Polygene base editing vector, editing method and application

Abstract

The invention provides a polygene base editing carrier, an editing method and application, and belongs to the technical field of gene editing. According to the polygene base editing vector provided by the invention, the mode that the replicon element is connected with U6 and sgRNA in series is utilized, so that the plasmid containing the replicon element can continuously exist in a cell, and other elements on the plasmid can be continuously expressed in the cell, so that the polygene silencing efficiency is improved. The invention also provides a tandem carrier, namely an epi element in the carrier is removed. The two multi-gene editing vectors constructed in the embodiment of the invention have silence editing effects on targeting sites, and the editing efficiency of the vector containing the epi element is higher. According to the invention, a 5-gene silent homozygous cell line is obtained through a drug enrichment screening method, and a material and a method are provided for disease-resistant breeding.

Description

Technical Field

[0001] The present invention belongs to the technical field of gene editing, and specifically relates to a multi-gene base editing vector and an editing method and application. Background Art

[0002] Gene knockout is a gene editing technology that destroys the normal sequence of the target gene and causes the normal function of the gene to be lost. Since the emergence of the CRISPR / Cas9 system, the operation of gene knockout has become simpler and the cost has gradually decreased, which has gradually increased the application of the gene knockout system in the biomedical field. In the field of animal breeding, gene knockout technology also has a large application scenario. Studies have shown that knocking out specific genes can increase the disease resistance of pigs and improve economic benefits. Since excellent traits are usually controlled by multiple genes, the knockout of multiple genes is of great significance for breeding. If you want to edit multiple genes at the same time, the editing efficiency needs to be further improved, especially for homozygous cell lines that want to knock out multiple genes. Therefore, improving the efficiency of multi-gene editing is an important part of breeding and even agricultural development. The current gene knockout efficiency is mainly to use the CRISPR / Cas9 system to cut the target chain, produce double-strand breaks, and then use the cell's own repair system to make the repaired double-strand have base insertions or deletions, resulting in frameshift mutations that cause the gene function to be lost. However, double-strand breaks can have adverse effects on cells, which may activate proto-oncogenes and inhibit tumor suppressor genes. Summary of the invention

[0003] The present invention provides a multi-gene base editing vector and an editing method and application, which utilizes a cytosine base editing system to generate premature termination codons by mutating bases on exons, thereby causing multi-gene silencing, making it impossible for target genes to be expressed normally, while avoiding hazards such as double-strand breaks.

[0004] The present invention provides a multi-gene base editing vector, wherein the vector comprises a tandem replicon element, a U6 promoter, and sgRNA for each target gene;

[0005] Each U6 promoter drives the expression of a sgRNA sequence of a target gene.

[0006] In a specific embodiment of the present invention, the replicon elements include EBNA1 and OriP.

[0007] In a specific embodiment of the present invention, the number of the target genes is not less than 1.

[0008] In a specific embodiment of the present invention, the target genes include genes related to the field of pig breeding and genes related to pig quality.

[0009] In a specific embodiment of the present invention, the backbone vector of the vector includes the following elements: a single base editor, an epi replicon element and multiple U6 tandems or csy4 tandems.

[0010] The present invention provides a tandem vector for multi-gene base editing, comprising removing the replicon element in the above-mentioned vector.

[0011] In a specific embodiment of the present invention, the vector is double-digested with restriction endonucleases NheI and AscI.

[0012] The present invention provides a method for targeted silencing of multiple genes, comprising using the above-mentioned vector or using the above-mentioned tandem vector to transform into target cells, thereby obtaining multi-gene silencing cells.

[0013] The present invention provides a multi-gene silenced cell constructed by the above method.

[0014] The present invention provides a multi-gene silenced homozygous cell line screened from the multi-gene silenced cells.

[0015] Beneficial effect: The present invention provides a vector for multi-gene base editing. By utilizing the replicon element and U6 and sgRNA in series, the plasmid containing the replicon element (epi element) can be continuously present in the cell, and then other elements on the plasmid will be continuously expressed in the cell, thereby improving the efficiency of gene silencing of multiple genes.

[0016] In the embodiment of the present invention, four disease-resistant related genes (CALR, ANPEP, CD163 and ANTXR1) and one pork quality-related gene (MSTN) in the pig breeding field are selected for gene silencing, and the epiBE4-5U6-sg vector is constructed by combining the replicon element and the sgRNA of each gene with a U6 promoter in series. The present invention also provides a tandem vector, that is, the epi element in the above-mentioned vector is removed, and the BE4-5U6-sg vector is constructed in the embodiment. The two multi-gene editing vectors constructed in the embodiment of the present invention have silencing editing on the targeted sites, and the editing efficiency of the epiBE4-5U6-sg vector is higher. The present invention obtains a homozygous cell line with 5 gene silencing by a drug enrichment screening method, which provides materials and methods for disease-resistant breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 The plasmid map of pKLV2-U6gRNA(Bbs1)-PGKpuro-2AZsGreen;

[0018] Figure 2 is the plasmid map of epiBE4-5U6-sg vector;

[0019] Figure 3 is the plasmid map of BE4-5U6-sg vector;

[0020] Figure 4 The figure shows the cell editing efficiency of epiBE4-5U6-sg vector (abbreviated as epiBE4) and BE4-5U6-sg vector (abbreviated as BE4) on the third day (D3) and the sixth day (D6) of enrichment;

[0021] Figure 5 This is a single cell cluster image after 9 days of culture with high concentration serum;

[0022] Figure 6 This is the result of homozygous cloning of 5 genes. DETAILED DESCRIPTION

[0023] The present invention provides a multi-gene base editing vector, wherein the vector comprises a tandem replicon (epi) element, a U6 promoter, and sgRNA for each target gene;

[0024] Each U6 promoter drives the expression of a sgRNA sequence of a target gene.

[0025] In a specific embodiment of the present invention, the epi element comprises EBNA1 and OriP, wherein the sequence of EBNA1 is shown as SEQ ID No.1, and the sequence of OriP is shown as SEQ ID No.2.

[0026] In a specific embodiment of the present invention, the nucleotide sequence of the U6 promoter may be as shown in SEQ ID No. 3. In the present invention, each U6 promoter promotes the expression of a target gene sgRNA.

[0027] The number of target genes described in the present invention is not less than 1. In a specific embodiment, sgRNAs of 5 target genes are designed at the same time. For example, in the embodiment, four disease resistance-related genes (CALR, ANPEP, CD163 and ANTXR1) and one pork quality-related gene (MSTN) in the pig breeding field are selected for gene silencing, and the sgRNA sequences shown in Table 1 are designed.

[0028] Table 1 sgRNA sequence list

[0029] gene sequence SEQ ID No. CALR sg1F CACCGATCCCCGGAGTACCCTTATG 4 CALR sg1R AAACCATAAGGGTACTCCGGGGATC 5 MSTN sg1F CACCGCAGCGAGCAAAAGGAAAATG 6 MSTN sg1R AAACCATTTTCCTTTTGCTCGCTGC 7 MSTN sg3F CACCGAAACAACCTGAATCCAACTT 8 MSTN sg3R AAACAAGTTGGATTCAGGTTGTTTC 9 MSTN sg4F CACCGGTGCACCAAGCAAACCCCAG 10 MSTN sg4R AAACCTGGGGTTTGCTTGGTGCACC 11 ANPEP sg1F CACCGCCCCCAGTTCTCCATGGCAC 12 ANPEP sg1R AAACGTGCCATGGAGAACTGGGGGC 13 ANPEP sg2F CACCGGGATCGATGGACCCTGCAGA 14 ANPEP sg2R AAACTCTGCAGGGTCCATCGATCCC 15 ANPEP sg3F CACCGGCCCCCAGGCAAAGTCCCAC 16 ANPEP sg3R AAACGTGGGACTTTGCCTGGGGGCC 17 ANTXR1 sg1F CACCGGAACTCCAGAAGGTTCTGCC 18 ANTXR1 sg1R AAACGGCAGAACCTTCTGGAGTTCC 19 ANTXR1 sg2F CACCGTCCTTTCAAGTAGTGGTGAG 20 ANTXR1 sg2R AAACCTCACCACTACTTGAAAGGAC 21 ANTXR1 sg3F CACCGCTTCCGACACGCCCGCAATG 22 ANTXR1 sg3R AAACCATTGCGGGCGTGTCGGAAGC 23 ANTXR1 sg4F CCGACCAGAGGAGAGCCAGGGCC 24 ANTXR1 sg4R AAACGGCCCTGGCTCTCCTCTGGTC 25 ANTXR1 sg5F CACCGGAACCACCAGAGGAGAGCCA 26 ANTXR1 sg5R AAACTGGCTCTCCTCTGGTGGTTCC 27 CD163 sg1F CACCGTGGTCGAGTTAACGCCAGTG 28 CD163 sg1R AAACCACTGGCGTTAACTCGACCAC 29 CD163 sg2F CACCGGTCCCAGTGAGAGTTGCAGA 30 CD163 sg2R AAACTCTGCAACTCTCACTGGGACC 31 CD163 sg3F CACCGGTGTGCCGACAGCTGGGCTG 32 CD163sg3R AAACCAGCCCAGCTGTCGGCACACC 33 CD163sg4F CACCGAAGTACAACATGGAGACACG 34 CD163sg4R AAACCGTGTCTCCATGTTGTACTTC 35

[0030] The backbone vector of the vector described in the present invention needs to include the following core elements: a single base editor, an epi replicon element and multiple U6 tandems (or csy4 tandems), such as the epiBE4-U6 selected in one embodiment.

[0031] When constructing the vector of the present invention, the sequence obtained after annealing the above-mentioned sgRNA is connected to the U6 promoter as in the example to obtain a sequence in which the sg and U6 of one gene are connected, i.e., U6-sg, and the sg and U6 sequences of five genes are connected in series, i.e., U6-sg1-U6-sg2-U6-sg3-U6-sg4-U6-sg5 and are connected in series to obtain the sequence shown in SEQ ID No.36.

[0032] The epiBE4-U6 universal vector was selected as the sgRNA expression vector, and the vector backbone was cut with PaqCI. The product after enzyme cutting was recovered to obtain the enzyme cutting product; the sequence shown in SEQ ID No.36 was connected to the enzyme cutting product to obtain the constructed epiBE4-5U6-sg vector; wherein, the epiBE4-U6 sequence is shown in SEQ ID No.37.

[0033] The present invention provides a tandem vector for multi-gene base editing, comprising removing the replicon element in the above-mentioned vector.

[0034] In a specific embodiment of the present invention, the epiBE4-5U6-sg vector is double-digested with restriction endonucleases NheI and AscI; then, a linear connection fragment of NheI and AscI is designed, and the above fragments are connected to successfully construct the BE4-5U6-sg vector.

[0035] The present invention provides a method for targeted silencing of multiple genes, comprising using the above-mentioned vector or using the above-mentioned tandem vector to transform into target cells, thereby obtaining multi-gene silencing cells.

[0036] The present invention has no particular limitation on the transformation method, and the transformation can be performed using conventional methods in the art, such as electroporation.

[0037] The present invention provides a multi-gene silenced cell constructed by the above method.

[0038] In the embodiments of the present invention, the vector or tandem vector constructed as above was used to electroporate and resuscitate Changbai PFF cells, and the target fragment of the edited gene was amplified by PCR. The results showed that both multi-gene editing vectors had silencing editing on the targeted sites.

[0039] The present invention provides a multi-gene silenced homozygous cell line screened from the multi-gene silenced cells.

[0040] The screening described in the present invention includes culturing the above-mentioned multi-gene silenced cells with a culture medium containing high-concentration serum (20%), changing the culture medium every 2 days, and waiting until 9 days later when single cells form a group. The cell clone group is picked up with a cloning ring and transferred to a 48-well plate for culture. After the cells are fully grown, 1 / 2 of the cells are taken for genotype identification, and the remaining cells are transferred to a 24-well plate for culture. The single clones identified as homozygous edited are frozen with freezing fluid and stored in a liquid nitrogen tank, which is the multi-gene silenced homozygous cell line described in the present invention.

[0041] In order to further illustrate the present invention, a multi-gene base editing vector, a construction method and an application provided by the present invention are described in detail below in combination with the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0042] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0043] Example 1

[0044] Design of primers for amplification of five gene targeting sites and construction of sgRNA expression vectors for five gene sites

[0045] 1. Verification of genomic SNPs

[0046] One pair of primers was designed targeting the intronic GGGG mutation of the CALR gene (CALR calreticulin [Sus scrofa (pig)] Gene ID: 100381266), three pairs of primers were designed targeting the 6th, 11th, and 18th exons of the ANPEP gene (ANPEP alanylaminopeptidase, membrane [Sus scrofa (pig)] Gene ID: 397520), three pairs of primers were designed targeting the 1st, 2nd, and 3rd exons of the MSTN gene (MSTN myostatin [Sus scrofa (pig)] Gene ID: 399534,), three pairs of primers were designed targeting the 4th, 10th, and 13th exons of the ANTXR1 gene (ANTXR1 ANTXR cell adhesion molecule 1 [Sus scrofa (pig)] Gene ID: 100513853), and three pairs of primers were designed targeting the 4th, 10th, and 13th exons of the CD163 gene (CD163 Four pairs of primers were designed for exons 5, 7, 8, and 12 of CD163 molecule [Susscrofa (pig)] Gene ID: 397031). The designed upstream primers and downstream primers were used to perform PCR amplification on the large white PFF genome (large white sows with gestation of 35 days purchased from Yangxiang Company, piglet fibroblasts were separated, and fibroblast genomes were extracted) to obtain PCR products. The primer sequences are shown in Table 2.

[0047] Table 2 PCR amplification primer sequence list

[0048]

[0049]

[0050] After being sent to the company for sequencing, the sequencing results were compared with the NCBI sequence and showed normal results without SNP.

[0051] 2. Construction of expression vector

[0052] 1. To construct an efficient vector, the crisprbets website was used to design sgRNAs with high efficiency and low off-target rate for specific genes. One gRNA (CALR-sg1) was designed for the intronic GGGG mutation of the CALR gene, three gRNAs (ANPEP-sg1, ANPEP-sg2, ANPEP-sg3) were designed for exons 6, 11, and 18 of the ANPEP gene, four gRNAs (MSTN-sg1, MSTN-sg2, MSTN-sg3, MSTN-sg4) were designed for exons 1, 2, and 3 of the MSTN gene, and one gRNA (MSTN-sg1, MSTN-sg2, MSTN-sg3, MSTN-sg4) was designed for exons 1, 2, and 3 of the MSTN gene. Five gRNAs (ANTXR1-sg1, ANTXR1-sg2, ANTXR1-sg3, ANTXR1-sg4, ANTXR1-sg5) were designed for exons 4, 10, and 13 of the CD163 gene, and four gRNAs (CD163-sg1, CD163-sg2, CD163-sg3, CD163-sg4) were designed for exons 5, 7, 8, and 12 of the CD163 gene, and the annealing primers of these gRNAs were designed and synthesized accordingly, as shown in Table 1.

[0053] 2. Select Figure 1 The pKLV2-U6gRNA(Bbs1)-PGKpuro-2AZsGreen shown is an sgRNA expression vector. The vector backbone is cut with Bbs1 to prepare a 50 μL system: 3 μg of pKLV2-U6gRNA(Bbs1)-PGKpuro-2AZsGreen plasmid, 5 μL of 10×rCutSmartBuffer, 1 μL of Bbs1-HF and the remainder of H2O; after 3 hours of enzyme digestion, the product is recovered to obtain the enzyme digestion product.

[0054] 3. Take 5 μL of each of the sgRNA oligonucleotide sequences with complementary sticky ends synthesized in Table 1 into a PCR tube, shake and centrifuge to mix, and then place it in a PCR instrument for annealing. The annealing program is: 95°C for 10 min, 65°C for 30 min to obtain the annealing product.

[0055] 4. Use DNA ligase to connect the annealing product to the restriction vector and prepare a 10 μL system: 50 ng of pKLV2-U6gRNA (Bbs1)-PGKpuro-2AZsGreen restriction product, 1 μL of annealing product, 5 μL of DNA ligation mix and the balance of H2O.

[0056] After mixing, place in a constant temperature metal bath at 25℃ for 10min. After the connection is completed, take it out and add it to DH5α competent cells. After ice bath for 5min, 42℃ water bath for 45s, ice bath for 2min, spread it on solid culture medium for transformation. After inverting overnight, pick monoclonal colonies of appropriate size into 1.5ml centrifuge tubes and add 700μLLB liquid culture medium. Culture on a shaker at 37℃ and 220r / min for 8h, send it to the company for sequencing to confirm that the vector construction is successful, then expand the culture and extract the plasmid.

[0057] Example 2

[0058] Cell experiments verify the editing efficiency of different sgRNAs for each gene

[0059] Use PK15 BE4 cell line to plate 10cm dish, and electroporate the expression sg vector plasmid when the density is 90% to 100%. Transfect 10μg plasmid per 1 / 310cm dish, wait for 72h to separate the GFP green fluorescence positive cells, extract the cell genome and use the previous genome amplification primers for PCR amplification. Send the amplified product to the company for sequencing, and use the http: / / baseeditr.com / online website to analyze the editing efficiency of sgRNA. Finally, select the sgRNA with the best activity at each gene site for subsequent multi-gene editing experiments.

[0060] The sgRNAs finally selected are CALR sg 1, MSTN sg 4, ANPEP sg 1, ANTXR1 sg 2, and CD163 sg 4 in Table 1.

[0061] Example 3

[0062] Construction of four tandem five-gene KO vectors

[0063] 1. Construction of epiBE4-5U6-sg vector

[0064] The U6 promoter plus sgRNA for silencing 5 genes was combined with the epi element to construct the epiBE4-5U6-sg tandem vector. The sgRNAs of the 5 genes were connected in series by connecting the U6 promoter to the sgRNA of one gene, that is, each U6 promoter activated one sgRNA, and finally the sequence shown in SEQ ID No.36 was obtained and cloned into the epiBE4-U6 universal vector, and finally synthesized as shown in Figure 2 The epiBE4-5U6-sg vector is shown.

[0065] 2. Construction of BE4-5U6-sg tandem vector

[0066] (1) Double digestion of the vector: Based on the epiBE4-5U6-sg vector, the EBNA1 and oriP elements were removed by enzyme digestion, and double digestion was performed using restriction endonucleases NheI and AscI.

[0067] Prepare 50 μL restriction enzyme digestion system: 1 μg plasmid, 5 μL 10× rCutSmartBuffer, 1 μL NheI-HF, 1 μL AscI-HF and the balance H2O;

[0068] NheI F (SEQ ID No. 64): CTAGCAATTACTCGCAGCCCGGAA;

[0069] AscI R (SEQ ID No. 65): CGCGTTCCGGGCTGCGAGTAATTG.

[0070] (2) Designing a connecting fragment for connecting the above double enzyme digestion backbone

[0071] Take 5 μL of each of the two linear fragments, oscillate and centrifuge to mix, and then place in a PCR instrument for annealing. The annealing program is: 95°C for 10 min, 65°C for 30 min. Add 90 μL of sterile water to the annealed product for dilution.

[0072] (3) Connection

[0073] Use DNA ligase DNALigationKit to connect the annealed product and the linearized double-enzyme digested vector. The 10μL ligation system includes 100ng of linearized double-enzyme digested backbone, 1μL of annealed product, 5μL of DNAligation mix, and the remaining amount of H2O. Connect at 25℃ for 10min, then transform, and sequence to identify positive clones. Remove endotoxin and extract plasmid for use. Figure 3 BE4-5U6-sg vector as shown.

[0074] Example 4

[0075] Cell experiments prove that multi-gene editing vectors can achieve targeted silencing of five genes

[0076] 1. Electroporation of replicon vectors and conventional vectors into Changbai fibroblasts for cell drug enrichment

[0077] Resuscitated Changbai PFF cells were placed in a 10 cm dish and electroporated when the cell density reached 100%. When the cell density reached 100% for electroporation, 1 / 3 of the cells in the 10 cm dish were electroporated with 10 μg of epiBE4-5U6-sg plasmid at 520 V. 1 / 3 of the cells in the 10 cm dish were electroporated with 10 μg of BE4-5U6-sg plasmid at 520 V. 1 / 3 of the cells in the 10 cm dish were electroporated without plasmid at 520 V as a negative control. After electroporation, the cells were transferred to an antibiotic-free culture medium. The next day, the cells were killed and enriched with puro (puro concentration: 1 μg / ml) after the cells were normal in morphology. After 3 days, 1 / 3 of the cell density was taken to detect the editing efficiency, and then puro was used to kill and enrich (puro concentration: 2 μg / ml). After 3 days of enrichment, 1 / 3 of the cell density was taken to detect the editing efficiency.

[0078] 2. Verify the efficiency of D3 and D6 multi-gene silencing vector cell pools

[0079] PCR amplifies the target fragment of the edited gene, and sends the amplified product to the company for testing. The peak graph of the test results is used to analyze the editing efficiency of each gene site using the EditR online website. The results are as follows Figure 4 As shown, both multi-gene editing vectors have silent editing of the targeted sites, among which the replicon vector has the highest editing efficiency in cells enriched in D6.

[0080] Example 5

[0081] Cell experiments proved that epiBE4-5U6-sg vector successfully screened 5 gene silencing homozygous clones

[0082] The Changbai PFF cells enriched for 6 days and electroporated with epiBE4-5U6-sg in Example 4 were diluted by gradient method to obtain a 10 cm dish containing 100 cells, and cultured with a medium with high serum concentration (20%, normal serum concentration is 10%). The medium was changed every 2 days. After 9 days, single cells formed a group, such as Figure 5 , use a cloning ring to pick up cell clones and transfer them to 48-well plates for culture. When the cells are full, take out 1 / 2 of the cells to identify the genotype, and transfer the remaining cells to 24-well plates for culture, and identify them as homozygous edited single clones, such as Figure 6 , cryopreserved with freezing solution and stored in liquid nitrogen tank.

[0083] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A vector for multi-gene base editing, characterized in that: The vector includes a tandem replicon element, a U6 promoter, and sgRNA for each target gene; Each U6 promoter drives the expression of a sgRNA sequence of a target gene.

2. The carrier according to claim 1, characterized in that The replicon elements include EBNA1 and OriP.

3. The carrier according to claim 1, characterized in that The number of the target genes is not less than 1.

4. The carrier according to claim 1, characterized in that The target genes include genes related to the pig breeding field and genes related to pig quality.

5. The carrier according to claim 1, characterized in that The backbone vector of the vector includes the following elements: a single base editor, an epi replicon element, and multiple U6 tandems or csy4 tandems.

6. A multi-gene base editing tandem vector, characterized in that: The method comprises removing the replicon element in the vector according to any one of claims 1 to 5.

7. The tandem carrier according to claim 6, characterized in that: The method comprises double digesting the vector with restriction endonucleases NheI and AscI.

8. A method for targeted silencing of multiple genes, characterized in that: The method comprises using the vector described in any one of claims 1 to 5 or the tandem vector described in claim 6 or 7 to transform into target cells to obtain multi-gene silenced cells.

9. The multi-gene silenced cell constructed by the method of claim 8.

10. A multi-gene silenced homozygous cell line screened from the multi-gene silenced cells according to claim 8.

Images