular fingerprint, in view of the current situation of serious product homogenization and narrow breeding background of white Flammulina velutipes.
[0005] The present application aims to provide a Flammulina velutipes variety with high sweet amino acid content and the construction of its MNP molecular fingerprint, in view of the current situation of serious product homogenization and narrow breeding background of white Flammulina velutipes.
[0006] The present application aims to provide a Flammulina velutipes variety with high sweet amino acid content and the construction of its MNP molecular fingerprint, in view of the current situation of serious product homogenization and narrow breeding background of white Flammulina velutipes.
[0007] The Flammulina velutipes variety 'Shangyan A111' of the present application was preserved in the Guangdong Microbial Culture Collection Center on March 15, 2024, at address: 5th floor, No. 59 Building, Guangzhou Xianlie Middle Road 100, Institute of Microbiology, Guangdong Academy of Sciences, with preservation number: GDMCC No: 64424.
[0008] The above-mentioned Flammulina velutipes variety 'Shangyan A111' is bred by single hybridization of spores from parent Flammulina velutipes 'Shangyan No.1' (preservation number GDMCC No: 61490) and parent 'Jin 2641' (preservation number GDMCC No: 61486) after ARTP mutagenesis. The fruiting body of the Flammulina velutipes variety 'Shangyan A111' at the harvesting time has a small cap, is spherical, thick and inwardly buckled, has a mountain-shaped top end in the longitudinal section, flat gills arranged regularly, and a columnar and thick stipe. The fruiting body is neat, and has good overall commodity traits and quality.
[0009] The content of sweet amino acids in the above-mentioned Flammulina velutipes variety 'Shangyan A111' is 20.559 mg / g, which is increased by 34.44% compared with the parent 'Shangyan No.1', increased by 210.47% compared with the parent 'Jin 2641', and increased by 181.67% compared with the white production main cultivar. The content of glycine contained in the sweet amino acids is 6.836 mg / g, which is increased by 29.88% compared with the parent 'Shangyan No.1', increased by 943.46% compared with the parent 'Jin 2641', and increased by 443.49% compared with the white production main cultivar. The content of proline contained in the sweet amino acids is 7.932 mg / g, which is increased by 34.33% compared with the parent 'Shangyan No.1', increased by 1177.29% compared with the parent 'Jin 2641', and increased by 1419.54% compared with the white production main cultivar.
[0010] The MNP molecular fingerprint of the above-mentioned Flammulina velutipes variety 'Shangyan A111' includes 7 MNP marker sites: SEQ ID NO: 1-14.
[0011] The amplification primers of the MNP molecular fingerprint of the above-mentioned Flammulina velutipes variety 'Shangyan A111' are as follows: the primers of SEQ ID NO: 1-2 are forward primer (5->3) cgcctctaaacaagtacgtttcatt and reverse primer (5->3) ttttgaagataggccaggacatctt.
[0012] The amplification primers of the MNP molecular fingerprint of the above-mentioned Flammulina velutipes variety 'Shangyan A111' are as follows: the primers of SEQ ID NO: 3-4 are forward primer (5->3) gtaaacattgaggctatcatagggc and reverse primer (5->3) gggtatatcattcgctagatgcaga.
[0013] The amplification primers of the MNP molecular fingerprint of the above-mentioned Flammulina velutipes variety 'Shangyan A111' are as follows: the primers of SEQ ID NO: 5-6 are as follows: forward primer (5->3) tctcaacgatatcaatcttcccaca; reverse primer (5->3) gtcctgagacttctacgagtgac.
[0014] The amplification primers of the MNP molecular fingerprint of the above-mentioned Flammulina velutipes variety 'Shangyan A111' are as follows: the primers of SEQ ID NO: 7-8 are as follows: forward primer (5->3) aagggaatacatatcaataccgcca; reverse primer (5->3) gacggaccatacaatgtgtgaaat.
[0015] The amplification primers of the MNP molecular fingerprint of the above-mentioned Flammulina velutipes variety 'Shangyan A111' are as follows: the primers of SEQ ID NO: 9-10 are as follows: forward primer (5->3) caagttggacctgtcggggaaatac; reverse primer (5->3) tcccgtccctcctctcaaag.
[0016] The amplification primers of the MNP molecular fingerprint of the above-mentioned Flammulina velutipes variety 'Shangyan A111' are as follows: the primers of SEQ ID NO: 11-12 are as follows: forward primer (5->3) cgttggaagggaaatatgaagaagg; reverse primer (5->3) gagactaattttagcacgtgagtcg.
[0017] The amplification primers of the MNP molecular fingerprint of the above-mentioned Flammulina velutipes variety 'Shangyan A111' are as follows: the primers of SEQ ID NO: 13-14 are as follows: forward primer (5->3) ttcaggtgatccttggattccaata; reverse primer (5->3) gactaggcttcctatctgtggaag.
[0018] The application has the following advantages: the average yield of the factory-bottled Flammulina velutipes variety 'Shangyan A111' reaches 438.5 g / bottle (1100 mL, 75 mm in diameter), which is higher than that of the parent 'Jin 2641' (358.9 g / bottle) and the parent 'Shangyan No. 1' (430.7 g / bottle), and is equivalent to that of the main variety (435.7 g / bottle); the growth period is 1-2 days shorter than that of the parent 'Shangyan No. 1' and the production control. The cap of 'Shangyan A111' is thick, with a diameter of 0.51-0.90 cm and a height of 0.48 cm; the stem is 0.21-0.42 cm in diameter and 16.6-19.1 cm in length; and the average effective stem number is 1076, calculated by cutting the root at a distance of 10 cm from the root. The appearance of the fruiting body of 'Shangyan A111' is white; the cap is spherical, thick, and inwardly buckled, and is not easy to open; the longitudinal section is mountain-shaped at the top; the stem is relatively thick, and the fruiting bodies are neat; the cap is smaller than that of the parent 'Shangyan No. 1' and is not easy to open, and the overall consistency is good; and the stem is longer than that of the parent 'Jin 2641' and the buds are neat. 'Shangyan A111' has excellent commodity traits, meets the diversified needs of the market, is suitable for factory annual bottle cultivation, and has a good application and promotion prospect. The MNP molecular fingerprint of the Flammulina velutipes variety 'Shangyan A111' uses a comprehensive multiple amplification and sequencing technology, and can perform sequence analysis on all marker sites of multiple samples at one time. Compared with ISSR, RAPD, SSR and other molecular markers and mushrooming tests, the MNP molecular fingerprint has the advantages of high throughput, multiple targets, high sensitivity and high precision. The MNP molecular fingerprint of the Flammulina velutipes variety 'Shangyan A111' has specificity and specificity in identifying the Flammulina velutipes strain 'Shangyan A111'. BRIEF DESCRIPTION OF DRAWINGS
[0019] In order to more clearly illustrate the technical solutions of the embodiments of the present application, the following will briefly introduce the drawings needed in the embodiment description, wherein:
[0020] Figure 1 The figure is the fruiting body morphology of 'Shangyan A111', 'Shangyan No. 1' and 'Jin 2641', and the main cultivated variety. DETAILED DESCRIPTION
[0021] In order to make the above-mentioned purposes, features and advantages of the present application more apparent and easy to understand, the specific implementation manner of the present application will be described in detail below with specific examples.
[0022] Example 1:
[0023] Breeding of the Flammulina velutipes variety 'Shangyan A111':
[0024] Spores of 'Shangyan No. 1' and 'Jin 2641' were collected from October 2020. The spores were made into spore suspension and subjected to ARTP mutagenesis. The mutagenized spore suspension was plated and the germinated colonies were picked. Microscopic examination observed whether there was a lock-like joint. The colonies without lock-like joint were formed by monokaryotic germination, and 31 and 68 spore monokaryons were obtained, respectively. In January 2021, monokaryotic hybridization pairing was carried out, and 217 hybrid offspring strains were obtained. The numbering rule continued the Shangyan series, and A was added as the beginning followed by Arabic numerals.
[0025] In February 2021, the hybrid offspring were preliminarily screened in the laboratory according to colony morphology, growth rate, and shake flask mycelial morphology, and 129 excellent offspring were obtained. In March 2021, the strains after preliminary screening were subjected to mushroom production in a small test. The parallel test was repeated three times. Based on the mushroom production speed, yield, and cap thickness, 25 strains with fast mushroom production speed, high yield, and thick cap were selected. In June 2021, a pilot test was carried out in Shengong Biotechnology Company in Shandong. In addition to investigating yield, production cycle, and cap thickness, the company also focused on culture time, bud emergence speed and uniformity, fruiting body morphology, base adhesion degree, shelf life, and other indicators. The strain numbered 'A111' performed well in cultivation tests, with a short production cycle, a large number of buds, a longer stem than the parent 'Jin 2641', and a uniform bud emergence. It also had better consistency than the parent 'Shangyan No. 1'. In November 2021, repeated cultivation tests were carried out on the 'A111' strain, and the cultivation characteristics were stable. Since 2021, demonstration tests have been carried out in Shengong Biotechnology Company in Shandong and Guangming Jiudaomuguo Biotechnology Company in Hebei. The strain has stable characteristics such as thick cap, early maturity, high quality, and high yield, and is suitable for factory production of golden needle mushrooms. It was finally named 'Shangyan A111'.
[0026] The nutritional characteristics of Flammulina velutipes variety 'Shangyan A111' and its parents 'Shangyan No.1' and 'Jin 2641' were determined and compared. The results showed that the total content of amino acids in Flammulina velutipes variety 'Shangyan A111' was higher than that in its parents 'Shangyan No.1', 'Jin 2641' and the production control (Table 1). Among them, the content of sweet amino acids in Flammulina velutipes variety 'Shangyan A111' was increased by 34.44% compared with 'Shangyan No.1', 210.47% compared with 'Jin 2641', and 181.67% compared with the white production main cultivar. The content of glycine in sweet amino acids was increased by 29.88% compared with 'Shangyan No.1', 943.46% compared with 'Jin 2641', and 443.49% compared with the white production main cultivar. The content of proline in sweet amino acids was increased by 34.33% compared with 'Shangyan No.1', 1177.29% compared with 'Jin 2641', and 1419.54% compared with the white production main cultivar. It was indicated that the directional strengthening variety could be developed by the breeding method of normal temperature room pressure plasma mutagenesis + hybridization.
[0027] Table 1 Comparison of amino acid characteristics of 'Shangyan A111' and its parents and production control (DW: mg / g)
[0028]
[0029] Aspartic acid is widely present in biosynthesis and can be used as a carrier of K+ and Mg2+ ions to transport electrolytes to the myocardium, thereby improving myocardial contraction function and reducing oxygen consumption. It has a protective effect on the myocardium in the case of coronary circulation disorder and hypoxia. It participates in ornithine cycle, promotes the generation of ammonia and carbon dioxide into urea, reduces the amount of nitrogen and carbon dioxide in blood, enhances liver function, and eliminates fatigue.
[0030] As shown in Table 1, the content of aspartic acid in 'Shangyan A111' was much higher than that in its parents 'Shangyan No.1', 'Jin 2641' and the production control variety.
[0031] Example 2:
[0032] Construction of MNP molecular fingerprint of Flammulina velutipes variety 'Shangyan A111':
[0033] (1) Mycelium culture: Flammulina velutipes strain 'Shangyan A111' was transferred to potato dextrose agar solid medium (PDA) and cultured at 19°C for 7 days, and then the mycelium was collected;
[0034] (2) Genomic DNA extraction: The genomic DNA of the above mycelium was extracted using a kit, the purity of the DNA of the sample to be tested was determined using a spectrophotometer, 1 μL of the DNA of the sample to be tested was used to determine the concentration using a Qubit fluorescence quantifier, and the concentration of the sample DNA was adjusted to between 30 ng / μL and 50 ng / μL;
[0035] (3) Multiplex polymerase chain reaction (PCR): The MNP marker site of the above extracted sample of the Tricholoma mongolicum strain "Shangyan A111" was amplified using multiplex PCR to obtain a multiplex PCR amplification product.
[0036] The PCR amplification system was 30 μL in total, including: 4 μL of primer group (each primer at a concentration of 0.2 μM), 4 μL of sample DNA to be tested (at a concentration of 20 ng / μL to 30 ng / μL), 10 μL of GenoPlexs 3xT Master Mix (manufacturer: Shijiazhuang Boruitai Biotechnology Co., Ltd.), 12 μL of ddH2O, and the mixture was shaken and mixed to obtain a mixture for multiplex PCR amplification.
[0037] The PCR amplification reaction program was: 95°C for 3 min; (95°C for 20 s, 60°C for 4 min) x 15 cycles; 72°C for 4 min; 10°C for storage. The multiplex PCR amplification product was purified.
[0038] (4) Construction of high-throughput sequencing library and sequencing: According to the operating instructions of the high-throughput sequencing kit and the high-throughput sequencer, the high-throughput sequencing library obtained from the multiplex PCR amplification was subjected to high-throughput sequencing. The average coverage multiple of the high-throughput sequencing was set to more than 700 times, and the sequencing length was not less than 300 bp.
[0039] To the multiplex PCR amplification product, 10 μL of GenoPlexs 3xT Master Mix, 2 μL of P5 primer at a concentration of 5 μM, 2 μL of P7 barcode primer (the primer contains a sample barcode) at a concentration of 5 μM, and 16 μL of ddH2O were added, shaken and mixed, and centrifuged briefly.
[0040] The PCR amplification reaction program was: 95°C for 3 min; (95°C for 15 s, 58°C for 15 s, 70°C for 30 s) x 8 cycles; 72°C for 5 min; 10°C for storage. The sequencing library was purified.
[0041] The high-throughput sequencing was performed using an illumina Next Seq550 sequencer to sequence the library, and the sequencing data of the sample to be tested was obtained. The detailed steps of sequencing are described in the instructions of the sequencer.
[0042] (5) Data alignment: The sequencing data of Flammulina velutipes strain 'Shangyan A111' was aligned to the DNA sequence of MNP marker sites on the Flammulina velutipes reference genome, and the average coverage multiple of the detected marker sites was counted. The genotype record of the detected MNP marker site was recorded as all the detected allele genotypes of the site, wherein the detected allele genotype refers to the detected DNA fragment composed of the first to the last base of the marker, and different detected allele genotypes are separated by " / ".
[0043] Using the data alignment software Bowtie2 (version number 2.1.0), the sequencing data of the sample to be tested was aligned to the Flammulina velutipes reference genome, and the DNA sequence of the MNP marker of each sample to be tested was obtained. The alignment results were saved in SAM (The Sequence Alignment / Map format, sequence alignment format) format.
[0044] Table 2 List of 14 MNP marker sites and primer information of Flammulina velutipes variety 'Shangyan A111'
[0045] Site name Forward primer Reverse primer Fragment size / bp SEQ ID NO: 1-2 cgcctctaaacaagtacgtttcatt ttttgaagataggccaggacatctt 200 SEQ ID NO: 3-4 gtaaacattgaggctatcatagggc gggtatatcattcgctagatgcaga 262 SEQ ID NO: 5-6 tctcaacgatatcaatcttcccaca gtcctgagacttctacgagtgac 270 SEQ ID NO: 7-8 aagggaatacatatcaataccgcca gacggaccatacaatgtgtgaaat 223 SEQ ID NO: 9-10 caagttggacctgtcggggaaatac tcccgtccctcctctcaaag 262 SEQ ID NO: 11-12 cgttggaagggaaatatgaagaagg gagactaattttagcacgtgagtcg 272 SEQ ID NO: 13-14 ttcaggtgatccttggattccaata gactaggcttcctatctgtggaag 274
[0046] (6) Calculate genetic similarity: Based on the principle that at least 1 SNP difference in the same MNP marker site allele genotype of different Flammulina velutipes strains is considered to be different, the number of different MNP markers of pairwise comparison of different Flammulina velutipes strains was counted, and the marker sites that can significantly distinguish any Flammulina velutipes strain were screened according to the different MNP marker sites. When the genetic similarity (GS) of the sample to be tested and the control sample is less than 96%, it is determined to be "different strains".
[0047] Genetic similarity GS = n / N x 100%, wherein N is the number of MNP sites amplified by the test strain and the 'Shangyan A111' variety, and n is the number of MNP sites with the same genotype among the MNP sites amplified by the test strain and the 'Shangyan A111' variety.
[0048] Table 3 Genetic similarity (GS) of Flammulina velutipes variety 'Shangyan A111' and other Flammulina velutipes strains
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056] From the results of Table 3, the highest value of genetic similarity between Flammulina velutipes variety 'Shangyan A111' and other 264 Flammulina velutipes strains is 91.03%, and the lowest value is 0%, which shows that there is a large genetic difference between Flammulina velutipes variety 'Shangyan A111' and other Flammulina velutipes strains, and Flammulina velutipes variety 'Shangyan A111' can be effectively identified through the MNP marker site.
[0057] It should be noted that the above examples are only used to illustrate the technical solutions of the present application and are not limiting. Although the present application has been described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that the technical solutions of the present application can be modified or replaced equivalently without departing from the spirit and scope of the technical solutions of the present application, and they should be covered in the scope of the claims of the present application.
Claims
1. A method for the molecular identification of MNP of high sweet amino acid content of Flammulina velutipes (Veil-veil mushroom) strain, characterized by: Flammulina filiformis 1. A method for the molecular identification of MNP of high sweet amino acid content of Flammulina velutipes (Veil-veil mushroom) strain, characterized by: MNP molecular identification was performed using the 7 pairs of MNP-labeled primers shown in SEQ ID NO: 1-14; the *Flammulina velutipes* (… Flammulina filiformis The strain has the preservation number GDMCC No: 64424, and the described *Flammulina velutipes* (… Flammulina filiformis The strain was deposited at the Guangdong Provincial Center for Microbial Culture Collection on March 15, 2024.
2. The method of claim 1, wherein: The said preserved number is GDMCC No: 64424 of Flammulina velutipes (L. Flammulina filiformis ) strain high yield glycine and proline.
3. The method of claim 1, wherein: The said Flammulina velutipes (GDMCC No: 64424) strain has high yield of aspartic acid. Flammulina filiformis ) 4. The method of claim 1, wherein: When the fungal strain to be identified is the same as the enoki mushroom with the preservation number GDMCCNo: 64424 ( Flammulina filiformis When the genetic similarity (GS) between strains is greater than or equal to 96%, they are identified as the same strain.
5. The method of claim 4, wherein: The MNP molecular identification comprises using 7 pairs of MNP marker primers shown in SEQ ID NO: 1-14 to perform PCR amplification on the test Pholiota nameko strain, and sequencing the amplification product.
6. The method according to claim 4 or 5, characterized in that: Genetic similarity GS = n / N × 100%, where N is the similarity between the tested strain and the *Flammulina velutipes* strain with accession number GDMCC No: 64424 (…). Flammulina filiformis The number of MNP sites co-amplified by the test strain and the *Flammulina velutipes* strain with accession number GDMCC No: 64424 is given by n. Flammulina filiformis The number of MNP sites with identical genotypes among the MNP sites amplified by the strains.
Citation Information
Patent Citations
Flammulina velutipes Shangyan No.2 strain as well as identification method, construction method and application of SSR marker fingerprint spectrum thereof
CN112760238A
Hymenopellis raphanipes high-yield strain HMGIM-T43 and breeding method thereof
CN113174339A