Kit, application of kit in pathogen detection and product

Abstract

The invention particularly relates to a kit, application of the kit in pathogen detection and a product. According to the specific technical scheme, the kit comprises a middle-layer structure and a lower-layer structure, the middle-layer structure comprises a middle plate, and a sample adding reaction bin is arranged at one end of the middle plate and used for containing a reagent reacting with a to-be-detected sample; a notch is formed in one side of the sample adding reaction bin and is communicated with the reagent strip through a sample channel; a detection line and a quality control line capable of detecting a sample to be detected are arranged on the reagent strip; and the lower layer structure can provide the required temperature for the reaction in the sample adding reaction bin. According to the joint detection kit and the detection method, isothermal amplification and a visual reagent strip technology are combined at the same time, and qualitative detection of specific pathogens can be conveniently and rapidly achieved. The invention also provides a primer group capable of simultaneously detecting two influenza viruses based on the kit and the method, and the detection sensitivity and accuracy are high.

Description

Technical Field

[0001] The present invention belongs to the field of PCR technology, and in particular relates to a kit and its application in detecting pathogens and a product. Background Art

[0002] Rapid and convenient simultaneous detection of multiple pathogens is a common pursuit in the fields of genetics and medicine. Existing detection methods are highly dependent on complex and sophisticated equipment and have limited application scenarios. In addition, when detecting multiple pathogens at the same time, especially when detecting multiple pathogens with close genetic relationships, the detection accuracy is often very low and the detection sensitivity is not high.

[0003] Therefore, if a product can be provided that can detect multiple pathogens at the same time and can complete the detection in the wild, places with dense population flow, and ordinary people's homes, it will have important practical significance and promotion value. Summary of the invention

[0004] The purpose of the present invention is to provide a kit and its application in detecting pathogens and a product.

[0005] In order to achieve the above-mentioned invention object, the technical solution adopted by the present invention is:

[0006] A test kit comprises a middle structure and a lower structure; the middle structure comprises a middle plate, one end of the middle plate is provided with a sample loading reaction chamber, the sample loading reaction chamber is used to place a reagent that reacts with a sample to be tested; a notch is provided on one side of the sample loading reaction chamber, the notch is connected to a reagent strip through a sample channel; a detection line and a quality control line that can detect the sample to be tested are provided on the reagent strip; the lower structure can provide the required temperature for the reaction carried out in the sample loading reaction chamber.

[0007] Preferably, the lower structure comprises a heating plate, and the heating plate is electrically connected to a power source.

[0008] Preferably, the reagent kit comprises an upper structure, the upper structure comprises an upper cover, and a sample addition port is arranged on the upper cover; the sample addition reaction chamber corresponds to and is in communication with the sample addition port in the upper structure.

[0009] Preferably, the sample channel is arranged obliquely toward the reagent strip.

[0010] A primer set, the primer set includes primers B3, F3, BIP, FIP, LB, and LF for detecting type A influenza virus, and the sequences are shown in SEQ ID NOs: 1 to 6, respectively; the primer set includes primers B3, F3, BIP, FIP, LB, and LF for detecting type B influenza virus, and the sequences are shown in SEQ ID NOs: 7 to 12, respectively.

[0011] Correspondingly, the primer set is used in detecting influenza virus.

[0012] Preferably, when the primer set is used to detect influenza virus, the LAMP solution components used for amplification include: a mixture of DNA polymerase, reverse transcriptase, RNase inhibitor, buffer and the primer set.

[0013] Preferably, the LAMP is a freeze-dried ball, which includes a freeze-dried protective agent, and the freeze-dried protective agent component includes any one or a combination of bovine serum albumin, trehalose, and PEG20000.

[0014] Preferably, the lyoprotectant component comprises a protein stabilizer.

[0015] Preferably, the protein stabilizer is any one of SCO1 and SCO2 or a combination of both.

[0016] Correspondingly, a reagent strip, a kit or a test paper comprising the primer set.

[0017] Preferably, the test kit includes a middle structure and a lower structure; the middle structure includes a middle plate, one end of the middle plate is provided with a sample loading reaction chamber, the sample loading reaction chamber is used to place reagents that react with the sample to be tested; a notch is provided on one side of the sample loading reaction chamber, the notch is connected to the reagent strip through a sample channel; the reagent strip is provided with a detection line and a quality control line that can detect the sample to be tested; the lower structure can provide the required temperature for the reaction carried out in the sample loading reaction chamber.

[0018] Preferably, the lower structure comprises a heating plate, and the heating plate is electrically connected to a power source.

[0019] Preferably, the reagent kit comprises an upper structure, the upper structure comprises an upper cover, and a sample addition port is arranged on the upper cover; the sample addition reaction chamber corresponds to and is in communication with the sample addition port in the upper structure.

[0020] The present invention has the following beneficial effects:

[0021] The present invention provides a set of primers that can simultaneously detect two or more influenza viruses in a targeted manner, with high detection sensitivity and accuracy. The present invention also provides a joint detection kit and a detection method based on the primer set, which combines isothermal amplification and visualization reagent strip technology, can be amplified in the kit, and the amplified product can be color-developed by a colloidal gold chromatography reagent strip, thereby conveniently and quickly realizing the qualitative detection of specific pathogens.

[0022] The kit provided by the present invention is suitable for various test samples requiring a specific reaction temperature range, for example, the kit is used to perform LAMP detection of viruses in the sample to be detected. In some embodiments, the sample loading reaction chamber in the present invention can be used to place the LAMP reaction reagent, and the reaction temperature is provided for the LAMP reaction by the heating plate to complete the LAMP reaction, and the colloidal gold chromatography reagent strip is combined for color development reaction, so that when testing the sample, the operator only needs to drop the sample to be tested into the sample loading reaction chamber to complete the LAMP reaction and amplification product detection on the kit, and the operation is convenient and fast. The sample channel is preferably arranged at an angle, and the inclined arrangement can increase the reaction volume of the sample loading reaction chamber on the one hand, and provide more sufficient space for the reaction of the sample to be tested in the sample loading reaction chamber, and on the other hand, after the LAMP reaction is completed, the chromatography buffer is added and mixed, and when the total solution exceeds the minimum holding volume of the sample loading reaction chamber, the reaction solution can flow to the reagent strip through the sample channel, so that the sample after the reaction flows to the reagent strip better and more fully. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 Schematic diagram of the structure of the reagent strip;

[0024] Figure 2 A schematic diagram of the upper structure of the kit provided by the present invention;

[0025] Figure 3 A schematic diagram of the middle structure of the kit provided by the present invention;

[0026] Figure 4 A schematic diagram of the lower structure of the test kit provided by the present invention;

[0027] Figure 5 Schematic diagram of the results of influenza virus A detection using different primer sets;

[0028] Figure 6 Schematic diagram of the results of influenza virus B detection using different primer sets;

[0029] Figure 7 This is a schematic diagram of the results of simultaneously detecting influenza viruses A and B using the kit. DETAILED DESCRIPTION

[0030] The present invention provides a method for simultaneously detecting two pathogens, comprising the following steps:

[0031] 1. Sample pretreatment: extract sample nucleic acid, or perform lysis treatment on the sample.

[0032] 2. LAMP amplification. LAMP reagents include: DNA polymerase, RNase inhibitor, reverse transcriptase, buffer, first pathogen LAMP primer, and second pathogen LAMP primer. Add the sample treated in step 1 to the LAMP amplification reagent, perform LAMP amplification reaction, and obtain a reaction solution.

[0033] The preferred solution is: the LAMP reagent is prepared as a freeze-dried product before use, the buffer is a freeze-dried buffer, and the DNA polymerase is Bst DNA polymerase. The more preferred solution is: the LAMP reagent is prepared as a freeze-dried pellet before use.

[0034] 3. Add the reaction solution dropwise and perform chromatography reaction.

[0035] Based on the above method, the present invention also provides a product that can detect at least two pathogens simultaneously, and the product can be prepared into a kit, a reagent strip, a test paper, etc. as needed.

[0036] The test strip or reagent strip can be set up as follows: Figure 1 As shown, the reagent strip includes a bottom plate, which can be a PVC bottom plate, and a sample pad 10, a gold pad 11, a NC membrane 12 and an absorption pad 13 are laid out in sequence from one end of the bottom plate to the other end. A portion of the gold pad 11 is located between the sample pad 10 and the bottom plate, and the other portion exceeds the sample pad 10 and is located on the upper surface of the NC membrane 12. T lines and C lines are sequentially arranged on the NC membrane 12 as needed. In the embodiment of the present invention, two T lines are arranged: T1 (Biotin anti) and T2 (DIG anti); the C line is arranged with sheep anti-mouse. The other end of the NC membrane 12 extends between the absorption pad 13 and the bottom plate. The reagent strip is a colloidal gold test strip. The reagent strip setting method is a mature prior art, and those skilled in the art can select and adjust it according to actual conditions.

[0037] The detection product is preferably a kit. The kit structure is as follows Figures 2 to 4 As shown, the test kit is divided into three layers, upper, middle and lower. The three layers have corresponding sizes and shapes and can be connected to form a whole. The three layers can be detachably connected, such as snap-fit ​​connections, or can be fixedly connected by adhesive or other methods. Figure 2 As shown, the middle structure is Figure 3 As shown, the lower structure is as Figure 4 It should be noted that the three-layer structure is exemplary and not limited to only three layers.

[0038] The upper layer of the reagent box includes an upper cover 20, and a sample adding port 21 is provided on the upper cover 20 for adding the treated sample. A viewing window 22 is also provided on the upper cover 20 for observing the reaction result after adding the sample. A power switch 23 is also provided on the upper cover 20.

[0039] The middle layer of the test kit includes an intermediate plate 30, and a sample loading reaction chamber 31 is arranged at one end of the intermediate plate 30. The sample loading reaction chamber 31 corresponds to and is connected to the sample loading port 21 in the upper structure. The sample is added dropwise from the sample loading port 21 of the upper layer and enters the sample loading reaction chamber 31. The sample loading reaction chamber 31 is filled with LAMP freeze-dried balls. A more preferred scheme is: a sealing film is arranged in the sample loading reaction chamber 31. When not in use, the LAMP freeze-dried balls are sealed inside the sample loading reaction chamber 31 by the sealing film to prevent the freeze-dried balls from absorbing moisture and affecting the performance. The sealing film can be selected as an automatic dissolving film or an external force removal film. If an automatic dissolving film is selected, the sealing film can be dissolved by the added sample and does not affect the reaction; if it is an external force removal film, a plastic sealing film made of materials such as aluminum foil or soft plastic can be directly used, and it can be torn off or broken (for example, punctured) by external force before it is needed to be added dropwise.

[0040] The sample loading reaction chamber 31 is provided with a notch toward the middle of the reagent kit, and the notch has a certain height along the axial direction of the sample loading reaction chamber 31. When the liquid in the sample loading reaction chamber 31 reaches the set height, it can overflow from the notch. The height of the notch can be set as needed, and the height of the notch should be greater than the axial height formed by the total LAMP reaction system in the sample loading reaction chamber 31 in the sample loading reaction chamber 31, so as to allow the reaction liquid obtained by the LAMP reaction of the sample to overflow after mixing with the chromatography buffer. The notch is connected to the reagent strip 33 through the sample channel 32. The sample channel 32 is preferably arranged at an angle. On the one hand, the inclined arrangement can increase the reaction volume of the sample loading reaction chamber 31 and provide more sufficient space for the reaction of the sample to be tested in the sample loading reaction chamber 31. On the other hand, after the LAMP reaction is completed, the chromatography buffer is added for mixing. When the total solution exceeds the minimum holding volume of the sample loading reaction chamber 31, the reaction liquid can flow to the reagent strip 33 through the sample channel 32, so that the sample after the reaction can flow to the reagent strip 33 better and more fully. The reagent strip 33 can be as follows Figure 1 The position of the reagent strip 33 corresponds to the window 22 in the upper structure of the reagent kit, so that the color development of the T line and the C line can be observed from the window 22. The reagent strip 33 is fixed on the middle plate 30, and the fixing method can be a detachable connection or a fixed connection.

[0041] The lower layer of the reagent box includes a cover plate 40, on which a heating plate 41 is arranged, and the heating plate 41 corresponds to the sample loading reaction chamber 31, so as to provide the required reaction temperature for the LAMP reaction. The heating plate 41 can be connected to an external power supply or to a built-in power supply inside the reagent box for heating and temperature control. Figure 4The method is to set a built-in power supply 42 such as a button battery, which is electrically connected to the heating plate 41. The built-in power supply 42 is electrically connected to the power switch 23 to control the opening and closing of the heating plate 41. The temperature of the heating plate 41 should be adapted to the LAMP reaction temperature to provide the required reaction temperature for the LAMP reaction to ensure the reaction temperature of the reaction chamber 31. A more preferred solution is that the heating temperature of the heating plate is controllable and the temperature on the power switch 23 is optional.

[0042] The sample loading reaction chamber 31 in the present invention can be used to place LAMP reaction reagents, and the reaction temperature is provided for the LAMP reaction by the heating plate 41 to complete the LAMP reaction, and the colloidal gold chromatography reagent strip is combined for color development reaction, so that when testing the sample, the operator only needs to drop the sample to be tested into the sample loading reaction chamber 31 to complete the LAMP reaction and amplification product detection on the test kit, which is convenient and fast to operate. Preferably, the present application adopts a combination of LAMP freeze-dried balls and sealing film sealing, which is convenient for transportation and storage, and further avoids reagent contamination, and is particularly suitable for testing various pathogen samples. The test kit provided in the present application can be optimized by multiple LAMP systems, and multiple detection lines are provided on the colloidal gold reagent strip to achieve joint detection of at least two samples. The sample loading hole 21 on the upper cover 20 is separated from the sample loading reaction chamber 31 in physical space, which effectively avoids reagent contamination; the sample loading hole 21 and the power switch 23 are set on the same interface, which is more convenient to operate.

[0043] Based on the above method and product, the present invention also provides a primer, method and product that can simultaneously detect influenza A virus (InfluenzaA virus), also known as influenza A virus (hereinafter referred to as influenza virus A) and influenza B virus (Influenza B virus), also known as influenza B virus (hereinafter referred to as influenza virus B). The primer sequence for detecting influenza virus A is shown in Table 1, and the primer sequence for detecting influenza virus B is shown in Table 2. The sequence is from 5' to 3' from left to right. The 5' label of LB and LF primers can be conventionally adjusted as needed. When in use, the primers described in Table 1 and Table 2 are prepared into LAMP reagents according to the above method and then used.

[0044] Table 1 Primer sequences for detecting influenza virus A

[0045]

[0046] Table 2 Primer sequences for detecting influenza virus B

[0047]

[0048]

[0049] The technical solutions in the embodiments of the present invention will be described clearly and completely below in conjunction with the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art. The data obtained are all average values ​​obtained after at least 3 repetitions, and all the data obtained in each repetition are valid data.

[0050] Example 1: Preparation of LAMP reagent

[0051] 1. Preparation of liquid LAMP reagent. LAMP reagent includes: Bst enzyme 2.0μL (40U), reverse transcriptase 0.5μL (30U), RNase inhibitor 0.05μL (20U), UDG enzyme 0.5μL (1U), Buffer 5μL, primer mix 4μL, and deionized water to a total volume of 20μL. Among them, the buffer can be selected from: 200mM Tris-HCl (pH=8.8), 200mM KCl, 80mM (NH)4SO4, 25mM MgSO4, 0.4% TritonX-100, 0.1% BSA, 50mM dNTP.

[0052] 2. Preparation of LAMP freeze-dried pellets.

[0053] The LAMP reagent is prepared as a freeze-dried ball, which can effectively extend the shelf life and service life, reduce the storage cost, and facilitate storage, transportation and use in practice. In this embodiment, under the same other conditions, freeze-dried Buffer is used to replace the Buffer in the LAMP reagent of step 1. The freeze-dried Buffer formula is: 200mM Tris-HCl (pH=8.8), 200mM KCl, 80mM (NH)4SO4, 25mM MgSO4, 0.4% (g / mL) TritonX-100, and freeze-dried protective agent.

[0054] In freeze-drying preparation, the selection of lyoprotectants is crucial. Lyoprotectants can protect and maintain enzyme activity during the freeze-drying process, and can also act as excipients for freeze-dried balls. If the lyoprotectant is not selected ideally, it will not only fail to play a protective role, but may also have a negative impact on the amplification reaction. When using different lyoprotectants, the dosage is also different. Lyoprotectants can be selected as: 0.3%~0.5% (g / mL) BSA (bovine serum albumin), 4%~10% (g / mL) trehalose, 3%~6% (g / mL) PEG20000.

[0055] The effect of lyophilized protective agents on amplification reactions was tested by amplifying the plasmids of influenza virus A and influenza virus B, respectively. Under the same conditions, the LAMP lyophilized beads prepared using liquid LAMP reagent and different lyophilized protective agents were tested and amplified at concentrations of 50 copies / μL and 200 copies / μL of influenza virus A and influenza virus B, respectively. Ten replicates were amplified in each group. The CT value of each group was calculated and the changes in the fluorescence peak were observed. The CT value was calculated as the average of 10 replicates.

[0056] According to the test results (amplification signal intensity, freeze-dried bead morphology and freeze-dried bead reconstitution speed), the freeze-dried protective agent is selected to contain trehalose, BSA and PEG20000. The preferred freeze-dried protective agent formula is: 200mM Tris-HCl (pH=8.8), 200mM KCl, 80mM (NH)4SO4, 25mM MgSO4, 0.4% TritonX-100, 0.5% BSA (bovine serum albumin), 8% trehalose, 5% PEG20000.

[0057] According to the preferred formula, LAMP freeze-dried balls were prepared, accelerated at 37°C, and stored in a sealed container at room temperature, and their performance stability and real-time stability after acceleration were tested. The 37°C acceleration refers to the high temperature accelerated stability evaluation under a constant temperature environment of 37°C for a period of time. The results showed that the amplification signal decreased after 3 weeks of acceleration.

[0058] In order to improve the storage stability of the freeze-dried balls, a protein stabilizer is further added. The test formula is: add 5% (v / v) of protein stabilizer to the above-mentioned preferred freeze-dried protective agent formula, and the protein stabilizers are SCO1 and SCO2 respectively. Then prepare LAMP freeze-dried balls under the same conditions, and continue to accelerate at 37°C and store in a closed state at room temperature. The morphology of the freeze-dried balls in each group was observed every week, and amplification was performed once. The results were as follows: the group containing SC01 was accelerated at 37°C for 1 month and stored at room temperature for two months. The freeze-dried balls maintained their complete morphology, the color was white, and the appearance did not change. The performance verification of the freeze-dried balls after storage was met after re-dissolution, and the average CT value changed by ±1. The group containing SC02 was accelerated at 37°C for 1 month and stored at room temperature for two months. The freeze-dried balls maintained their complete morphology, the color was white and did not change. The performance verification of the freeze-dried balls after storage was unqualified after re-dissolution, and the CT value was delayed.

[0059] Comprehensive selection of protein stabilizer SCO1 (manufacturer: surmodics). Adding protein stabilizer SCO1 at a volume ratio of 5% to 10% in the freeze-dried system can effectively improve the storage stability of freeze-dried beads. When the addition amount is 5%, the beads can be stably stored at room temperature for more than 6 months.

[0060] According to the above test results, the formula of freeze-dried buffer was determined as follows: 200 mM Tris-HCl (pH = 8.8), 200 mM KCl, 80 mM (NH) 4 SO 4, 25 mM MgSO 4, 0.4% Triton X-100, 0.5% (g / mL) BSA, 5% (v / v) SC01, 8% (g / mL) trehalose, and 5% (g / mL) PEG 20000.

[0061] Example 2: Preparation of test products

[0062] 1. Preparation of the reagent strip. The reagent strip can be prepared using the LAMP freeze-dried beads prepared in Example 1 and the pathogen template to be detected according to conventional techniques in the art. This example provides one of the optional methods.

[0063] Colloidal gold labeling. Measure 100mL of 40nm colloidal gold solution and 5mL of 0.1M BB (boric acid buffer, pH=9.0) into a beaker and stir for 10 minutes. Then add 1.0mg FAM antibody to the beaker, mix well, and stir for 30 minutes. Then add 1mL of 10% BSA and continue stirring for 20 minutes. The obtained solution is divided into centrifuge bottles and centrifuged at 16000rpm, 14000g at 4°C for 30 minutes.

[0064] After centrifugation, the supernatant was aspirated, and T-Gold from different centrifuge bottles was transferred to the same centrifuge bottle with a pipette and mixed. The volume was adjusted to 8 mL with 0.01 M BB (BSA) and mixed.

[0065] Preparation of gold pad. Prepare the gold solution: one glass fiber (7×28mm). Formula: total volume 1.4mL, colloidal gold labeled product (12%) = 168μL, gold buffer = 1232μL. Gold buffer: Tris 3.03g, citric acid 3.2g, PEG 0.5g, PVP 0.5g, BSA 1g, sucrose 12.5g, deionized water to 500mL, pH = 8.0. The gold pad was dried at 37℃ for 4 hours.

[0066] Preparation of NC membrane: A stripping solution of 30 μL for a 30 cm×2.5 cm NC membrane includes 1.5 μL of 50% trehalose, 0.2 μL of 25 mM EDTA, 45 μg of antibody (biotin antibody or DIG antibody), and 0.01 M PBS to make up to 30 μL.

[0067] The film can be drawn according to the number of items to be tested, and dried at 37℃ for 2 hours after the film is drawn.

[0068] Reagent strip assembly: structure as Figure 1As shown, NC membrane is laid on the PVC base plate, a sample pad is set at one end of the NC membrane, a gold pad is set on the side of the sample pad close to the other end of the PVC base plate, and an absorption pad is set on the opposite side of the PVC base plate. The membrane is drawn between the gold pad and the absorption pad as needed: if one pathogen is detected, lines T and C are drawn; if two pathogens are detected, lines T1, T2, and C are drawn.

[0069] 2. Preparation of the kit. Figures 2 to 4 As shown, the test kit is divided into three layers, upper, middle and lower. The test kit is divided into three layers, upper, middle and lower, and the three-layer structure can be snap-connected to form a whole. The upper layer of the test kit includes an upper cover 20, and a sample addition port 21 is provided on the upper cover 20 for dripping the treated sample. The upper cover 20 is also provided with a window 22 for observing the reaction result after the sample addition. The upper cover 20 is also provided with a power switch 23. The middle layer of the test kit includes an intermediate plate 30, and a sample addition reaction chamber 31 is provided at one end of the intermediate plate 30. The sample addition reaction chamber 31 corresponds to and is connected with the sample addition port 21 in the upper structure. The sample enters the sample addition reaction chamber 31 after being dripped from the sample addition port 21 of the upper layer. The sample addition reaction chamber 31 is filled with LAMP freeze-dried balls.

[0070] The sample loading reaction chamber 31 is provided with a notch toward the middle of the reagent box, and the notch has a certain height, and when the liquid in the sample loading reaction chamber 31 reaches 50 μL, it can overflow from the notch. The notch is connected to the reagent strip through an inclined sample channel 32. The position of the reagent strip corresponds to the window 22 in the upper structure of the reagent box, so that the color development of the T line and the C line can be observed from the window 22.

[0071] The lower layer of the reagent kit includes a cover plate 40, on which a heating plate 41 connected to a built-in power source 42 is disposed, and the heating plate 41 corresponds to the sample loading reaction chamber 31, so as to generate heat when the LAMP freeze-dried balls need to be heated and melted. The heating temperature is controlled at 60-65°C.

[0072] When using, if there is only a reagent strip, mix the test object (sample / nucleic acid extract) with the LAMP solution (if the LAMP is a freeze-dried ball, melt it first and then mix it) and perform an amplification reaction for a specific time. After the reaction is completed, drop the reaction mixture onto the sample pad of the reagent strip and observe the color development of the T line and C line.

[0073] If a test kit is used, 20 μL of the test solution is added to the sample injection port 21, and the power switch 23 is turned on to heat the heating plate 41. After the test solution is added, the freeze-dried ball will be dissolved immediately, and amplification will be performed at 60-65°C. After waiting for 30 minutes, the amplification is completed, and 200 μL of chromatography buffer is added to the sample injection port 21. The chromatography buffer is mixed with the amplification product, and then flows out from the gap of the sample injection reaction chamber 31 and flows to the sample pad 10 of the reagent strip to be absorbed. The solution completes the entire chromatography process on the reagent strip. If there is a target sequence in the sample, LAMP amplification will produce a sequence with a label, such as a FAM label, a biotin label, and a digoxigenin label, so that the colloidal gold-FAM antibody complex will be re-dissolved and combined with the FAM label sequence to form a three-component complex, which will then be captured by the biotin antibody of the T line, and the T line shows the red color of colloidal gold. The C line captures the unbound colloidal gold-FAM complex to form a quality control line.

[0074] Example 3: Screening of influenza virus primers and demonstration of their effects

[0075] 1. Primers were designed for the conserved sequence segments of influenza viruses A and B, and the top 5 LAMP primers were selected. The primers for influenza virus A are shown in Tables 3-7, and the primers for influenza virus B are shown in Tables 8-12. "Letter-number" is used to represent specific primer sets, for example, A-1 represents influenza virus A primer set 1 (shown in Table 3).

[0076] Table 3 Influenza virus A primer set 1 sequence

[0077] Primer name Primer sequences B3 CCAGTTTCTGTATTTGTCGT F3 CAAAAGCAGGCAAACCAT BIP CCATACAGCCATGGAACAGGACCACTTCCCCTTCTCTGA FIP GCTTATGGCATTTTGCGCTGTTGAATGGATGTCAATCCGA LB ACAGGATACACCATGGACACA LF GATGACAAGGATTTCCAAGG

[0078] Table 4 Influenza virus A primer set 2 sequences

[0079] Primer name Primer sequences B3 ACTTCTTTTTGCTCATGTTGA F3 GATGATGGGCATGTTCAAC BIP GACGATTTTGCCCTCATAGTGAAAACTTGCAGGTCCTGTAG FIP ACCAGTATGTTGTCTTGGTGTATTTATGCTAAGTACGGTTTTAGGAG LB TGCACCAAATCATGAGGGAATAC LF GCCCAAGATTCAGTACCGAGA

[0080] Table 5 Influenza virus A primer set 3 sequences

[0081] Primer name Primer sequences B3 TTCGATCTAAAAACTTCTATGGT F3 GGCCTTCCTTGAAGAATCC BIP AGGCCGCCAGACTTATGATTGTTGGCTAATGCAGTTGC FIP ACCCTTGTTTGTTGAACGACTACCCAGGTATCTTTGAGAACT LB GGACATTAAACAGAAATCAACCGG LF TACGGAACTTTGTTACCTT

[0082] Table 6 Influenza virus A primer set 4 sequences

[0083] Primer name Primer sequences B3 TCCTGATTCATTGGCTGT F3 CCCAGGTATCTTTGAGAACT BIP TTGGACATAAACAGAAATCAACCGCATTCGATCTAAAAACTTCTATGGT FIP GCGGCCTTGGGTTAGTTTGTCATGCCTTGAAACAATGGAAG LB GCAGCAACTGCATTAGC LF ACCCTTGTTTGTTGAACGA

[0084] Table 7 Influenza virus A primer set 5 sequences

[0085]

[0086]

[0087] Table 8 Influenza virus B primer set 1 sequence

[0088] Primer name Primer sequences B3 TTTTGGACGTCTTCTCCTT F3 TGTACCTGAATCCTGGAAAT BIP AGAGCAGCGAGATCCTCAGTCATTGTTTTTGCTGTGTTCAT FIP ATGAGCTCTGTGTGAATGTGATGATTCAATGCAAGTAAAACTAGGA LB FAM-AGGAGTGAGACGGGAAATGC LF DIG-GCACAAAGCACAGAGCGT

[0089] Table 9 Influenza virus B primer set 2 sequences

[0090] Primer name Primer sequences B3 CATCCAGATGTAGCAGGTT F3 AGGGGAAGTCAATGTGAC BIP AACTGTTTTAACTGCACAGATCTGG-TTGAGACTTTTGCGGAGG FIP CTGGTCTGTGTTCCTTTGAGATTGATACCACTAACAACAACACCT LB GTGGCCCTAGGCAGACCAAAATG LF TGCAAAATGAGATTTGGT

[0091] Table 10 Influenza virus B primer set 3 sequences

[0092] Primer Name Primer Sequence B3 TTTGGGAAGCCACCAATC F3 CAAGACAGCAATAAATCCAGTA BIP GACTCTATGGAGACTCAAATCCTCATGAGAAACATAATGTGTGGTTAC FIP AGAGTGGAACCCCCAAACAGAGTAGAAGTACCATACATTTGTTCA LB AAAGTTCACCTCATCTGCCAATGG LF TAATTTGGTCTTCCCCTTC

[0093] Table 11 Influenza virus B primer set 4 sequences

[0094] Primer Name Primer Sequence B3 GCTCTCCTGTGTAGTAAGG F3 AGCGGCAGAATTGTTGTT BIP AGGAGCAAGGTAATAAAAGGGTCCCCGTACTTTTCGTGGAGG FIP TGAGGCAATAAAATGCCTCTTTGATGATTACATGGTACAAAAACCTGG LB TGCCTTTAATTGGTGAAGCAGA LF AACAATTGTTCCTGTTTTT

[0095] Table 12 Influenza virus B primer set 5 sequences

[0096]

[0097]

[0098] The above 10 sets of primers were prepared respectively, and amplification detection was performed using RNA templates of influenza virus A and influenza virus B. The amplification system was: 5 μL of 4×Buffer, 1 μL of enzyme mix, 2 μL of primer mix, 3 μL of template were added to each test, and deionized water was added to 20 μL.

[0099] The primer mix is: 16 μM FIP / BIP, 2 μM F3 / B3, 4 μM LF / LB. FIP / BIP means that FIP ​​and BIP are added in equal molar amounts. Other similar expressions have the same meaning and will not be repeated hereafter.

[0100] Buffer is: 200mM Tris-HCl (pH=8.8), 200mM KCl, 80mM (NH)4SO4, 25mM MgSO4, 0.4% TritonX-100, 0.1% BSA, 50mM dNTP, 4μM SYTO TM 9.

[0101] The enzyme mix is: 40U Bst enzyme, 30U reverse transcriptase, 1U UDG enzyme.

[0102] The reaction process was: 25°C for 2 mins, 60°C for 60 mins, and 85°C for 5 mins.

[0103] The results of the influenza virus A reaction are as follows Figure 5 shown. Figure 5From top to bottom, they are: Group 1, 2, 3, 4, 5 (two lines in each group). Among them, primer groups 1, 2, and 3 have peaks, while groups 4 and 5 have no peaks. However, primer group 3 has low sensitivity, so primer groups 1 and 2 (A-1 and A-2) are selected to continue the experiment. The reaction results of influenza virus B are as follows Figure 6 shown. Figure 6 From top to bottom, they are: group 1, 1, 3, 5, 5, 3, 2, 4. Among them, primer groups 1, 3, and 5 have peaks, while groups 2 and 4 do not have peaks. Subsequently, primer groups 1, 3, and 5 are selected to continue the experiment (B-1, B-3, and B-5).

[0104] 2. When two sets of primers are used to detect two influenza viruses at the same time, there will be interference between primer sets, different RNA templates and non-corresponding primer sets, resulting in detection failure or reduced sensitivity. The reaction system and reaction process are the same. The influence of different RNA templates on primer sets A-1 and A-2 are tested respectively. The test combinations and results are shown in Table 13. The influence of different RNA templates on primer sets B-1, B-3, and B-5 are tested respectively. The test combinations and results are shown in Table 14. When the RNA templates of influenza viruses A and B exist at the same time, the mass ratio of the two is 1:1, and the total amount is 3μL.

[0105] Table 13 Comparison of the effects of different templates on each primer set of influenza virus A

[0106]

[0107] Table 14 Comparison of the effects of different templates on each primer set of influenza virus B

[0108]

[0109] 3. Mix the primer groups A-1 and B-1 to prepare a primer mix. The primer mix includes: LAMP primer groups for influenza A / B pathogens, with concentrations of 16μM FIP / BIP, 2μM F3 / B3, and 4μM Loop F / Loop B. Prepare an amplification system according to step 1 of this example, and prepare a reagent strip according to the method of Example 2 (A-1 and B-1 are present at the same time). Amplify 4 templates: NTC, influenza virus A template, influenza virus B template, and influenza virus AB mixed template (1:1 mixture). The amplification products of the 4 templates were tested with the kit. Each group was repeated 5 times. The results are as follows: Figure 7 shown.

[0110] The embodiments described above are only descriptions of the preferred modes of the present invention and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations, modifications, and substitutions made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A kit, characterized in that: The reagent kit comprises a middle structure and a lower structure; the middle structure comprises a middle plate (30), one end of the middle plate (30) is provided with a sample loading reaction chamber (31), the sample loading reaction chamber (31) is used to place a reagent that reacts with a sample to be tested; a notch is provided on one side of the sample loading reaction chamber (31), the notch is connected to a reagent strip (33) through a sample channel (32); a detection line and a quality control line that can detect the sample to be tested are provided on the reagent strip (33); the lower structure can provide a required temperature for a reaction performed in the sample loading reaction chamber (31).

2. The kit according to claim 1, characterized in that: The lower structure comprises a heating plate (41), and the heating plate (41) is electrically connected to a power source.

3. The kit according to claim 1, characterized in that: The reagent kit comprises an upper structure, the upper structure comprises an upper cover (20), a sample addition port (21) is arranged on the upper cover (20); the sample addition reaction chamber (31) corresponds to and is in communication with the sample addition port (21) in the upper structure.

4. The kit according to claim 1, characterized in that: The sample channel (32) is arranged to be inclined toward the reagent strip (33).

5. A primer set, characterized in that: The primer set includes primers B3, F3, BIP, FIP, LB, and LF for detecting influenza A virus, and the sequences are shown in SEQ ID NOs: 1 to 6, respectively; the primer set includes primers B3, F3, BIP, FIP, LB, and LF for detecting influenza B virus, and the sequences are shown in SEQ ID NOs: 7 to 12, respectively.

6. Use of the primer set according to claim 5 in detecting influenza virus.

7. The use according to claim 6, characterized in that: When the primer set is used to detect influenza virus, the LAMP solution components used for amplification include: DNA polymerase, reverse transcriptase, RNase inhibitor, buffer and a mixture of the primer set.

8. The use according to claim 7, characterized in that: The LAMP is a freeze-dried ball, which includes a freeze-dried protective agent. The freeze-dried protective agent component includes any one or a combination of bovine serum albumin, trehalose, and PEG20000.

9. The use according to claim 8, characterized in that: The lyoprotectant component includes a protein stabilizer.

10. The use according to claim 9, characterized in that: The protein stabilizer is any one of SCO1 and SCO2 or a combination of the two.

11. A reagent strip, reagent composition, kit or test paper comprising or utilizing the primer set according to claim 5.

12. The kit according to claim 11, characterized in that: The reagent kit comprises a middle structure and a lower structure; the middle structure comprises a middle plate (30), one end of the middle plate (30) is provided with a sample loading reaction chamber (31), the sample loading reaction chamber (31) is used to place a reagent that reacts with a sample to be tested; a notch is provided on one side of the sample loading reaction chamber (31), the notch is connected to a reagent strip (33) through a sample channel (32); a detection line and a quality control line that can detect the sample to be tested are provided on the reagent strip (33); the lower structure can provide a required temperature for a reaction performed in the sample loading reaction chamber (31).

13. The kit according to claim 12, characterized in that: The lower structure comprises a heating plate (41), and the heating plate (41) is electrically connected to a power source.

14. The kit according to claim 12, characterized in that: The reagent kit comprises an upper structure, the upper structure comprises an upper cover (20), a sample addition port (21) is arranged on the upper cover (20); the sample addition reaction chamber (31) corresponds to and is in communication with the sample addition port (21) in the upper structure.

15. The kit according to claim 12, characterized in that: The sample channel (32) is arranged to be inclined toward the reagent strip (33).

Images