A reagent for detecting SNP sites in the genome of largemouth bass and its application.

By using GWAS screening and designing detection primers, SNP sites in the genome of largemouth bass were detected, solving the problem of detecting resistance to frog iridovirus in largemouth bass, realizing efficient disease-resistant breeding, and significantly improving the disease resistance of largemouth bass.

CN119162330BActive Publication Date: 2026-05-26PEARL RIVER FISHERY RES INST CHINESE ACAD OF FISHERY SCI
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
PEARL RIVER FISHERY RES INST CHINESE ACAD OF FISHERY SCI
Filing Date
2024-09-12
Publication Date
2026-05-26

AI Technical Summary

Technical Problem

Currently, there is a lack of effective methods to detect and utilize SNP sites in the largemouth bass genome that are associated with resistance to frog iridovirus, resulting in a lack of effective treatment options for the largemouth bass aquaculture industry when facing this viral disease, causing serious economic losses.

Method used

Genome-wide association analysis (GWAS) was used to screen for SNP sites in the largemouth bass genome that are associated with frog iridovirus resistance. Specific detection primers were designed to detect the genotypes of SNP sites 1, 2, and 3, and corresponding kits and breeding methods were developed.

Benefits of technology

Effective identification of resistance of largemouth bass to frog iridovirus provides basic information for disease-resistant breeding, significantly improves the resistance of largemouth bass to frog iridovirus, and reduces the mortality rate after viral infection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119162330B_ABST
    Figure CN119162330B_ABST
Patent Text Reader

Abstract

This invention relates to a reagent for detecting SNP sites in the genome of largemouth bass and its application, belonging to the field of fish molecular breeding technology. The invention provides a reagent for detecting SNP sites in the genome of largemouth bass, specifically for detecting the genotypes of SNP sites 1, 2, and 3. SNP site 1 is located at g 38928188 on chromosome 3 of the largemouth bass genome, SNP site 2 is located at g 38930790 on chromosome 3 of the largemouth bass genome, and SNP site 3 is located at g 38943374 on chromosome 3 of the largemouth bass genome. The GenBank accession number for the largemouth bass genome is ASM1485139v1. By detecting the genotypes of SNP1, SNP2, and SNP3, the resistance of the tested largemouth bass to frog iridovirus can be effectively determined.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of fish molecular breeding technology, and in particular to a reagent for detecting SNP sites in the genome of largemouth bass and its application. Background Technology

[0002] Largemouth bass (Micropterus salmoides), also known as California bass, is an important aquaculture species. Infection with Largemouth bass ranavirus (LMBV) causes severe viral diseases with a mortality rate reaching 100%. Currently, there is no effective treatment, resulting in significant economic losses and becoming a bottleneck restricting the healthy development of largemouth bass aquaculture. Research into the location of disease-resistant loci and the breeding of highly resistant populations are crucial strategies for the sustainable development of largemouth bass aquaculture.

[0003] Genome-wide association study (GWAS) is a method of detecting genetic variations (markers) across the entire genome in multiple individuals to obtain genotypes. Then, population-level statistical analysis is performed on the genotypes and observable traits (phenotypes). Based on statistical measures or p-values, the genetic variations (markers) most likely to influence the trait are screened. Finally, the linkage disequilibrium between these markers and functional genes is used to identify genes associated with trait variations. GWAS offers high association accuracy and a short study cycle, making it an important tool for functional gene discovery. With the development of science and technology, obtaining high-density genetic markers through high-throughput sequencing has become the mainstream approach in marker development. Based on high-throughput genotyping techniques combined with GWAS methods, a large number of genetic variations associated with complex traits have been discovered and identified, greatly promoting the development of genetics.

[0004] Researchers have identified SNP sites associated with resistance to rhabdovirus in largemouth bass, but studies on SNP sites associated with resistance to frog iridovirus in largemouth bass are lacking. Summary of the Invention

[0005] The purpose of this invention is to overcome the shortcomings of the prior art and provide a reagent for specifically detecting SNP sites in the genome of largemouth bass and its application.

[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0007] In a first aspect, the present invention provides a reagent for detecting SNP sites in the genome of largemouth bass, the reagent being used to detect the genotypes of SNP site 1, SNP site 2 and SNP site 3;

[0008] The SNP locus 1 is located at g 38928188 on chromosome 3 of the largemouth bass genome.

[0009] The SNP site 2 is located at g 38930790 on chromosome 3 of the largemouth bass genome.

[0010] The SNP site 3 is located at g 38943374 on chromosome 3 of the largemouth bass genome.

[0011] The GenBank accession number for the largemouth bass genome is ASM1485139v1.

[0012] This invention identifies single nucleotide polymorphism (SNP) sites associated with the largemouth bass's resistance to frog iridovirus. By detecting the genotype of the SNP sites, the largemouth bass's resistance to frog iridovirus can be obtained.

[0013] In a specific embodiment of the present invention, the reagent includes a primer set;

[0014] The nucleotide sequences of the primer set for detecting SNP site 1 are shown in SEQ ID NO: 1-3;

[0015] The nucleotide sequences of the primer set for detecting SNP site 2 are shown in SEQ ID NO: 4-6;

[0016] The nucleotide sequences of the primer set for detecting SNP site 3 are shown in SEQ ID NO: 7-9.

[0017] Secondly, the present invention provides the application of the reagent in identifying the characteristics of largemouth bass resistant to frog iridovirus.

[0018] Thirdly, the present invention provides the application of the reagent in the preparation of a kit for identifying the characteristics of largemouth bass against frog iridovirus.

[0019] Fourthly, the present invention provides the application of the reagent in the breeding of largemouth bass.

[0020] Fifthly, the present invention provides a method for identifying the anti-frog iridovirus trait of largemouth bass, by detecting the genotypes of SNP loci 1, SNP loci 2 and SNP loci 3 of the largemouth bass to be tested.

[0021] The SNP locus 1 is located at g 38928188 on chromosome 3 of the largemouth bass genome.

[0022] The SNP site 2 is located at g 38930790 on chromosome 3 of the largemouth bass genome.

[0023] The SNP site 3 is located at g 38943374 on chromosome 3 of the largemouth bass genome.

[0024] The GenBank accession number for the largemouth bass genome is: ASM1485139v1;

[0025] The samples with the SNP site 1 genotype GG showed significantly higher resistance to frog iridovirus than the samples with the GT and TT genotypes.

[0026] The samples with the CC genotype at SNP site 2 showed significantly higher resistance to frog iridovirus than the samples with the GG and GC genotypes.

[0027] The samples with the CC genotype at SNP site 3 showed significantly higher resistance to frog iridovirus than the samples with the AA and AC genotypes.

[0028] In a specific embodiment of the present invention, the reagent is used for detection.

[0029] Furthermore, the method is PCR amplification.

[0030] In a sixth aspect, the present invention provides a kit for identifying the characteristics of largemouth bass resistant to frog iridovirus, the kit containing the aforementioned reagent.

[0031] In a specific embodiment of the present invention, the kit also contains Flu-Arms 2×PCR Mix and water.

[0032] Using the genomic DNA of the largemouth bass to be tested as a DNA template, and the primers shown in SEQ ID NO: 1-3, SEQ ID NO: 4-6 and SEQ ID NO: 7-9 as nucleotide sequences, PCR amplification was performed to obtain amplification products. The genotypes of the largemouth bass SNP sites 1-3 to be tested in the amplification products were determined, and the anti-frog iridovirus phenotype of the largemouth bass to be tested was determined.

[0033] The PCR amplification program was as follows: 95℃ for 10 min; 95℃ for 15 s, gradient annealing at 61-55℃ for 60 s (-0.6℃ / cycle, decreasing by 0.6℃ per cycle), 10 cycles; 95℃ for 15 s, 55℃ for 60 s, for a total of 30 cycles; 30℃ for 30 s.

[0034] The PCR amplification system (total volume 10 μL) consisted of: 5 ng to 250 ng DNA template, 5.0 μL Flu-Arms 2×PCR Mix, 0.05 μL to 0.25 μL upstream genotyping primer F1 (10 μM), 0.05 μL to 0.25 μL downstream genotyping primer F2 (10 μM), 0.1 μL to 0.5 μL downstream universal primer R (10 μM), and ddH2O added to a final volume of 10 μL.

[0035] The preferred PCR amplification system (total volume 10 μL) is as follows: 5 ng to 50 ng DNA template, 5.0 μL Flu-Arms 2×PCR Mix, 0.1 μL upstream genotyping primer F1 (10 μM), 0.1 μL downstream genotyping primer F2 (10 μM), 0.3 μL downstream universal primer R (10 μM), and ddH2O added to a final volume of 10 μL.

[0036] The amplification products of primers with nucleotide sequences as shown in SEQ ID NO: 1 to 3 (named amplification product 1) are shown in SEQ ID NO: 13; the amplification products of primers with nucleotide sequences as shown in SEQ ID NO: 4 to 6 (named amplification product 2) are shown in SEQ ID NO: 14; and the amplification products of primers with nucleotide sequences as shown in SEQ ID NO: 7 to 9 (named amplification product 3) are shown in SEQ ID NO: 15.

[0037] When SNP site 1 is located at the 25th bp of the 5' end of amplification product 1 (i.e., at g 38928188 on chromosome 3 of the reference largemouth bass genome in GenBank accession number: ASM1485139v1), largemouth bass samples with the GG genotype show significantly higher resistance to frog iridovirus than those with the GT and TT genotypes, and have a longer survival time after infection with frog iridovirus.

[0038] When SNP site 2 is located at 25 bp at the 5' end of amplified product 2 (i.e., at g 38930790 on chromosome 3 of reference largemouth bass in GenBank accession number: ASM1485139v1), largemouth bass samples with the CC genotype have significantly higher resistance to frog iridovirus than those with the GG and GC genotypes, and have a longer survival time after infection with frog iridovirus.

[0039] When SNP site 3 is located at the 25th bp of the 5' end of amplified product 3 (i.e., at g 38943374 on chromosome 3 of the reference largemouth bass genome in GenBank accession number: ASM1485139v1), largemouth bass samples with the CC genotype show significantly higher resistance to frog iridovirus than those with the AA and AC genotypes, and have a longer survival time after infection with frog iridovirus.

[0040] In a seventh aspect, the present invention provides a method for breeding largemouth bass, which involves detecting the genotypes of SNP loci 1, SNP loci 2 and SNP loci 3 of largemouth bass, obtaining largemouth bass with the genotype of SNP loci 1 being GG, the genotype of SNP loci 2 being CC and the genotype of SNP loci 3 being CC, and using the parent as a parent to breed largemouth bass resistant to frog iridovirus;

[0041] The SNP locus 1 is located at g 38928188 on chromosome 3 of the largemouth bass genome.

[0042] The SNP site 2 is located at g 38930790 on chromosome 3 of the largemouth bass genome.

[0043] The SNP site 3 is located at g 38943374 on chromosome 3 of the largemouth bass genome.

[0044] The GenBank accession number for the largemouth bass genome is ASM1485139v1.

[0045] Furthermore, the genotypes of SNP sites 1, 2, and 3 in largemouth bass were detected using the reagent or kit described above.

[0046] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0047] This invention identified three single nucleotide polymorphism (SNP) sites associated with resistance to frog iridovirus in largemouth bass using GWAS screening. These SNP sites are g 38928188G>T, g 38930790C>G, and g 38943374C>A on chromosome 3 of largemouth bass. Largemouth bass with the GG genotype of SNP1, the CC genotype of SNP2, and the CC genotype of SNP3 exhibited significantly higher resistance to frog iridovirus than individuals with other genotypes. By detecting the genotypes at SNP1, SNP2, and SNP3, the resistance of the tested largemouth bass to frog iridovirus was effectively determined, providing a foundation for further research on the genetic structure of largemouth bass frog iridovirus resistance and offering valuable information for disease-resistant breeding. Attached Figure Description

[0048] Figure 1 Symptoms of largemouth bass infected with largemouth bass frog iridovirus (LMBV). A represents a healthy largemouth bass; B represents a largemouth bass infected with LMBV and showing symptoms.

[0049] Figure 2 Distribution density of SNPs on the chromosome of largemouth bass after quality control filtration.

[0050] Figure 3 Genome-wide association analysis of LMBV resistance in largemouth bass. A is the Manhattan plot; B is the quantile-quantile (QQ) plot.

[0051] Figure 4 The image shows fluorescence signal readings for different genotypes at various loci of largemouth bass. A represents g 38928188G>T; B represents g 38930790C>G; C represents g 38943374C>A; and D represents g 38943495G>A.

[0052] Figure 5 The survival time of different genotypes at various loci of largemouth bass is shown in the graph. Among them, A is g 38928188G>T; B is g 38930790C>G; C is g 38943374C>A; and D is g 38943495G>A.

[0053] Figure 6 The disease incidence and survival rate of largemouth bass in the selected and non-selected groups after being challenged with largemouth bass frog iridovirus are shown. A represents the non-selected group; B represents the selected group; and C represents the survival rate. Detailed Implementation

[0054] To better illustrate the purpose, technical solution, and advantages of this invention, the invention will be further described below with reference to specific embodiments. Unless otherwise specified, other materials and reagents used in the embodiments are commercially available.

[0055] Example 1: Analysis of SNP sites in largemouth bass resistant to frog iridovirus disease

[0056] I. Experimental Methods

[0057] 1. Phenotypic determination of largemouth bass against frog iridovirus

[0058] 1000 healthy "Youlu No. 3" (approximately 5.5 cm in length) largemouth bass were artificially infected with largemouth bass iridovirus (LMBV). The healthy largemouth bass were intraperitoneally injected with LMBV (10... 4 TCID 50 ( / tail), water temperature controlled at 28℃, observe once each morning, noon and evening, record the time of onset and death of largemouth bass, and collect the tail fins of dying and sick largemouth bass in time and preserve them in anhydrous ethanol.

[0059] 2. Resequencing of the genome of the largemouth bass

[0060] Largemouth bass tail fin samples were selected from the top 50 individuals who died after LMBV infection (susceptible group) and 50 surviving individuals 14 days after LMBV infection (resistant group). Genomic DNA was extracted, and its concentration and purity were tested. The extracted genomic DNA with an OD260 / OD280 ratio between 1.8 and 2.0 and a DNA concentration greater than 100 ng / μL was suitable for whole-genome resequencing. The genomic DNA was randomly fragmented into short DNA fragments using enzymes and then subjected to blunt end repair. dA tails were then ligated to both ends of the DNA fragments, and sequencing adapters were added. The adapter-added DNA fragments were purified using AMPure XP magnetic beads, and fragments in the 300–400 bp range were selected for PCR amplification to obtain the sequencing library. After purification and library inspection, the sequencing library was sequenced using a HiSeq X10 PE150 whole-genome sequencer at a sequencing depth of 10×. After preliminary quality control, each sample yielded an average of 10,556,429,233 bp of high-quality data, with high-quality bases (Q value > 30) accounting for 92.48% and an average GC content of 42.45%, resulting in raw reads.

[0061] The largemouth bass genome (ASM1485139v1) published by NCBI was selected as the reference genome. After quality control of the raw reads obtained from sequencing each sample, the clean reads of each sample were compared with the reference genome to obtain the variant sites. The obtained variant sites were filtered using Plink2 software to remove non-secondary alleles, sites with a second allele frequency of less than 0.05, sites with a deletion rate greater than 0.5, and sites with a heterozygosity greater than 0.8, resulting in a total of 2,902,562 SNPs. Further SNP quality control filtering yielded 2,064,240 high-quality SNPs.

[0062] 3. Genome-wide association analysis and screening of disease-resistant SNP sites

[0063] Genome-wide association analysis (GWIA) involves detecting genetic variations (markers) polymorphism across the entire genome in multiple individuals to obtain genotypes. Then, statistical analysis is performed at the population level on the genotypes and observable traits, i.e., phenotypes. Based on statistics or significance p-values, the genetic variations (markers) most likely to affect the trait are screened out. Finally, the linkage disequilibrium between the markers and functional genes is used to discover genes associated with trait variations.

[0064] The generalized linear model GLM(Q) was calculated using Gemma software (v0.98.1). Association analysis was performed on the target trait in the population to locate candidate genes associated with the target trait. The GWAS analysis model is expressed as: y=Xα+Qβ+Kμ+e.

[0065] Where y is the phenotypic vector, i.e. the survival time of largemouth bass after infection with frog iridovirus, X is the genotype matrix, α is the genotype effect vector, Q is the fixed effect matrix (which can be information such as population structure), β is the fixed effect vector, K is the random effect matrix, mainly referring to the kinship matrix, μ is the random effect vector, and e is the residual vector.

[0066] For each SNP locus, we test whether α is 0. The probability value of α being 0 is p, which is used to measure the degree of association between the marker genotype and the phenotype. The smaller the p value, the smaller the probability of α being 0, and the more likely the marker is to be associated with the trait.

[0067] II. Experimental Results

[0068] 1. The peak mortality period for largemouth bass is 3-4 days after viral infection. Dead largemouth bass mainly exhibit symptoms such as dragging feces, wandering, circling, bleeding along the gill cover and fins, and spleen enlargement. Figure 1 A and Figure 1 B). Seven days after the viral challenge, the survival rate of the experimental fish remained relatively stable, and the overall mortality rate of the largemouth bass during the entire experiment was 78.8%.

[0069] 2. Distribution of high-quality SNPs on the 22 chromosomes as follows: Figure 2 As shown, the SNP density map shows that the density is highest on chromosome 1 (chr 1) of the largemouth bass genome and lowest on chromosome 15 (chr 15).

[0070] 3. The susceptible population was assigned a value of 1, and the resistant population a value of 0, as phenotypic traits. Association analysis was performed with the genotypes obtained from resequencing. Below the threshold of -log10 p = 4.0, a total of 2348 SNP loci associated with LMBV resistance were obtained. Figure 3 A). The most significant SNPs were primarily located on chromosome 3 of the largemouth bass genome. Quantile-quantile (QQ) plots were generated using R to visualize the association analysis results, as shown below. Figure 3 As shown in B. The results show that the p-value of significant SNPs (-log10p = 4) is greater than its expected value, indicating that the GLM model is reliable for the sample data.

[0071] This yielded four SNP sites, namely:

[0072] SNP1: Three genotypes exist at the location g 38928188G>T on chromosome 3 of the largemouth bass genome: GG, GT and TT.

[0073] SNP2: Three genotypes exist at the location g 38930790C>G on chromosome 3 of the largemouth bass genome: GG, GC and CC.

[0074] SNP3: At the location g 38943374C>A on chromosome 3 of the largemouth bass genome, there are 3 genotypes: CC, AC and AA;

[0075] SNP4: At the location g 38943495G>A on chromosome 3 of the largemouth bass genome, there are 3 genotypes: AA, AG and GG.

[0076] Example 2: Correlation analysis between genotype and frog iridovirus resistance trait

[0077] I. Experimental Methods

[0078] The four SNP loci from Example 1 of this invention were validated in another population containing 311 largemouth bass.

[0079] Based on the genome sequence of the largemouth bass (GenBank accession number: ASM1485139v1) on chromosome, PCR amplification-specific primer combinations were designed using SNPprimer software according to the location information of the four SNP loci determined in Example 1. Each primer combination included an upstream genotyping primer F1, a downstream genotyping primer F2, and a downstream universal primer R. The primer sequences are shown in Table 1.

[0080] Table 1

[0081]

[0082]

[0083] Largemouth bass iridovirus (10) was administered via intraperitoneal injection. 4.5 TCID 50 (each fish was counted as one tail), and the onset and mortality times of 311 experimental largemouth bass were recorded. The tail fins of dying and diseased fish were collected promptly, and genomic DNA was extracted from these 311 largemouth bass and stored at -20℃ for later use. The genomic DNA of the 311 largemouth bass was amplified by PCR using the specific primers listed in Table 1 to obtain the genotypes of SNP loci in different samples. Based on the genotyping results, the number of individuals with different genotypes at each locus was counted, and the gene frequency and genotype frequency of different SNP loci were calculated and correlated with the survival time of the largemouth bass after challenge.

[0084] PCR amplification system (10 μL): DNA template 5 ng ~ 50 ng, Flu-Arms 2×PCR Mix 5 μL, upstream genotyping primer F1 (10 μM) 0.1 μL, downstream genotyping primer F2 (10 μM) 0.1 μL, downstream universal primer R (10 μM) 0.3 μL, add ddH2O to 10 μL.

[0085] PCR amplification program: 95℃ for 10 min; 95℃ for 15 s, gradient annealing at 61~55℃ for 60 s (-0.6℃ / cycle, decreasing by 0.6℃ per cycle), 10 cycles; 95℃ for 15 s, 55℃ for 60 s, 30 cycles in total; 30℃ for 30 s.

[0086] II. Experimental Results

[0087] Figure 4 A, Figure 4 B. Figure 4 C and Figure 4 D shows the fluorescence signal readings of different genotypes at SNP1, SNP2, SNP3, and SNP4 loci in largemouth bass, in sequence.

[0088] As shown in Table 2, Figure 5 A, Figure 5 B and Figure 5 As shown in Table C, SNP1, SNP2, and SNP3 were significantly associated with resistance to frog iridovirus in largemouth bass. The resistance of the GG genotype of SNP1 to frog iridovirus (i.e., survival time after infection with largemouth bass frog iridovirus) was significantly higher than that of the GT and TT genotypes (p<0.01); the resistance of the CC genotype of SNP2 to frog iridovirus was significantly higher than that of the GG genotype (p<0.01) and significantly higher than that of the GC genotype (p<0.05); the resistance of the CC genotype of SNP3 to frog iridovirus was significantly higher than that of the AA and AC genotypes (p<0.01). (See Table 2 and...) Figure 5 As shown in C, there is no significant difference in resistance to frog iridovirus among the different SNP4 genotypes.

[0089] Table 2

[0090]

[0091]

[0092] Example 3: A kit for identifying the anti-frog iridovirus phenotype of largemouth bass

[0093] I. Composition

[0094] Flu-Arms 2×PCR Mix, primers with nucleotide sequences as shown in SEQ ID NO: 1-9, and water.

[0095] II. Instructions for Use

[0096] Using the genomic DNA of the largemouth bass to be tested as a DNA template, and the primers shown in SEQ ID NO: 1-3, SEQ ID NO: 4-6 and SEQ ID NO: 7-9 as nucleotide sequences, PCR amplification was performed to obtain amplification products. The genotypes of the largemouth bass SNP sites 1-3 to be tested in the amplification products were determined, and the anti-frog iridovirus phenotype of the largemouth bass to be tested was determined.

[0097] The PCR amplification program was as follows: 95℃ for 10 min; 95℃ for 15 s, gradient annealing at 61-55℃ for 60 s (-0.6℃ / cycle, decreasing by 0.6℃ per cycle), 10 cycles; 95℃ for 15 s, 55℃ for 60 s, for a total of 30 cycles; 30℃ for 30 s.

[0098] The PCR amplification system (total volume 10 μL) consisted of: 5 ng to 50 ng DNA template, 5 μL Flu-Arms 2×PCR Mix, 0.1 μL upstream genotyping primer F1 (10 μM), 0.1 μL downstream genotyping primer F2 (10 μM), 0.3 μL downstream universal primer R (10 μM), and water added to a final volume of 10 μL.

[0099] III. Result Interpretation

[0100] The amplification products of primers with nucleotide sequences as shown in SEQ ID NO: 1-3 (named amplification product 1) are shown in SEQ ID NO: 13 (atacaagagagaaaagtctctatcggcctttctctgagtttcagagtgcagattt ctcct); the amplification products of primers with nucleotide sequences as shown in SEQ ID NO: 4-6 (named amplification product 2) are shown in SEQ ID NO: 14 (cgttaagagctaaattcagagatacgtccgtgaggtgtgaggaa gcagagatctgtgccg); the amplification products of primers with nucleotide sequences as shown in SEQ ID NO: 7-9 (named amplification product 3) are shown in SEQ ID NO: 15 (gatgatgaggtgccagggtggaggctgaaaataa cacttccgctcagcagttacagccttc).

[0101] When SNP site 1 is located at the 25th bp of the 5' end of amplified product 1 (i.e., at g 38928188 on chromosome 3 of the reference largemouth bass genome with GenBank accession number: ASM1485139v1), largemouth bass samples with the GG genotype show significantly higher resistance to frog iridovirus than those with the GT and TT genotypes, and have a longer survival time after infection with frog iridovirus.

[0102] When SNP site 2 is located at 25 bp at the 5' end of amplified product 2 (i.e., at g 38930790 on chromosome 3 of the reference largemouth bass genome with GenBank accession number: ASM1485139v1), largemouth bass samples with the CC genotype show significantly higher resistance to frog iridovirus than those with the GG and GC genotypes, and have a longer survival time after infection with frog iridovirus.

[0103] When SNP site 3 is located at the 25th bp of the 5' end of amplified product 3 (i.e., at g 38943374 on chromosome 3 of the reference largemouth bass genome with GenBank accession number: ASM1485139v1), largemouth bass samples with the CC genotype show significantly higher resistance to frog iridovirus than those with the AA and AC genotypes, and have a longer survival time after infection with frog iridovirus.

[0104] Example 4: Breeding method and verification of largemouth bass with resistance to frog iridovirus

[0105] I. Experimental Methods

[0106] Largemouth bass with genotypes GG at SNP1, CC at SNP2, and CC at SNP3 were selected as disease-resistant parents for breeding. Offspring were obtained, and 1000 offspring with a body length of 4–5 cm were selected as the breeding group. Offspring from a population of 1000 largemouth bass with a body length of 4–5 cm that had not undergone SNP1, SNP2, and SNP3 selection were used as the control group (unselected group). A challenge experiment was conducted according to the method in Example 1, and the disease incidence and survival rate of each group 14 days after challenge were recorded.

[0107] II. Experimental Structure

[0108] Three days after the viral challenge, the largemouth bass in the control group showed severe ulceration of the back muscles. Figure 6 A) In the selected group of largemouth bass, only a few fish showed slight ulceration. Figure 6 B); Survival rates were calculated 14 days after viral challenge. The survival rate of the selected group of largemouth bass was 65.47%, significantly higher than that of the control group (22.99%). Figure 6 C).

[0109] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. A reagent for detecting SNP sites in the genome of largemouth bass, characterized in that, The reagent is used to detect the genotypes of SNP loci 1, SNP loci 2 and SNP loci 3; The SNP site 1 is located at the 25th bp of the 5' end of amplification product 1, and there are 3 genotypes: GG, GT and TT; the nucleotide sequence of amplification product 1 is shown in SEQ ID NO: 13; The SNP site 2 is located at the 25th bp of the 5' end of the amplification product 2, and there are 3 genotypes: GG, GC and CC; the nucleotide sequence of the amplification product 2 is shown in SEQ ID NO: 14; The SNP site 3 is located at the 25th bp of the 5' end of the amplification product 3, and there are 3 genotypes: CC, AC and AA; the nucleotide sequence of the amplification product 3 is shown in SEQ ID NO: 15; The GenBank accession number for the largemouth bass genome is: ASM1485139v1; The reagents include a primer set; The nucleotide sequences of the primer set for detecting SNP site 1 are shown in SEQ ID NO: 1-3; The nucleotide sequences of the primer set for detecting SNP site 2 are shown in SEQ ID NO: 4-6; The nucleotide sequences of the primer set for detecting SNP site 3 are shown in SEQ ID NO: 7-9.

2. The application of the reagent of claim 1 in identifying the characteristics of largemouth bass against frog iridovirus for non-disease diagnosis and treatment purposes.

3. The use of the reagent of claim 1 in the preparation of a kit for identifying the characteristics of largemouth bass against frog iridovirus.

4. The application of the reagent described in claim 1 in the breeding of largemouth bass with the trait of resistance to frog iridovirus.

5. A method for identifying the characteristics of largemouth bass against frog iridovirus for non-disease diagnosis and treatment purposes, characterized in that, Genotypes of SNP loci 1, SNP loci 2, and SNP loci 3 were detected in the largemouth bass to be tested; The SNP site 1 is located at the 25th bp of the 5' end of amplification product 1, and there are 3 genotypes: GG, GT and TT; the nucleotide sequence of amplification product 1 is shown in SEQ ID NO: 13; The SNP site 2 is located at the 25th bp of the 5' end of the amplification product 2, and there are 3 genotypes: GG, GC and CC; the nucleotide sequence of the amplification product 2 is shown in SEQ ID NO: 14; The SNP site 3 is located at the 25th bp of the 5' end of the amplification product 3, and there are 3 genotypes: CC, AC and AA; the nucleotide sequence of the amplification product 3 is shown in SEQ ID NO: 15; The GenBank accession number for the largemouth bass genome is: ASM1485139v1; The samples with the SNP site 1 genotype GG showed significantly higher resistance to frog iridovirus than the samples with the GT and TT genotypes. The samples with the CC genotype at SNP site 2 showed significantly higher resistance to frog iridovirus than the samples with the GG and GC genotypes. The samples with the CC genotype at SNP site 3 showed significantly higher resistance to frog iridovirus than the samples with the AA and AC genotypes.

6. The method according to claim 5, characterized in that, The detection was performed using the reagent described in claim 1.

7. A kit for identifying the anti-frog iridovirus phenotype of largemouth bass, characterized in that, The kit contains the reagent of claim 1.

8. The reagent kit according to claim 7, characterized in that, The kit also contains Flu-Arms2×PCR Mix and water.

9. A breeding method for largemouth bass with resistance to frog iridovirus, characterized in that, Genotypes of SNP loci 1, SNP loci 2 and SNP loci 3 were detected in largemouth bass. Largemouth bass with genotypes of SNP loci 1 (GG), SNP loci 2 (CC) and SNP loci 3 (CC) were obtained as parents. These parents were then bred to obtain a largemouth bass variety resistant to frog iridovirus. The SNP site 1 is located at the 25th bp of the 5' end of amplification product 1, and there are 3 genotypes: GG, GT and TT; the nucleotide sequence of amplification product 1 is shown in SEQ ID NO: 13; The SNP site 2 is located at the 25th bp of the 5' end of the amplification product 2, and there are 3 genotypes: GG, GC and CC; the nucleotide sequence of the amplification product 2 is shown in SEQ ID NO: 14; The SNP site 3 is located at the 25th bp of the 5' end of the amplification product 3, and there are 3 genotypes: CC, AC and AA; the nucleotide sequence of the amplification product 3 is shown in SEQ ID NO: 15; The GenBank accession number for the largemouth bass genome is ASM1485139v1.

Citation Information

Patent Citations

  • Molecular marker related to disease resistance of micropterus salmoides as well as detection primer, kit and application of molecular marker

    CN118064605A

  • SNP marker related to antiviral characteristics of micropterus salmoides and application of SNP marker

    CN118127178A