Acinetobacter baumannii AbaR protein binding preparation and application thereof

Abstract

The invention belongs to the technical field of medicines, and relates to an acinetobacter baumannii AbaR protein binding preparation and application thereof. The morusin O can be effectively combined with AbaR protein in acinetobacter baumannii, so that an AHL quorum sensing system of the acinetobacter baumannii is inhibited. It is proved that morusin O can significantly inhibit the biofilm forming ability of the Acinetobacter baumannii ATCC 19606 strain, reduce the motility of bacteria and reduce the toxicity of bacteria to cells, and does not significantly affect the growth of bacteria to cause selective pressure to promote the evolution of drug resistance of bacteria.

Description

Technical Field

[0001] The invention belongs to the field of medical technology and relates to an Acinetobacter baumannii AbaR protein binding preparation and application thereof. Background Art

[0002] Acinetobacter baumannii is a common Gram-negative bacterium that can colonize multiple tissue sites in the human body and cause a variety of infections, including but not limited to bacteremia, pneumonia, meningitis, peritonitis, endocarditis, and urinary tract and wound skin infections. Currently, the control of Acinetobacter baumannii infections mainly relies on various antibiotics, but the widespread use of antibiotics has led to serious problems of microbial resistance.

[0003] Acinetobacter baumannii has developed resistance to a large number of antimicrobial drugs in the past few decades due to its complex resistance mechanisms and ability to easily acquire external resistance genes. The emergence and spread of carbapenem-resistant Acinetobacter baumannii (CRAB), multidrug-resistant Acinetobacter baumannii (MDR-AB), and pan-drug-resistant Acinetobacter baumannii (XDR-AB) have increased the difficulty of clinical infection control. At present, clinically, combined drug regimens are often used for infections caused by multidrug-resistant Acinetobacter baumannii, and commonly used drugs include sulbactam, polymyxins, and tigecycline. However, these drugs have strong side effects and may destroy the structure of healthy human flora. The evolution of drug resistance is closely related to clinical drug use, and continued reliance on antibiotic treatment may further induce Acinetobacter baumannii to evolve stronger drug resistance.

[0004] When bacteria grow to a certain density, they secrete quorum sensing signal molecules for intra- and inter-species communication to coordinate the release of virulence factors, affect the host microecology and physiological environment, and improve the bacterial tolerance to antimicrobial drugs and extreme environments. Acinetobacter baumannii has a typical LuxI / LuxR quorum sensing signal system network, which is composed of AHL synthase AbaI, AHL receptor and transcription activator AbaR. After AbaR binds to the AHL signal molecule, the complex binds to the promoter region of the target gene, controls the expression of downstream genes, and then regulates the biological functions of the Acinetobacter baumannii population, including virulence factor expression, plasmid transformation, motility, secretion of antimicrobial compounds, bacterial adhesion ability, biofilm formation ability, antibiotic tolerance, etc. Therefore, AbaR is a potential antibacterial target that can be used to develop quorum sensing inhibitors of Acinetobacter baumannii.

[0005] Currently, combined drug regimens are often used in clinical practice for infections caused by multidrug-resistant Acinetobacter baumannii. Commonly used drugs include sulbactam, polymyxins, and tigecycline. However, these drugs have strong side effects and may destroy the structure of healthy human flora. The evolution of drug resistance is closely related to clinical drug use, and continued reliance on antibiotic treatment may further induce Acinetobacter baumannii to evolve stronger drug resistance. Summary of the invention

[0006] The purpose of the present invention is to address the above-mentioned problems existing in the prior art. The present invention provides an Acinetobacter baumannii AbaR protein binding preparation that can specifically inhibit bacterial pathogenicity, has high safety, and will not cause Acinetobacter baumannii to develop drug resistance.

[0007] The purpose of the present invention can be achieved by the following technical scheme: a preparation of Acinetobacter baumannii AbaR protein binding, the preparation is prepared from Moracin O, and the structural formula of Moracin O is as follows:

[0008]

[0009] The present invention also provides an application of the combined preparation in preparing a pharmaceutical composition against Acinetobacter baumannii.

[0010] In the above application, the anti-Acinetobacter baumannii pharmaceutical composition includes a drug for preventing and / or treating infection by Acinetobacter baumannii or a drug for preventing and / or treating infectious diseases caused by Acinetobacter baumannii.

[0011] In the above application, the pharmaceutical composition further contains pharmaceutically acceptable excipients.

[0012] In the above application, the pharmaceutical excipient is selected from at least one of water, a surfactant, a diluent, an antioxidant, a stabilizer, and a solubilizer.

[0013] In the above application, the dosage form of the pharmaceutical composition is a solid preparation, a liquid preparation or a semisolid preparation.

[0014] In the above application, the pharmaceutical composition is at least one of a tablet, a capsule, and an injection.

[0015] In the above application, the effective concentration of the Sancin O against Acinetobacter baumannii is ≥50 μM.

[0016] In the above application, the effective concentration of the Sancin O against Acinetobacter baumannii is ≥100 μM.

[0017] In the above application, the effective concentration of the Sancin O against Acinetobacter baumannii is ≥200 μM.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] 1. The present invention utilizes sansin O to effectively bind to the AbaR protein in Acinetobacter baumannii, thereby inhibiting its AHL quorum sensing system. It has been confirmed that sansin O can significantly inhibit the biofilm formation ability of Acinetobacter baumannii ATCC 19606 strain, reduce the motility of bacteria, and reduce the toxicity of bacteria to cells, and will not significantly affect the growth of bacteria to cause selective pressure to induce bacteria to evolve drug resistance.

[0020] 2. The present invention utilizes sansin O to reduce the production of AHL signaling molecules and downregulate the transcription level of the AHL synthase encoding gene abaI. These effects indicate that sansin O is a potential effective antibacterial candidate drug that can specifically inhibit the pathogenicity of Acinetobacter baumannii without causing bacterial resistance, thereby providing a safe and effective method for treating multidrug-resistant Acinetobacter baumannii infection. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is the MST result diagram of the in vitro binding of Moracin O to AbaR protein in Example 1;

[0022] Figure 2 This is a graph showing the results of the inhibition of motility, biofilm and cytotoxicity of strain ATCC 19606 by sansin O in Example 1; DMSO was used as the control group; the data shown here are the average results of three biological experiments, and the error bars reflect the standard deviation;

[0023] Figure 3 This is a graph showing the effect of sangsin O on the growth rate of strain ATCC 19606 in Example 1; DMSO was used as the control group; the data shown here are the average results of three biological experiments, and the error bars reflect the standard deviation;

[0024] Figure 4 This is the effect of Sancin O on the AHL signal production of Acinetobacter baumannii strain ATCC 19606 in Example 1; an equal volume of DMSO was used as a control group; the data shown here are the average results of three biological experiments, and the error bars reflect the standard deviation;

[0025] Figure 5 This is Example 1. The effect of sangsin O on the transcription level of the coding genes of AHL signal synthase and receptor of Acinetobacter baumannii strain ATCC 19606; DMSO was used as a control; the average results of 3 biological experiments are shown, and the error bars reflect the standard deviation. DETAILED DESCRIPTION

[0026] The following are specific embodiments of the present invention, which further describe the technical solutions of the present invention, but the present invention is not limited to these embodiments.

[0027] Embodiment 1:

[0028] In vitro binding experiment of Sansin O and AbaR protein.

[0029] The construction method of pET28a-AbaR expression vector is as follows:

[0030] The primer sequences designed to amplify the target gene fragment are:

[0031] pET28a-Aba-F:

[0032] CAGCAAATGGGTCGCGGATCCCAATTTGATAAAGTCGACACAGC;

[0033] pET28a-Aba-R:

[0034] TTGTCGACGGAGCTCGAATTCTTAAACTTCAATCAAGCATGCAAA;

[0035] The target gene was amplified using the genomic DNA of Acinetobacter baumannii ATCC 19606 as a template, and the PCR product was recovered. The pET-28a plasmid DNA was extracted, and the plasmid DNA was also double-digested with BamHI and EcoRI, and the digested plasmid DNA was recovered for later use; the recovered PCR product and the digested plasmid were connected using the Norwegian homeologous recombinase (C112), and the connection product was transformed into BL21 (DE3) competent cells. Positive clones were screened on LB plates (containing 50μg / mL kanamycin); single clones were picked for PCR identification, and positive clones were obtained after sequencing verification;

[0036] The constructed pET28a-AbaR protein expression vector was transformed into the BL21 (DE3) expression strain and then plated on an LB plate containing 50 μg / mL kanamycin (10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl, 15 g / L agar, and the solvent was ddH2O), and cultured overnight in a 37°C constant temperature incubator; after a single colony grew out and was verified by PCR, a positive single colony was picked and inoculated into an LB culture medium containing the corresponding resistance (10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl, and the solvent was ddH2O), and cultured at 37°C with shaking overnight; 10 mL of the overnight cultured bacterial solution was taken and inoculated into 1 L LB culture medium (containing kanamycin), and continued to be shaken and cultured at 37°C until OD 600= 0.6-0.8, add IPTG with a final concentration of 500μM to the bacterial solution, place it at 16℃, 200rpm and shake overnight; collect the bacteria by centrifugation at 4℃, 4000rpm for 30min, add 50mL 1×PBS buffer to the bacteria, and suspend the bacteria thoroughly; use ultrasonic cell disruptor to break the bacteria; centrifuge at 4℃, 8000rpm for 30min to collect the supernatant and purify the 6хHis fusion protein with Ni SepharoseTM excel affinity chromatography column. Cut the fusion protein tag with thrombin protease at 4℃. Elute and separate the cleaved fusion protein and analyze it with SDS-PAGE.

[0037] The MST binding experiment of Sansin O and AbaR protein was performed using the L001 Monolith NT.115 protein labeling kit and the Monolith NT.115 instrument instructions. The binding constant (K d )Evaluate the experimental results.

[0038] Embodiment 2:

[0039] Antibacterial activity test of Sancin O:

[0040] S1. Culture conditions of Acinetobacter baumannii ATCC 19606 strain: growth temperature selected at 37°C; rotation speed selected at 220 rpm / min; culture medium selected at LB medium.

[0041] S2. Effect of sansin O on biofilm of Acinetobacter baumannii strain ATCC 19606: Acinetobacter baumannii activated overnight on LB plates was inoculated into the culture medium and cultured until the exponential growth phase; the initial OD of the bacterial solution was measured. 600 Use fresh LB culture medium to dilute the bacterial solution to OD 600 About 0.1; add the sansin O solution (dissolved in DMSO solvent, with an equal volume of DMSO as a control) prepared in different concentrations (200mM, 100mM, 50mM) to the above bacterial solution at a volume ratio of 1:1000 and mix. Transfer the above bacterial solution to a 96-well plate, 100μL per well; incubate at 37°C for 24h and then take out the 96-well plate; discard the bacterial solution, add 100μL of 0.1% crystal violet to each well, and incubate at 37°C for 0.5h; discard the crystal violet; and wash several times with ddH2O; after drying, re-dissolve each well with 100μL of 95% ethanol. Measure the optical density (OD) of the solution at 570nm 570 ) to quantify biofilm formation. Experiments were repeated at least three times.

[0042] S3. Determination of the effect of sansin O on the growth of Acinetobacter baumannii strain ATCC 19606: The glycerol strain was activated on the LB plate, and then a single colony was picked and inoculated into LB medium and cultured overnight with shaking; the initial OD of the bacterial solution was measured 600 Dilute the bacterial solution to OD with fresh LB culture medium 600 =0.01 or OD 600 =0.1; add 50mM, 100mM, and 200mM sansin O solutions (dissolved in DMSO solvent, with an equal volume of DMSO as a control) to the above bacterial solution at a volume ratio of 1:1000 and mix. Add 100μL of the above bacterial solution to the 96-well plate for growth curve determination; use a fully automatic growth curve determination instrument to detect the growth curve data and draw a growth curve. Repeat the experiment at least 3 times.

[0043] S4. Effect of sangsin O on the motility of Acinetobacter baumannii strain ATCC 19606: A single colony of Acinetobacter baumannii activated overnight on an LB plate was inoculated into a liquid LB medium and cultured to the exponential growth phase. A motility semisolid medium (10% tryptone, 5% sodium chloride, 3% agar) containing 200 μM, 100 μM, and 50 μM sangsin O was prepared. Then 1 μL of the bacterial solution was inoculated into the center of the motility medium plate, and the movement trajectory was observed after static culture at 37°C for 8 hours.

[0044] S5. Effect of Sangsin O on the toxicity of Acinetobacter baumannii strain ATCC 19606 cells: The cell line selected was A549 cells, and the culture medium was DMEM (10% FBS). The culture was carried out in an incubator at 37°C and 5% CO2. The lactate dehydrogenase activity was measured by an enzyme reader to evaluate the toxicity level of Acinetobacter baumannii infecting cells. This experiment used the cytoTOX96 kit from Promega. According to the instructions of the kit, the following operations were performed: the Acinetobacter baumannii glycerol bacteria were activated on the LB plate, a single colony was picked and inoculated in 10 mL of fresh liquid LB, and cultured overnight; the bacterial solution was centrifuged at 4000 rpm, the supernatant was discarded, the bacteria were resuspended with DMEM (1% FBS) culture medium, and the bacterial solution OD was adjusted. 600 The concentration of sangsin O solution (dissolved in DMSO solvent, with an equal volume of DMSO as control) prepared in different concentrations (200mM, 100mM, 50mM) was added to the above bacterial solution at a volume ratio of 1:1000 to make the final concentrations of 200μM, 100μM, and 50μM. A549 cells were cultured in DMEM medium supplemented with 10% FBS at a rate of 1×10 5The cells were grown in a 96-well tissue culture plate at a cell density of 100 cells / well until attached. The cell culture medium was aspirated and washed twice with sterile 1×PBS for later use. 100 μL of the above bacterial cells were added to each well of the 96-well plate containing A549 cells and incubated for 8 hours. At 7 hours and 15 minutes, 10 μL of lysis solution was added to the positive wells and cultured for another 45 minutes. At the end of the incubation, 50 μL of supernatant was added to each well of another 96-well plate. After 50 μL of reaction solution was added to each well, the reaction was protected from light for 0.5 hours. 50 μL of stop solution was added to terminate the reaction. OD was detected by a multifunctional microplate reader. 490 This experiment was repeated at least three times.

[0045] Embodiment 3:

[0046] Effects of sansin O on the AHL signaling system of Acinetobacter baumannii ATCC 19606 strain.

[0047] Effect of sansin O on AHL signal production of Acinetobacter baumannii ATCC 19606 strain: The overnight activated Acinetobacter baumannii ATCC 19606 seed solution was inoculated into 1L of fresh LB culture medium and cultured with shaking until OD 600 = about 3.0. Centrifuge the bacterial solution at 4000rpm for 30min, collect the supernatant; add an equal volume of ethyl acetate for extraction, and concentrate the extract. Redissolve the remaining concentrate with 1mL of methanol and filter with a 0.22μm microporous filter membrane. Transfer the sample to a HPLC sample bottle for later use. Detect using UHPLC-ESI-MS / MS, using Waters C 18 The chromatographic column (1.8 μm, 150×2.1 mm) was used for detection, 3-OH-C12-HSL was selected as the analytical reference, the mass spectrometer was operated in the positive ion mode, and the mobile phase was 0.1% formic acid / water and acetonitrile.

[0048] Effect of sangsin O on the transcription level of the coding genes of AHL signal synthase and receptor of Acinetobacter baumannii ATCC 19606 strain: The wild-type strain of Acinetobacter baumannii ATCC 19606 was inoculated into fresh liquid LB, and sangsin O solutions prepared with different concentrations (200mM, 100mM, 50mM) were dissolved in DMSO solvent. An equal volume of DMSO was added to the above bacterial solution at a volume ratio of 1:1000 as a control to make the final concentrations of 200μM, 100μM, and 50μM. The culture was shaken until OD 600 =1.0. According to Shanghai Promega RNA was extracted according to the instructions of Super Total RNA Extraction Kit. Reverse transcription of mRNA was performed according to the instructions of HiScript III RT SuperMix for qPCR (+gDNA wiper) of Nanjing Novab Biotechnology Co., Ltd. The specific experimental protocol of RT-qPCR was based on the ChamQTM Universal Follow the instructions of qPCR Master Mix.

[0049] Table 1: Primer sequences

[0050] Sequence number Primers Sequence (5'-3') SEQ ID NO 1 abaI-F AAAACCCGCAGCACGTAATA SEQ ID NO 2 abaI-R ATCCGCCTTCCTCTAGCAGT SEQ ID NO 3 abaR-F ACCCTTATCTATTGCTGAACC SEQ ID NO 4 abaR-R TGACTGAGCCCAACCGACAT SEQ ID NO 5 ATCC 19606-16S-F CCTGTAAACCGTAATGCTCC SEQ ID NO 6 ATCC 19606-16S-R TGTCACTTAAACCACCCTCA

[0051] Statistical analysis: Data are presented as mean ± standard deviation (SD) of three independent experiments. Statistical analysis was performed using Prism 8 software (GraphPad). Statistical significance is as follows: ns = no significant difference, *p < 0.05, **p < 0.01, ***p < 0.001

[0052] (One-way ANOVA or two-way ANOVA). Error bars are represented by SD.

[0053] like Figure 1 As shown in Figure 2, in vitro experiments have shown that sansin O binds to the AHL receptor protein AbaR of Acinetobacter baumannii. The results obtained by MST detection analysis are as follows Figure 1 As shown, the binding constant K of Sancin O and AbaR protein was determined d The value was 22.7±3.3 μM. This indicated that Sancin O had in vitro binding effect with Acinetobacter baumannii AbaR protein.

[0054] Sancin O has an inhibitory effect on the motility of Acinetobacter baumannii strain ATCC 19606. Figure 2 As shown, with DMSO as the control, the motility of Acinetobacter baumannii strain ATCC19606 treated with 50μM, 100μM, and 200μM sansin O decreased by 21.42%, 38.09%, and 54.76%, respectively. This indicates that sansin O has a good inhibitory effect on the motility of Acinetobacter baumannii strain ATCC 19606 ( Figure 2 A).

[0055] Sancin O has an inhibitory effect on the biofilm of Acinetobacter baumannii strain ATCC 19606. Figure 2As shown in B, with DMSO as the control, the biofilm formation ability of Acinetobacter baumannii strain ATCC19606 treated with 50μM, 100μM, and 200μM sansin O was reduced by 24.04%, 37.81%, and 54.26%, indicating that sansin O has a certain inhibitory effect on the biofilm formation ability of Acinetobacter baumannii strain ATCC 19606.

[0056] Sancin O has an inhibitory effect on the cytotoxicity of Acinetobacter baumannii strain ATCC 19606. The cytotoxicity was detected by detecting the release of LDH. When detecting the effect of Sancin O on the cytotoxicity of Acinetobacter baumannii strain ATCC 19606, the LDH release of the DMSO group added to the Acinetobacter baumannii strain ATCC 19606 was taken as 100%, and the LDH release ratio of different concentrations of Sancin O was standardized. Under the condition of adding Acinetobacter baumannii ATCC 19606, with DMSO as the control, when Sancin O was 50μM, 100μM, and 200μM, the toxicity of Acinetobacter baumannii ATCC 19606 to A549 cells was reduced to 18.79%, 27.47%, and 44.94% or less ( Figure 2 C).

[0057] Sancin O has no inhibitory effect on the growth of Acinetobacter baumannii strain ATCC 19606 cells. Taking DMSO as the control, the growth rate of Acinetobacter baumannii ATCC19606 strain treated with Sancin O at final concentrations of 50μM, 100μM and 200μM in LB medium was not significantly affected. This result shows that the therapeutic effect of Acinetobacter baumannii strain ATCC 19606 treated with Sancin O is not achieved by killing bacterial cells, so it is not easy to develop drug resistance ( Figure 3 ).

[0058] Effect of sangsin O on the 3-OH-C12-HSL signal production of Acinetobacter baumannii strain ATCC 19606. Quantitative analysis of 3-OH-C12-HSL signal by LC-MS / MS showed that compared with the wild-type strain, the 3-OH-C12-HSL signal production of Acinetobacter baumannii ATCC 19606 strain treated with sangsin O at final concentrations of 50 μM, 100 μM and 200 μM decreased by 23.42%, 38.80% and 54.52%, respectively. Figure 4 ).

[0059] Effects of sansin O on the transcriptional levels of abaI, the gene encoding the synthase of the AHL signaling system, and abaR, the gene encoding the receptor protein, in Acinetobacter baumannii strain ATCC 19606. Figure 5It can be seen that the transcription levels of the AHL signaling system synthase encoding gene abaI and the receptor protein encoding gene abaR were detected by RT-qPCR and promoter fusion lacZ reporter system experiments. The results showed that 50μM, 100μM and 200μM of sangsin O could significantly inhibit the transcription level of the AHL signaling system synthase encoding gene abaI, but had almost no effect on the transcription level of its receptor protein encoding gene abaI.

[0060] In summary, the compound sangxinsu O provided by the present invention targets AbaR and can inhibit the AHL signal production, pathogenic phenotype and toxicity of Acinetobacter baumannii by directly binding to AbaR protein. When the concentration of sangxinsu O reaches 50 μM, the transcription level of the AHL synthase encoding gene abaI and the signal production of AHL can be inhibited. Sangxinsu O has good pharmacological activity against Acinetobacter baumannii, does not inhibit the growth rate of the test strain ATCC 19606, and when the concentration reaches 50 μM or more, it shows an inhibitory effect on the obvious motility, biofilm formation ability and cytotoxicity of Acinetobacter baumannii. In summary, the compound sangxinsu O has a good interference inhibitory effect on the AHL-type quorum sensing system of Acinetobacter baumannii, and shows a significant antibacterial effect. Since the compound sangxinsu O does not directly inhibit the growth of Acinetobacter baumannii and does not produce selective pressure on Acinetobacter baumannii, it will not lead to the production of drug-resistant pathogens. Therefore, sangxinsu O has a good application prospect in the development of new antibacterial drugs, especially in the development of drugs for anti-Acinetobacter baumannii infection.

[0061] The parts of the embodiments herein that are not exhaustive of the midpoint values ​​of the technical scope claimed for protection by the present invention and the new technical solutions formed by equivalent replacement of single or multiple technical features in the technical solutions of the embodiments are also within the scope claimed for protection by the present invention; at the same time, in all the listed or unlisted embodiments of the scheme of the present invention, each parameter in the same embodiment merely represents an example of its technical solution (i.e., a feasible solution), and there is no strict coordination and limitation relationship between the parameters, wherein the parameters can be replaced with each other without violating the axioms and the claims of the present invention, unless otherwise stated.

[0062] The technical means disclosed in the scheme of the present invention are not limited to the technical means disclosed in the above technical means, but also include technical schemes composed of any combination of the above technical features. The above is a specific implementation of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications are also regarded as the protection scope of the present invention.

[0063] The specific embodiments described herein are merely examples of the spirit of the present invention. Those skilled in the art may make various modifications or additions to the specific embodiments described or replace them in similar ways, but they will not deviate from the spirit of the present invention or exceed the scope defined by the appended claims.

Claims

1. A preparation for binding AbaR protein of Acinetobacter baumannii, characterized in that: The preparation is prepared from mulberry extract O, and the structural formula of mulberry extract O is as follows:

2. Use of the combined preparation as claimed in claim 1 in the preparation of a pharmaceutical composition against Acinetobacter baumannii.

3. The use according to claim 2, characterized in that: The pharmaceutical composition against Acinetobacter baumannii includes a drug for preventing and / or treating infection with Acinetobacter baumannii or a drug for preventing and / or treating infectious diseases caused by Acinetobacter baumannii.

4. The use according to claim 3, characterized in that: The pharmaceutical composition also contains pharmaceutically acceptable excipients.

5. The use according to claim 4, characterized in that: The pharmaceutical excipient is selected from at least one of water, a surfactant, a diluent, an antioxidant, a stabilizer, and a solubilizer.

6. The use according to claim 3, characterized in that: The dosage form of the pharmaceutical composition is a solid preparation, a liquid preparation or a semisolid preparation.

7. The use according to claim 3, characterized in that: The pharmaceutical composition is at least one of a tablet, a capsule, and an injection.

8. The use according to claim 2, characterized in that: The effective concentration of Sancin O against Acinetobacter baumannii is ≥50 μM.

9. The use according to claim 2, characterized in that: The effective concentration of the Sancin O against Acinetobacter baumannii is ≥100 μM.

10. The use according to claim 2, characterized in that: The effective concentration of the Sancin O against Acinetobacter baumannii is ≥200 μM.

Images