A nucleic acid test strip and a detection method for detecting smut disease genes

Abstract

The application provides a nucleic acid test strip and a detection method for detecting smut genes, and belongs to the technical field of detection. The application comprises a bottom plate, a sample pad and a water absorption pad; an NC film is attached to the bottom plate, the NC film is provided with a T line and a C line, the T line is sprayed with a coupling agent of a capture probe and streptavidin; the C line is sprayed with a coupling agent of a quality control probe and streptavidin; the quality control probe is complementary to a DNA sequence of a DNA1-AgInS2 / ZnS fluorescent probe. The application utilizes the advantages of AgInS2 / ZnS quantum dots (AgInS2 / ZnS QDs), such as good biocompatibility, high fluorescence intensity and wide spectral range. The test strip based on AgInS2 / ZnS quantum dots has higher sensitivity and stronger quantitative capacity than traditional test strips. The fluorescence ratio of the T line and the C line is detected by using a fluorescence immunoassay instrument for quantitative detection, the fluorescence immunoassay instrument can quickly read out the value, and has the advantages of rapidness, simple operation, low sensitivity, good selectivity and the like.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of detection, in particular to a nucleic acid test strip for detecting smut disease gene and a method for detecting smut disease by using the nucleic acid test strip. BACKGROUND

[0002] Sugarcane smut is caused by smut disease of sugarcane and is a very serious sugarcane disease in the world. The incidence of sugarcane smut in the field is between 10% and 20%, and in some areas it even exceeds 50%, causing huge economic losses. The characteristic performance of the disease is that the growth point of sugarcane stem changes to form a black whip, which makes it the most easily identifiable one among all sugarcane diseases. Although the disease is obvious in the later stage of development and easy to diagnose, its incubation period is long, and it is difficult for traditional diagnostic methods to accurately determine whether the sugarcane seedlings or seedcane without symptoms have been infected with sugarcane smut fungus. Therefore, exploring the early prediction and diagnosis of sugarcane smut disease has important significance and promoting effect on improving the economic benefit of sugarcane industry.

[0003] At present, the detection of sugarcane smut is mainly through visual observation of the disease or through PCR related technology. However, the disease is observed by naked eye when it has caused great harm to the growth of sugarcane, and the PCR technology usually has the shortcomings of expensive equipment, need for professional operation and inability to detect on site. Therefore, it is necessary to develop a simple, rapid, low-cost and sensitive method for on-site detection of sugarcane smut fungus. SUMMARY

[0004] Therefore, in order to solve the above problems in the prior art, on the one hand, the present application provides a nucleic acid test strip for detecting smut disease gene, which utilizes AgInS2 / ZnS quantum dots (AgInS2 / ZnS QDs) with good biocompatibility, high fluorescence intensity and wide spectral range. The test strip based on AgInS2 / ZnS quantum dots has higher sensitivity and stronger quantitative ability than traditional test strips. The fluorescence ratio of T line and C line is detected by using a fluorescence immunoassay instrument for quantitative detection, which can quickly read out the value and has the advantages of rapidity, simple operation, low sensitivity and good selectivity.

[0005] To achieve the above purpose, the present application provides the following technical solutions:

[0006] A nucleic acid test strip for detecting smut disease gene, comprising:

[0007] a bottom plate with an NC film pasted thereon;

[0008] a sample pad pasted on one side of the bottom plate;

[0009] a water-absorbing pad attached to the other side of the bottom plate;

[0010] The NC film is provided with a T line and a C line, the T line is close to the sample pad, the C line is close to the water-absorbing pad, the T line is sprayed with a conjugate of a capture probe and streptavidin; the 3' end of the capture probe is labeled with biotin;

[0011] The C line is sprayed with a conjugate of a quality control probe and streptavidin; the 5' end of the quality control probe is labeled with biotin; the quality control probe is complementary to the DNA sequence of the DNA1-AgInS2 / ZnS fluorescent probe;

[0012] The nucleotide sequence of the capture probe is TGGAGACGTAGG, and the nucleotide sequence of the quality control probe is ACTAACTTACGG;

[0013] The nucleotide sequence of DNA1 in the DNA1-AgInS2 / ZnS fluorescent probe is CCGTAAGTTAGT.

[0014] Preferably, the preparation method of the DNA1-AgInS2 / ZnS fluorescent probe comprises the following steps:

[0015] Step (1), AgInS2 / ZnS quantum dots are mixed with PBS buffer containing EDC and NHS after activation, and activated AgInS2 / ZnS is obtained;

[0016] Step (2), mix the activated AgInS2 / ZnS with DNA1, and vortex at room temperature;

[0017] Step (3), add BSA, vortex at room temperature, and perform blocking treatment, and finally obtain the DNA1-AgInS2 / ZnS fluorescent probe.

[0018] Preferably, the preparation method of the DNA1-AgInS2 / ZnS fluorescent probe is as follows:

[0019] Step (1), mix 1-5 μL of AgInS2 / ZnS quantum dots with 20-50 μL of PBS buffer containing 10-20 mM of EDC and NHS after activation, and obtain activated AgInS2 / ZnS;

[0020] Step (2), mix the activated AgInS2 / ZnS with DNA1, and vortex at room temperature for 1-4 h;

[0021] Step (3), add 30-50 μL of 0.5-5% BSA, vortex at room temperature for 0.5-3 h, and perform blocking treatment, and finally obtain the DNA1-AgInS2 / ZnS fluorescent probe.

[0022] Preferably, the preparation method of the AgInS2 / ZnS quantum dots comprises the following steps:

[0023] Step (11), adding water, silver nitrate, mercaptoacetic acid, and ammonium hydroxide in a volumetric flask, stirring uniformly to obtain a first mixed solution;

[0024] Step (12), adding InCl3·4H2O to the first mixed solution to obtain a second mixed solution;

[0025] Step (13), adding Na2S·9H2O to the second mixed solution to obtain a third mixed solution, and heating under temperature rise;

[0026] Step (14), adding mercaptoacetic acid and Zn(CH3COO)2 to the third mixed solution to obtain a fourth mixed solution, and continuing to heat to form a ZnS shell;

[0027] Step (15), after rotary evaporation of the fourth mixed solution, adding isopropyl alcohol to induce quantum dot aggregation, then centrifuging, and adding isopropyl alcohol again, repeating the same steps twice to collect the precipitate, dissolving the collected precipitate in water, and storing in a dark environment.

[0028] Preferably, the preparation method of the AgInS2 / ZnS quantum dots is specifically as follows:

[0029] Step (11), adding 90-120 mL of water, 1-3 mL of 0.5-3 M silver nitrate, 2-3 mL of 0.5-3 M mercaptoacetic acid, and 0.5-2 mL of 3-6 M ammonium hydroxide in a volumetric flask, stirring uniformly to obtain a first mixed solution;

[0030] Step (12), adding 0.5-1 mL of 1-3 M InCl3·4H2O to the first mixed solution to obtain a second mixed solution;

[0031] Step (13), adding 0.5-3 mL of 1-3 M Na2S·9H2O to the second mixed solution to obtain a third mixed solution, and heating under temperature rise to 90-95°C for 30-60 min;

[0032] Step (14), adding 0.5-3 mL of 0.5-3 M mercaptoacetic acid and 0.5-3 mL of 0.5-3 M Zn(CH3COO)2 to the third mixed solution to obtain a fourth mixed solution, and continuing to heat for 30-60 min to form a ZnS shell;

[0033] Step (15), after rotary evaporation of the fourth mixed solution at 30-60℃, 2-5 mL of isopropanol is added to induce quantum dot aggregation, then centrifugation is carried out at 4500 rpm for 5-10 min, isopropanol is added again, and the same step is repeated twice to collect the precipitate, the collected precipitate is dissolved in 0.5-3 mL of water, and stored in a dark environment.

[0034] Preferably, the preparation method of the conjugate of the capture probe and streptavidin comprises the following steps:

[0035] Mixing the capture probe and the aqueous streptavidin solution, incubating, and coupling are performed to obtain the conjugate.

[0036] The preparation method of the conjugate of the quality control probe and streptavidin comprises the following steps:

[0037] Mixing the quality control probe and the aqueous streptavidin solution, incubating, and coupling are performed to obtain the conjugate.

[0038] In another aspect, the present application also provides a method for detecting smut genes, which utilizes the above-mentioned nucleic acid test strip for detecting smut genes to detect, comprising the following steps:

[0039] The mixed solution of the DNA amplification liquid containing the target and the DNA1-AgInS2 / ZnS fluorescent probe is dropped onto the T line and the C line, respectively, and the T line develops color as a positive result, and the T line does not develop color as a negative result.

[0040] Preferably, the preparation method of the DNA amplification liquid comprises the following steps:

[0041] Preparation of a logic device: mixing S chain and N chain, heating, cooling to obtain S-N double-stranded chain, incubating magnetic beads and S-N double-stranded chain to obtain a logic device;

[0042] The nucleotide sequence of the S chain is:

[0043] ACACCTTCCATCGACAGCACGTTGATGAACCAGAGCGAAAAAAAAAAA A A;

[0044] The nucleotide sequence of the N chain is: GGTTCATCAACGAGTCGATGGAAGGTGT;

[0045] Preparation of a logic device: mixing R, P, Q chains, heating, cooling to obtain R-P-Q double-stranded chain, incubating magnetic beads and R-P-Q to obtain a logic device;

[0046] The nucleotide sequence of the R chain is: CCTACGTCTCCAACTAACTTACGG;

[0047] The nucleotide sequence of the P chain is:

[0048] AAAAAAAAAAAAAAACCCAGGTTCATCAACGAGTC;

[0049] The nucleotide sequence of the Q chain is:

[0050] CCTTCCATCGACTCGTTGATGAACCTGGGCCGTAAGTTAGTTGGAGAC GTAGG;

[0051] Preparation of the c logic device: heating and cooling the F chain, incubating the magnetic beads and the F chain, and obtaining the c logic device;

[0052] The nucleotide sequence of the F chain is:

[0053] AAAAAAAAACCTACGTCTCCAACTAACTTACGGCCCAGGTTCATCAA CGAGTCG;

[0054] Incubating the target and the a, b, and c logic devices after mixing, and obtaining the DNA amplification solution after magnetic separation of the solution.

[0055] Preferably, the molar ratio of the S chain and the N chain is 1:1 when the a logic device is prepared.

[0056] The molar ratio of the R, P, and Q chains is 1:1:1 when the b logic device is prepared.

[0057] Preferably, preparation of the a logic device: mixing the S chain and the N chain, heating to 80-95℃, maintaining for 5-15 min, and then naturally cooling to room temperature to obtain an S-N double strand, and incubating the magnetic beads and the S-N double strand on a shaking bed for 1-4 h to obtain the a logic device.

[0058] Preparation of the b logic device: mixing the R, P, and Q chains, heating to 80-95℃, maintaining for 5-15 min, and then naturally cooling to room temperature to obtain an R-P-Q double strand, and incubating the magnetic beads and the R-P-Q double strand on a shaking bed for 1-4 h to obtain the b logic device.

[0059] Preparation of the c logic device: heating the F chain to 80-95℃, maintaining for 5-15 min, and then naturally cooling to room temperature, incubating the magnetic beads and the F chain on a shaking bed for 1-4 h, and obtaining the c logic device.

[0060] Compared with the prior art, the present application has the following beneficial effects:

[0061] The nucleic acid test strip for detecting smut genes provided by the application has higher sensitivity and stronger quantitative capacity than traditional test strips, can be observed and judged by naked eyes under the irradiation of a 365nm ultraviolet lamp to realize preliminary qualitative analysis, and can be quantitatively detected by using a fluorescence immunoassay instrument to detect the fluorescence ratio of T line and C line, the fluorescence immunoassay instrument can quickly read out the value, and has the advantages of rapidness, simple operation, low sensitivity and good selectivity.

[0062] The test strip based on AgInS2 / ZnS quantum dots has higher sensitivity and stronger quantitative capacity than traditional test strips, can be observed and judged by naked eyes under the irradiation of a 365nm ultraviolet lamp to realize preliminary qualitative analysis, and can be quantitatively detected by using a fluorescence immunoassay instrument to detect the fluorescence ratio of T line and C line, the fluorescence immunoassay instrument can quickly read out the value, and has the advantages of rapidness, simple operation, low sensitivity and good selectivity. The nucleic acid test strip has low cost, simple instrument and no need for professional operation, and is easy to realize production.

[0063] The detection method of the application uses a DNA logic device, entropy-driven amplification and fluorescent quantum dots to perform signal enhancement, amplifies a small amount of target to effectively amplify the detection signal, and has a low detection limit for smut gene detection. The double-primer-driven strategy is introduced to more accurately detect smut genes. BRIEF DESCRIPTION OF DRAWINGS

[0064] Figure 1 It is a schematic diagram of the test strip of the application;

[0065] Figure 2 It is a schematic diagram of the principle of the test strip of the application for identifying smut, wherein part A is a schematic diagram of an entropy-driven amplification process, part B is a working principle diagram of the test strip, and part C is a schematic diagram of detection results with or without target;

[0066] Figure 3 It is a detection result diagram of the test strip of the application with or without target sequences (observed under the irradiation of a 365nm ultraviolet lamp), wherein part A is a physical diagram without adding smut primers, part B is a physical diagram of adding only smut Target1 gene primers, part C is a physical diagram of adding only smut Target2 gene primers, and part D is a physical diagram of adding two kinds of primers at the same time;

[0067] Figure 4 It is a result diagram of the test strip of the application for detecting different concentrations of target gene sequences;

[0068] Figure 5 It is a standard curve diagram of the test strip of the application for detecting the ratio of T / C signal intensity of different concentrations of target gene sequences. DETAILED DESCRIPTION

[0069] As shown in the drawings, the present application provides a nucleic acid test strip for detecting smut gene, comprising: Figure 1

[0070] a bottom plate, wherein the bottom plate is preferably a PVC (polyvinyl chloride) bottom plate;

[0071] a sample pad attached to one side of the bottom plate, wherein the sample pad is preferably pretreated, and the pretreatment is preferably:

[0072] the sample pad is soaked in a mixed solution of 1% NaCl, 0.5% Tween, 1% BSA, 2% sucrose and 1% triton for 1h, and then baked at 60℃ for 12h, and stored in a sealed container for future use;

[0073] a water absorption pad attached to the other side of the bottom plate;

[0074] wherein the sample pad and the water absorption pad are connected with an overlap of 2mm;

[0075] the NC membrane is provided with a T line (detection limit) and a C line (quality control line), the T line is close to the sample pad, the C line is close to the water absorption pad, and the T line is sprayed with a conjugate of capture probe and streptavidin (SA); the 3' end of the capture probe is labeled with biotin;

[0076] the C line is sprayed with a conjugate of control probe and streptavidin; the 5' end of the control probe is labeled with biotin; the control probe is complementary to the DNA sequence of DNA1-AgInS2 / ZnS fluorescent probe (DNA1-AgInS2 / ZnS probe);

[0077] the nucleotide sequence of the capture probe is TGGAGACGTAGG, and the nucleotide sequence of the control probe is ACTAACTTACGG;

[0078] the nucleotide sequence of DNA1 in the DNA1-AgInS2 / ZnS fluorescent probe is CCGTAAGTTAGT.

[0079] In order to fix the probes on the T line and the C line on the NC membrane, streptavidin is selected as an intermediate, and the capture probe and the control probe labeled with biotin are incubated with streptavidin respectively.

[0080] ​The prepared solution is drawn on the T line and C line area of the NC film by a dispensing machine (preferably 30 μL / s), dried (preferably 37℃ for 12h), cut into test strips (preferably 4mm wide) by a cutting machine, and sealed for storage (preferably at 4℃).

[0081] In the present application, the preparation method of the DNA1-AgInS2 / ZnS fluorescent probe comprises the following steps:

[0082] Step (1), AgInS2 / ZnS quantum dots are mixed with PBS buffer containing EDC and NHS to activate, and activated AgInS2 / ZnS is obtained;

[0083] Step (2), the activated AgInS2 / ZnS is mixed with DNA1, and vortexed at room temperature;

[0084] Step (3), BSA is added and vortexed at room temperature, and the blocking treatment is performed, and finally the DNA1-AgInS2 / ZnS fluorescent probe is obtained.

[0085] The preparation method of the DNA1-AgInS2 / ZnS fluorescent probe is specifically:

[0086] Step (1), 1-5 μL of AgInS2 / ZnS quantum dots are mixed with 20-50 μL of PBS buffer containing 10-20 mM of EDC and NHS, and then shaken at 37℃ for 0.5-2h to activate, and activated AgInS2 / ZnS is obtained;

[0087] Step (2), the activated AgInS2 / ZnS is mixed with DNA1, and vortexed at room temperature for 1-4h;

[0088] Step (3), 30-50 μL of 0.5-5% BSA is added and vortexed at room temperature for 0.5-3h, and the blocking treatment is performed, and finally the DNA1-AgInS2 / ZnS fluorescent probe is obtained.

[0089] In the present application, the preparation method of the AgInS2 / ZnS quantum dots comprises the following steps:

[0090] Step (11), water, silver nitrate, mercaptoacetic acid, and ammonium hydroxide are added to a volumetric flask and stirred uniformly to obtain a first mixed solution;

[0091] Step (12), InCl3·4H2O is added to the first mixed solution to obtain a second mixed solution;

[0092] Step (13), Na2S·9H2O is added to the second mixed solution to obtain a third mixed solution, and the temperature is raised and heated;

[0093] Step (14), adding mercaptoacetic acid and Zn(CH3COO)2 to the third mixed solution to obtain a fourth mixed solution, and continuing to heat to form a ZnS shell;

[0094] Step (15), after rotary evaporation of the fourth mixed solution, adding isopropanol to induce quantum dot aggregation, then centrifuging, and then adding isopropanol, repeating the same step twice to collect the precipitate, and dissolving the collected precipitate in water and storing in a dark environment.

[0095] The preparation method of the AgInS2 / ZnS quantum dots specifically comprises the following steps:

[0096] Step (11), adding 90-120 mL of water, 1-3 mL of 0.5-3 M silver nitrate, 2-3 mL of 0.5-3 M mercaptoacetic acid, and 0.5-2 mL of 3-6 M ammonium hydroxide in a volumetric flask, and stirring uniformly to obtain a first mixed solution;

[0097] Step (12), adding 0.5-1 mL of 1-3 M InCl3·4H2O to the first mixed solution to obtain a second mixed solution;

[0098] Step (13), adding 0.5-3 mL of 1-3 M Na2S·9H2O to the second mixed solution to obtain a third mixed solution, and heating to 90-95 °C for 30-60 min;

[0099] Step (14), adding 0.5-3 mL of 0.5-3 M mercaptoacetic acid and 0.5-3 mL of 0.5-3 M Zn(CH3COO)2 to the third mixed solution and stirring vigorously to obtain a fourth mixed solution, and continuing to heat for 30-60 min to form a ZnS shell;

[0100] Step (15), after rotary evaporation of the fourth mixed solution at 30-60 °C until the final volume is 10-20 mL, adding 2-5 mL of isopropanol to induce quantum dot aggregation, then centrifuging at 4500 rpm for 5-10 min, and then adding isopropanol, repeating the same step twice to collect the precipitate, dissolving the collected precipitate in 0.5-3 mL of water, and storing in a dark environment at 4 °C.

[0101] In the present application, the preparation method of the conjugate of the capture probe and streptavidin comprises the following steps:

[0102] mixing the capture probe and the streptavidin aqueous solution, incubating, and coupling to obtain the conjugate, and specifically preferably:

[0103] Mix 30-60 μL of 10-15 μM of the capture probe and 40-60 μL of 2-6 mg / mL of the streptavidin aqueous solution, and incubate at 4℃ in a refrigerator for 1-3 h to couple, to obtain a coupling reaction solution;

[0104] The preparation method of the coupling product of the quality control probe and the streptavidin comprises the following steps:

[0105] Mix the quality control probe and the streptavidin aqueous solution, and incubate to couple, to obtain the coupling product, and the specific preparation method can be preferably as follows:

[0106] Mix 30-60 μL of 10-15 μM of the quality control probe and 40-60 μL of 2-6 mg / mL of the streptavidin aqueous solution, and incubate at 4℃ in a refrigerator for 1-3 h to couple, to obtain a coupling reaction solution.

[0107] In another aspect, the present application also provides a method for detecting the smut gene, which utilizes the above-mentioned nucleic acid test strip for detecting the smut gene, and comprises the following steps:

[0108] Drop the mixed solution of the DNA amplification liquid containing the target and the DNA1-AgInS2 / ZnS fluorescent probe on the T line and the C line respectively, and the T line shows a positive result, and the T line does not show a negative result.

[0109] In the present application, the preparation method of the DNA amplification liquid comprises the following steps:

[0110] Preparation of the a logic device: mix the S chain and the N chain, heat, cool, and obtain an S-N double strand, incubate the magnetic beads and the S-N double strand, and obtain the a logic device;

[0111] The nucleotide sequence of the S chain is as follows:

[0112] ACACCTTCCATCGACAGCACGTTGATGAACCAGAGCGAAAAAAAAAA AA;

[0113] The nucleotide sequence of the N chain is as follows: GGTTCATCAACGAGTCGATGGAAGGTGT;

[0114] Preparation of the b logic device: mix the R, P, and Q chains, heat, cool, and obtain an R-P-Q double strand, incubate the magnetic beads and the R-P-Q double strand, and obtain the b logic device;

[0115] The nucleotide sequence of the R chain is as follows: CCTACGTCTCCAACTAACTTACGG;

[0116] The nucleotide sequence of the P chain is as follows:

[0117] AAAAAAAAAAAAAAACCCAGGTTCATCAACGAGTC;

[0118] The nucleotide sequence of the Q strand is:

[0119] CCTTCCATCGACTCGTTGATGAACCTGGGCCGTAAGTTAGTTGGAGAC GTAGG;

[0120] Preparation of the c logic device: heating and cooling the F strand, incubating the magnetic beads and the F strand, and obtaining the c logic device;

[0121] The nucleotide sequence of the F strand is:

[0122] AAAAAAAAACCTACGTCTCCAACTAACTTACGGCCCAGGTTCATCAA CGAGTCG;

[0123] Incubating the target and the a, b, and c logic devices after mixing, and obtaining the DNA amplification solution after magnetic separation of the solution.

[0124] Preferably, the molar ratio of the S strand and the N strand is 1:1 when the a logic device is prepared.

[0125] The molar ratio of the R, P, and Q strands is 1:1:1 when the b logic device is prepared.

[0126] In the present application, the preparation of the a logic device: mixing the S strand and the N strand, heating to 80-95℃, maintaining for 5-15 min, and then naturally cooling to room temperature to obtain the S-N double strand, and incubating the magnetic beads and the S-N double strand on a shaking bed for 1-4 h to obtain the a logic device.

[0127] The preparation of the b logic device: mixing the R, P, and Q strands, heating to 80-95℃, maintaining for 5-15 min, and then naturally cooling to room temperature to obtain the R-P-Q double strand, and incubating the magnetic beads and the R-P-Q double strand on a shaking bed for 1-4 h to obtain the b logic device.

[0128] The preparation of the c logic device: heating the F strand to 80-95℃, maintaining for 5-15 min, and then naturally cooling to room temperature, incubating the magnetic beads and the F strand on a shaking bed for 1-4 h to obtain the c logic device.

[0129] The above nucleotide sequences are shown in Table 1:

[0130] Table 1: Nucleotide sequence table

[0131]

[0132] The technical solutions of the present application will be described in detail below in combination with specific embodiments.

[0133] Example 1

[0134] I. Preparation of test strip for detecting sugarcane smut, comprising the following steps:

[0135] 1. Pretreatment of sample pad

[0136] The sample pad was soaked in a mixed solution of 1% NaCl, 0.5% Tween, 1% BSA, 2% sucrose, and 1% triton X-100 for 1 h, then baked in an oven at 60°C for 12 h, and stored in a sealed state.

[0137] 2. Preparation of test strip

[0138] The NC membrane (no need for pretreatment) was attached to the PVC base plate, with the water-absorbing pad attached to one side of the NC membrane and the treated sample pad attached to the other side. Each part was overlapped by 2 mm, and the T line and C line were located in the middle of the sample pad and water-absorbing pad, with the T line close to the sample pad and the C line close to the water-absorbing pad, as shown in Figure 1 .

[0139] (1) In order to fix the probes on the T line and C line of the NC membrane, streptavidin was chosen as the intermediate, and 50 μL of 12 μM labeled biotin capture probe and quality control line probe were incubated with 50 μL of 4 mg / mL streptavidin at 4°C for 1 h.

[0140] (2) The prepared solution was drawn on the T line and C line regions of the NC membrane using a dispensing machine (flow rate of 30 μL / s), and after drying at 37°C for 12 h, the test strip was cut into a width of 4 mm using a strip cutter, and stored in a sealed state at 4°C.

[0141] 3. Preparation of AgInS2 / ZnS QDs

[0142] (1) In a volumetric flask, 96 mL of water was added, and under stirring conditions, 1.0 mL of 0.1M silver nitrate, 2.0 mL of 1.0M mercaptoacetic acid, and 0.65 mL of 5.0M ammonium hydroxide were added.

[0143] (2) After stirring uniformly, 0.7 mL of 1.0M InCl3·4H2O (dissolved in 0.2M nitric acid) was added.

[0144] (3) 1 mL of 1.0M Na2S·9H2O was added to the above solution, and the solution was continuously stirred and heated to 95°C for 30 min.

[0145] (4) After adding 1.0 mL of 1.0M mercaptoacetic acid and 1.0 mL of 1.0M Zn(CH3COO)2 (dissolved in 0.01M nitric acid), the solution was stirred vigorously and heated for another 30 min to form a ZnS shell.

[0146] (5) The above solution was rotary evaporated at 40 °C until the final volume was 10 mL. 2.5 mL of isopropanol was added to induce the aggregation of quantum dots, and then centrifuged at 4500 rpm for 5 min.

[0147] (6) A small amount of isopropanol was added, and the precipitate was collected by repeating the same procedure twice. Finally, the collected precipitate was dissolved in 1 mL of water and stored in a dark environment at 4 °C.

[0148] 4. Preparation of DNA1-AgInS2 / ZnS QDs

[0149] (1) 3 μL of AgInS2 / ZnS QDs was mixed with 37 μL of PBS containing 10 mM EDC and 20 mM NHS, and activated at 37 °C for 1 h.

[0150] (2) The activated AgInS2 / ZnS QDs were mixed with DNA1, and vortexed at room temperature for 2 h.

[0151] (3) 30 μL of 1% BSA was added, and vortexed at room temperature for 1 h to block the material, obtaining DNA1-AgInS2 / ZnS QDs.

[0152] 5. Preparation of DNA amplification solution

[0153] (1) Preparation of a logic device: mix S and N chains at a ratio of 1:1, heat to 95 °C for 5 min, then naturally cool to room temperature to obtain S-N double-stranded. Incubate the magnetic beads and S-N double-stranded by shaking bed for 2 h to obtain a logic device;

[0154] (2) Preparation of b logic device: mix R, P, and Q chains at a ratio of 1:1:1, heat to 95 °C for 5 min, then naturally cool to room temperature to obtain R-P-Q double-stranded. Incubate the magnetic beads and R-P-Q by shaking bed for 2 h to obtain b logic device;

[0155] (3) Preparation of c logic device: heat F chain to 95 °C for 5 min, then naturally cool to room temperature. Incubate the magnetic beads and F chain by shaking bed for 2 h to obtain c logic device;

[0156] 6. Detection method

[0157] (1) Mix different concentrations of target and 6 μL of prepared a logic device, 20 μL of b logic device, and 20 μL of c logic device, and incubate by shaking bed for 3.5 h. After magnetic separation, 50 μL of supernatant (DNA amplification solution) is obtained;

[0158] (2) Mix the supernatant obtained in step (1) with 15 μL of DNA1-AgInS2 / ZnS QDs probe and incubate at 37 °C for 1 h;

[0159] (3) Drop 65 μL of the mixture onto the sample pad, where it will be driven onto the absorbent pad via capillary action. Through complementary base pairing, the amplified DNA1-AgInS2 / ZnS QDs strands can be captured by the detection probe on the detection line. Excess DNA1-AgInS2 / ZnS QDs are captured by the control probe on the control line, thus producing two red bands. Wait approximately 5-20 minutes, then add 100 μL of 5% Tween wash solution. This will reduce the background color, making the detection and control lines clearer.

[0160] (4) Insert the test strip into the fluorescence immunoassay analyzer to read the signal intensity of the detection line / control line and obtain the quantitative analysis of the sugarcane smut gene.

[0161] II. Using the test strip of this invention for the detection of sugarcane smut gene.

[0162] 1. Construction principle of test strips for sugarcane smut disease gene

[0163] like Figure 2 As shown in Part A: Through the entropy-driven principle, the addition of sugarcane smut gene primers (such as Target1 and Target2 in Table 1) will trigger logic a, thereby releasing the N chain. The N chain pairs with the P chain of logic b, thereby triggering logic b. The NPR double strand obtained from logic b can trigger logic c. After logic c completes its work, it releases R and N chains. The N chain can continue to participate in the cyclic reaction, thereby amplifying more R chains.

[0164] like Figure 2 As shown in Part B: After magnetic separation in Part A, the supernatant was aspirated and incubated with the DNA1-AgInS2 / ZnSQDs probe in a shaker for 1 hour, and then dropped onto the test strip.

[0165] T-line color development principle: The T-line is fixed with a capture probe that can specifically recognize the R chain. The bases of the amplified R chain can bind to the DNA1 of the DNA1-AgInS2 / ZnS QDs probe through complementary base pairing. When the complex formed flows to the T-line with the liquid, it can also pair with the capture probe on the T-line, thus being captured by the capture probe on the T-line and accumulating at the T-line to show color, indicating the presence of the target analyte in the sample.

[0166] C-line color development principle: The C-line has quality control probes that are complementary to the DNA1-AgInS2 / ZnS QDs probes. Even if there is no target analyte in the sample, these DNA1-AgInS2 / ZnS QDs probes will flow to the C-line with the liquid and be captured by the quality control probes on the C-line, resulting in C-line color development. The surface test strip functions normally and the detection process is effective.

[0167] like Figure 2 As shown in section C: The logic amplification is initiated by the double primers. Without the addition of primers specific to the sugarcane smut disease gene, the amplification reaction cannot proceed, and only line C shows color on the test strip. The detection result is as follows... Figure 3 Part A of the test strip; when only one gene primer (Target1 or Target2) is added, the amplification reaction cannot proceed, and only line C appears on the test strip, as shown in the test result. Figure 3 Parts B and C of the test strip; only when both primers are present will lines T and C on the test strip show color simultaneously, and the test result will be as shown. Figure 3 Part D in the text.

[0168] 2. Test strip testing

[0169] The test strip is inserted into the cartridge and then into the fluorescence analyzer to read the data. This allows for rapid reading of the fluorescence intensity of the T and C lines. To eliminate errors caused by differences in the tested samples, batches of test strips, and processing variations, we chose the ratio of the T-line fluorescence intensity to the C-line fluorescence intensity (T / C value) as a parameter for the quantitative detection of the analyte content using primers for sugarcane smut-specific genes. Based on the read values, a linear regression equation was established with the logarithm of the smut gene concentration on the x-axis and the T / C ratio on the y-axis, thus completing the quantitative analysis of sugarcane smut. Figure 4 and Figure 5 As shown, the T / C signal ratio is related to the concentration of sugarcane smut gene at a ratio of 10. -15 -10 -6 There is a good linear relationship within the range of M, and the linear regression equation T / CValue = 0.126lg C Target / M+2.019(R 2 =0.992, M = mol / L), the detection limit is 289aM (S / N = 3).

Claims

1. A nucleic acid test strip for detecting smut disease genes, characterized in that, include: The base plate has an NC film pasted on it; The sample pad is attached to one side of the base plate; An absorbent pad is attached to the other side of the base plate; The NC membrane has T-lines and C-lines, with the T-lines close to the sample pad and the C-lines close to the absorbent pad. The T-lines are coated with a conjugate of the capture probe and streptavidin. The 3' end of the capture probe is biotin-labeled. The C-line is coated with a conjugate of a quality control probe and streptavidin; the 5' end of the quality control probe is biotin-labeled; the DNA sequence of the quality control probe is complementary to that of the DNA1-AgInS2 / ZnS fluorescent probe. The nucleotide sequence of the capture probe is TGGAGACGTAGG, and the nucleotide sequence of the quality control probe is ACTAACTTACGG. The nucleotide sequence of DNA1 in the DNA1-AgInS2 / ZnS fluorescent probe is CCGTAAGTTAGT; The DNA amplification solution containing the target and the mixture of the DNA1-AgInS2 / ZnS fluorescent probe were respectively dropped onto the T line and C line. A positive result was indicated by color development on the T line, and a negative result was indicated by no color development on the T line. The nucleotide sequence of primer Target1 for the smut gene is TGCT GTC GAT GGAAGG TGT, and the nucleotide sequence of primer Target2 for the smut gene is CGCTCT GGT TCATCAACG. The method for preparing the DNA amplification solution includes the following steps: Preparation of the α logic device: After mixing the S chain and N chain, heating and cooling are performed to obtain the SN double chain. The magnetic beads and the SN double chain are incubated to obtain the α logic device. The nucleotide sequence of the S chain is as follows: ACACCTTCCATCGACAGCACGTTGATGAACCAGAGCGAAAAAAAAAA AA; The nucleotide sequence of the N chain is: GGTTCATCAACGAGTCGATGGAAGGTGT; Preparation of b logic device: Mix R, P and Q chains, heat and cool to obtain RPQ double chain, incubate magnetic beads and RPQ to obtain b logic device; The nucleotide sequence of the R chain is: CCTACGTCTCCAACTAACTTACGG; The nucleotide sequence of the P chain is as follows: AAAAAAAAAAAAAAACCCAGGTTCATCAACGAGTC; The nucleotide sequence of the Q chain is as follows: CCTTCCATCGACTCGTTGATGAACCTGGGCCGTAAGTTAGTTGGAGAC GTAGG; Preparation of C logic device: The F chain is heated and cooled, and the magnetic beads and F chain are incubated to obtain the C logic device; The nucleotide sequence of the F chain is as follows: AAAAAAAAACCTACGTCTCCAACTAACTTACGGCCCAGGTTCATCAA CGAGTCG; The target material was mixed with logics a, b, and c and incubated. After magnetic separation of the solution, the DNA amplification solution was obtained.

2. The nucleic acid test strip for detecting smut disease genes according to claim 1, characterized in that, The preparation method of the DNA1-AgInS2 / ZnS fluorescent probe includes the following steps: Step (1): AgInS2 / ZnS quantum dots are mixed with PBS buffer containing EDC and NHS and then activated to obtain activated AgInS2 / ZnS. Step (2): Mix the activated AgInS2 / ZnS with DNA1 and vortex at room temperature; Step (3): Add BSA to it, vortex at room temperature to block it, and finally obtain DNA1-AgInS2 / ZnS fluorescent probe.

3. A nucleic acid test strip for detecting smut disease genes according to claim 2, characterized in that, The specific preparation method of the DNA1-AgInS2 / ZnS fluorescent probe is as follows: Step (1): Mix 1-5 μL of AgInS2 / ZnS quantum dots with 20-50 μL of PBS buffer containing 10-20 mM EDC and NHS and activate them to obtain activated AgInS2 / ZnS. Step (2): Mix the activated AgInS2 / ZnS with DNA1 and vortex at room temperature for 1-4 hours; Step (3): Add 30-50 μL of 0.5-5% BSA to the solution, vortex at room temperature for 0.5-3 h to block the solution, and finally obtain the DNA1-AgInS2 / ZnS fluorescent probe.

4. A nucleic acid test strip for detecting smut disease genes according to claim 2, characterized in that, The preparation method of the AgInS2 / ZnS quantum dots includes the following steps: Step (11): Add water, silver nitrate, mercaptoacetic acid, and ammonium hydroxide to a volumetric flask, stir well, and obtain the first mixture; Step (12): Add InCl3·4H2O to the first mixture to obtain the second mixture; Step (13): Add Na2S·9H2O to the second mixture to obtain the third mixture, and heat it. Step (14): Add mercaptoacetic acid and Zn(CH3COO)2 to the third mixture to obtain the fourth mixture, and continue heating to form a ZnS shell; Step (15): After rotary evaporating the fourth mixture, add isopropanol to induce quantum dot aggregation, then centrifuge, add isopropanol again, repeat the same steps twice to collect the precipitate, dissolve the collected precipitate in water, and store it in the dark.

5. A nucleic acid test strip for detecting smut disease genes according to claim 4, characterized in that, The preparation method of the AgInS2 / ZnS quantum dots is as follows: Step (11): Add 90-120 mL of water, 1-3 mL of 0.5-3 M silver nitrate, 2-3 mL of 0.5-3 M mercaptoacetic acid, and 0.5-2 mL of 3-6 M ammonium hydroxide to a volumetric flask, stir well, and obtain the first mixture. Step (12): Add 0.5-1 mL of 1-3 M InCl3·4H2O to the first mixture to obtain the second mixture; Step (13): Add 0.5-3 mL of 1-3 M Na2S·9H2O to the second mixture to obtain the third mixture, and heat it at 90-95℃ for 30-60 min. Step (14): Add 0.5-3 mL of 0.5-3 M mercaptoacetic acid and 0.5-3 mL of 0.5-3 M Zn(CH3COO)2 to the third mixture to obtain the fourth mixture, and continue heating for 30-60 min to form a ZnS shell; Step (15): After rotary evaporating the fourth mixture at 30-60℃, add 2-5 mL of isopropanol to induce quantum dot aggregation, then centrifuge at 4500 rpm for 5-10 min, add isopropanol again, repeat the same steps twice to collect the precipitate, dissolve the collected precipitate in 0.5-3 mL of water, and store in the dark.

6. A nucleic acid test strip for detecting smut disease genes according to any one of claims 1-5, characterized in that, The method for preparing the conjugate of the capture probe and streptavidin includes the following steps: The capture probe and streptavidin aqueous solution are mixed, incubated, and coupled to obtain the desired result. The preparation method of the conjugate of the quality control probe and streptavidin includes the following steps: The quality control probe and streptavidin aqueous solution are mixed and incubated for coupling to obtain the final product.

7. A method for detecting smut disease genes, characterized in that, The detection using the nucleic acid test strip for detecting smut disease genes according to any one of claims 1-6 includes the following steps: The mixture of DNA amplification solution containing the target and the DNA1-AgInS2 / ZnS fluorescent probe is dropped onto the T line and C line respectively. A positive result is indicated by color development on the T line, and a negative result is indicated by no color development on the T line.

8. The method for detecting smut disease gene according to claim 7, characterized in that, The method for preparing the DNA amplification solution includes the following steps: Preparation of the α logic device: After mixing the S chain and N chain, heating and cooling are performed to obtain the SN double chain. The magnetic beads and the SN double chain are incubated to obtain the α logic device. The nucleotide sequence of the S chain is as follows: ACACCTTCCATCGACAGCACGTTGATGAACCAGAGCGAAAAAAAAAA AA; The nucleotide sequence of the N chain is: GGTTCATCAACGAGTCGATGGAAGGTGT; Preparation of b logic device: Mix R, P and Q chains, heat and cool to obtain RPQ double chain, incubate magnetic beads and RPQ to obtain b logic device; The nucleotide sequence of the R chain is: CCTACGTCTCCAACTAACTTACGG; The nucleotide sequence of the P chain is as follows: AAAAAAAAAAAAAAACCCAGGTTCATCAACGAGTC; The nucleotide sequence of the Q chain is as follows: CCTTCCATCGACTCGTTGATGAACCTGGGCCGTAAGTTAGTTGGAGAC GTAGG; Preparation of C logic device: The F chain is heated and cooled, and the magnetic beads and F chain are incubated to obtain the C logic device; The nucleotide sequence of the F chain is as follows: AAAAAAAAACCTACGTCTCCAACTAACTTACGGCCCAGGTTCATCAA CGAGTCG; The target material was mixed with logics a, b, and c and incubated. After magnetic separation of the solution, the DNA amplification solution was obtained.

9. The method for detecting smut disease gene according to claim 8, characterized in that, When fabricating logic a, the molar ratio of the S chain to the N chain is 1:1; When fabricating the b logic device, the molar ratio of the R, P, and Q chains is 1:1:

1.

10. A method for detecting smut disease genes according to claims 8-9, characterized in that, Preparation of α logic device: Mix S chain and N chain, heat to 80-95℃, hold for 5-15 min, and then cool naturally to room temperature to obtain SN double chain. Incubate magnetic beads and SN double chain in a shaker for 1-4 h to obtain α logic device. Preparation of b logic device: Mix R, P and Q chains, heat to 80-95℃, hold for 5-15 min, and then cool naturally to room temperature to obtain RPQ double chain. Incubate magnetic beads and RPQ in a shaker for 1-4 h to obtain b logic device. Preparation of C logic device: Heat F chain to 80-95℃, hold for 5-15 min, then cool naturally to room temperature, and incubate magnetic beads and F chain in a shaker for 1-4 h to obtain C logic device.

Images