Preparation method and application of immobilized compound flora for degrading phthalate

Abstract

The invention provides a preparation method and application of an immobilized compound flora for degrading phthalic acid ester, belongs to the technical field of microorganisms, and can realize efficient degradation of phthalic acid ester in polluted soil and plants through the synergistic effect of various strains. The method comprises the following steps: activating glutamic acid bacillus, gordonia and acinetobacter; adopting activated glutamicum, gordonia and acinetobacter to prepare a compound bacterium suspension; the compound bacterium suspension and the biochar are subjected to curing treatment to obtain an immobilized compound flora, the 16S rRNA sequence of glutamicum glutamicum is as shown in SEQ ID NO: 1, the 16S rRNA sequence of gordonia is as shown in SEQ ID NO: 2, and the 16S rRNA sequence of acinetobacter is as shown in SEQ ID NO: 3.

Description

Technical Field

[0001] The invention relates to the technical field of microorganisms, and in particular to a preparation method and application of an immobilized composite bacterial community for degrading phthalates. Background Art

[0002] In recent years, the microbial remediation technology of using degrading bacteria to remove toxic organic pollutants (such as phthalates (PAEs)) has become one of the most promising organic pollution control technologies because of its high efficiency, economy and environmental friendliness. Most studies in the prior art use single strains with specific degradation functions. However, single strains can usually only degrade one or several specific types of pollutants. If the pollutants are complex and diverse in composition, the metabolic pathway of a single strain is often insufficient to achieve comprehensive degradation. In addition, single strains have poor adaptability to environmental conditions (such as temperature, pH value, oxygen concentration, nutrients, etc.). In the natural environment, these conditions often fluctuate greatly. If a single strain does not adapt to certain changes, it may lose its activity or viability, thereby affecting the degradation efficiency of pollutants (such as phthalates). It can be seen that the degradation effect of single strains on phthalates is poor. Summary of the invention

[0003] The present invention provides a preparation method of an immobilized composite bacterial community for degrading phthalates and an application thereof, which can achieve efficient degradation of phthalates in contaminated soil and plants through the synergistic effect of multiple strains.

[0004] In order to achieve the above object, the present invention adopts the following technical solution: In a first aspect, the present invention provides a method for preparing an immobilized composite bacterial community for degrading phthalates, comprising: Activates glutamicum, Gordonia, and Acinetobacter; The composite bacterial suspension is prepared by using activated glutamicum, Gordonia and Acinetobacter; The composite bacterial suspension and biochar are solidified to obtain an immobilized composite bacterial community; Among them, the 16S rRNA sequence of Bacillus glutamicum is shown in SEQ ID NO: 1, the 16S rRNA sequence of Gordonia spp. is shown in SEQ ID NO: 2, and the 16S rRNA sequence of Acinetobacter spp. is shown in SEQ ID NO: 3.

[0005] In one implementation of the first aspect, activated Bacillus glutamicum, Gordonia and Acinetobacter are used to prepare a composite bacterial suspension, comprising: The activated Bacillus glutamicum, Gordonia and Acinetobacter were centrifuged respectively, the supernatant was discarded, and the cells were centrifuged again to obtain Bacillus glutamicum, Gordonia and Acinetobacter cells.

[0006] Glutamibacillus cells, Gordonia cells and Acinetobacter cells are respectively prepared into bacterial suspensions using MSM liquid culture medium, and compounded in a volume ratio of 1-2:1-2:1 to obtain the composite bacterial suspension.

[0007] In an implementation of the first aspect, the composite bacterial suspension and biochar are processed to obtain an immobilized composite bacterial community, including: The composite bacterial suspension and biochar were mixed at a ratio of 5ml~15ml:1g, cultured at a constant temperature with shaking, and then centrifuged multiple times to discard the supernatant to obtain an immobilized composite bacterial community.

[0008] In an implementation of the first aspect, activating Glutamibacillus, Gordona, and Acinetobacter comprises: inoculating Glutamibacillus, Gordona, and Acinetobacter into LB liquid culture medium, respectively, and culturing to a logarithmic growth phase to obtain activated Glutamibacillus, Gordona, and Acinetobacter.

[0009] In an implementation of the first aspect, the method for preparing biochar is: drying, crushing, and sieving poplar branches and then pyrolyzing them to obtain biochar.

[0010] In a second aspect, the present invention provides an application of an immobilized composite bacterial community for degrading phthalates. The immobilized composite bacterial community prepared based on the above-mentioned preparation method of an immobilized composite bacterial community for degrading phthalates is used to degrade phthalates in contaminated soil.

[0011] Specifically, the immobilized composite bacterial community is applied to the PAEs contaminated soil at a mass ratio of 1-5%, thereby achieving the degradation of phthalates in the contaminated soil.

[0012] In a third aspect, the present invention further provides an application of an immobilized composite bacterial community for degrading phthalates. The immobilized composite bacterial community prepared based on the above-mentioned preparation method of an immobilized composite bacterial community for degrading phthalates is used to degrade phthalates in plants.

[0013] Specifically, the immobilized composite bacterial community is applied to the PAEs-contaminated soil where the plants grow according to a certain mass ratio, thereby achieving the degradation of phthalates in the plants.

[0014] In a fourth aspect, the present invention further provides an application of an immobilized composite bacterial community for degrading phthalates, based on the above-mentioned immobilized composite bacterial community, for simultaneously degrading phthalates in contaminated soil and phthalates in plants.

[0015] Specifically, the immobilized composite bacterial community is applied to the PAEs-contaminated soil where the plants grow according to a certain mass ratio, thereby simultaneously achieving the degradation of phthalates in the contaminated soil and the plants.

[0016] In an implementation of the second aspect, the third aspect and the fourth aspect, the phthalate ester includes at least one of dimethyl phthalate, diethyl phthalate, dibutyl phthalate, butyl benzyl phthalate, di(2-ethyl)hexyl phthalate and di-n-octyl phthalate.

[0017] The beneficial effects of the present invention are: The present invention utilizes poplar branches to prepare biochar and loads the composite bacterial community onto the biochar, thereby overcoming the problem that free bacteria are easily affected by the external environment and have low biological effectiveness; and realizes the coupling of PAEs pollution control and garden waste resource development.

[0018] The prior art uses a single strain or indigenous flora to biodegrade PAEs. However, due to the limited broad-spectrum degradation of a single bacteria, the complex composition of the indigenous flora, the large differences in the ability of different microorganisms in the flora to degrade pollutants, and the fact that the flora does not necessarily contain strains specifically targeting specific pollutants, the prior art has a low degradation efficiency for PAEs. Compared with the prior art method of degrading PAEs with a single bacteria, the composite flora provided by the present invention can more thoroughly degrade and transform PAEs through the synergistic effect between different strains, thereby improving the degradation efficiency of PAEs.

[0019] The immobilized composite bacterial community provided by the present invention can not only remove PAEs in soil and plants, but also decompose organic matter in the soil while decomposing PAEs, and convert the organic matter into nutrients that can be used by plants, optimize the plant rhizosphere environment, form a microecological environment that is conducive to plant growth, and thus promote the growth and development of plants. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 It is a schematic diagram of the results of the strain antagonism test provided in the examples of the present application; Figure 2 is a scanning electron microscope schematic diagram of poplar biochar provided in the examples of the present application; Figure 3 is a scanning electron microscope schematic diagram of the immobilized composite bacterial flora provided in the examples of the present application; Figure 4 It is a schematic diagram of the degradation efficiency of A1, A2, A3, composite bacterial suspension and immobilized composite bacterial community on ∑PAEs provided in the examples of the present application; Figure 5 This is a schematic diagram of the degradation pathway of dibutyl phthalate by the single bacteria A1 provided in the examples of the present application; Figure 6 This is a schematic diagram of the degradation pathway of dibutyl phthalate by the immobilized composite bacterial community provided in the examples of the present application; Figure 7 It is a schematic diagram of the degradation rate of ∑PAEs in soil after applying the immobilized composite bacterial community provided in the examples of the present application; Figure 8 It is a schematic diagram of the degradation rate of ∑PAEs in lettuce after applying the immobilized composite bacterial flora provided in the examples of the present application. DETAILED DESCRIPTION

[0021] The terms "first" and "second" etc. in the description and claims of the present invention are used to distinguish different objects rather than to describe a specific order of the objects.

[0022] The “and / or” in the embodiments of the present application indicates the relationship between objects. For example, A and / or B may indicate the following three situations: A exists alone, B exists alone, and A and B exist at the same time.

[0023] In the embodiments of the present application, words such as "exemplary" or "for example" are used to indicate examples, illustrations or descriptions. Any embodiment or design described as "exemplary" or "for example" in the embodiments of the present application should not be interpreted as being more preferred or more advantageous than other embodiments or designs. Specifically, the use of words such as "exemplary" or "for example" is intended to present related concepts in a specific way.

[0024] The preparation method and application of the immobilized composite bacterial community provided in the embodiments of the present application can be used to degrade phthalates. Specifically, the immobilized composite bacterial community prepared in the embodiments of the present application degrades phthalates in contaminated soil and plants.

[0025] Understandably, phthalates (PAEs) as plasticizers are widely used and difficult to degrade. They can enter plants through the soil and interfere with the normal physiological processes of plants, which not only pollutes the soil but also affects plant growth.

[0026] However, due to the variable environmental conditions in which PAEs are located, a single strain cannot adapt to a variety of environments. Therefore, the effect of degrading PAEs by a single strain is poor. In order to solve the above problems, the present application embodiment provides a preparation method and application of an immobilized composite bacterial community for degrading phthalates, which can more thoroughly degrade and transform PAEs through the synergistic effect between different strains, thereby improving the degradation efficiency of PAEs.

[0027] Illustratively, the present embodiment provides a method for preparing an immobilized composite bacterial community for degrading phthalates, including S101-S104.

[0028] S101, Bacillus glutamicum, Gordonia, and Acinetobacter; glutamicum ( Glutamicibacter sp. ), Gordonia Gordonia sp. ) and Acinetobacter ( Acinetobacter sp. ) were inoculated into LB liquid medium and cultured to the logarithmic growth phase to obtain activated glutamicum bacteria, Gordonia and Acinetobacter; The 16S rRNA sequence of Bacillus glutamicum is shown in SEQ ID NO: 1, the 16S rRNA sequence of Gordonia spp. is shown in SEQ ID NO: 2, and the 16S rRNA sequence of Acinetobacter spp. is shown in SEQ ID NO: 3; SEQ ID NO: 1: SEQ ID NO:2: TGGAGGTCTCCCGGCGGTCGACTTACGCGTTAGCTCCGGAAGCCACTCCTCAAGGGAACAACCTCCAAGTCGACATCGTTTACGGCGTGGACTACCAGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGCACCTGAGCGTCAGTCTTTGTCCAGGGGGCCGCCTTCGCCACCGGTATTCCTCCAGATCTCTACGCATTTCACCGCTACACCTGGAATTCTACCCCCCTCTACAAGACTCTAGCCTGCCAGTTTCGAATGCAGTTCCCAGGTTGAGCCCGGGGATTTCACATCCGACTTGACAGACCGCCTGCGTGCGCTTTACGCCCAGTAATTCCGATTAACGCTTGCACCCTCCGTATTACCGCGGCTGCTGGCACGGAGTTAGCCGGTGCTTCTTCTGCGGGTAACGTCAATTGCTGCGGTTATTAACCGCAACACCTTCCTCCCCGCTGAAAGTACTTTACAACCCGAAGGCCTTCTTCATACACGCGGCATGGCTGCATCAGGCTTGCGCCCATTGTGCAATATTCCCCACTGCTGCCTCCCGTAGGAGTCTGGACCGTGTCTCAGTTCCAGTGTGGCTGGTCATCCTCTCAGACCAGCTAGGGATCGTCGCCTAGGTGAGCCATTACCCCACCTACTAGCTAATCCCATCTGGGCACATCTGATGGCAAGAGGCCCGAAGGTCCCCCTCTTTGGTCTTGCGACGTTATGCGGTATTAGCTACCGTTTCCAGTAGTTATCCCCCTCCATCAGGCAGTTTCCCAGACATTACTCACCCGTCCGCCACTCGTCACCCGAGAGCAAGCTCTCTGTGCTACCGTTCGACTTGCATGTGTTAGGCCTGCCGCCAGCGTTCATCTGACGGGGGTA; SEQ ID NO:3: ; Specifically, the activation process of Bacillus glutamicum (hereinafter referred to as A1), Gordonia (hereinafter referred to as A2) and Acinetobacter (hereinafter referred to as A3) is as follows: Strain A1, A2, and A3 were scraped and placed in LB liquid medium, and cultured in a shaking incubator at 30°C and 150 r / min until the logarithmic growth phase to activate strains A1, A2, and A3; Furthermore, in order to verify whether there is antagonism between strains A1, A2, and A3, a small amount of activated bacterial solution was picked up with an inoculation loop and inoculated on a plate containing LB solid culture medium in an ultra-clean workbench; after the three strains were crossed on the LB solid culture medium, the plate was inverted and cultured in a 30°C constant temperature incubator for 3 days; after the culture was completed, the growth of the colonies at the intersection of the crossed lines was observed; Colony growth Figure 1 As shown by Figure 1 It can be seen that after the cross-streak culture, the strains A1, A2 and A3 grew well at the intersection, indicating that there was no antagonism between the three strains and they could be used for the preparation of immobilized composite bacterial flora. The LB liquid culture medium formula is as follows: weigh 10 g of tryptone, 5 g of yeast extract and 10 g of sodium chloride; add the above drugs into deionized water, stir until completely dissolved, and dilute to 1 L with deionized water; place the prepared LB liquid culture medium in a culture bottle and sterilize it by high pressure at 121°C for 15-20 minutes; LB solid culture medium formula: weigh 10 g tryptone, 5 g yeast extract, 10 g sodium chloride and 15 g agar; add the above drugs to deionized water, heat and stir until completely dissolved, and dilute to 1 L with deionized water; place the solution in a culture bottle and sterilize it by high pressure at 121°C for 15-20 minutes; after sterilization, wait for the culture medium to cool down and pour it into a sterile plate; S102, preparing a composite bacterial suspension using activated glutamicum, Gordonia and Acinetobacter; In one implementation, S102 includes S1021-S1022; S1021, centrifuging the activated glutamicum bacteria, Gordona bacteria and Acinetobacter bacteria respectively, discarding the supernatant, and centrifuging again to obtain glutamicum bacteria cells, Gordona bacteria cells and Acinetobacter bacteria cells; S1022, preparing bacterial suspensions of Bacillus glutamicum, Gordonia and Acinetobacter using MSM liquid culture medium respectively, and compounding them in a volume ratio of 1-2:1-2:1 to obtain the composite bacterial suspension; Optionally, the MSM liquid culture medium (also called Minimal Salts Medium liquid culture medium) is a basic salt culture medium, which is mainly used to study the degradation ability of bacteria on specific carbon sources, or to separate bacteria with degradation ability. Since the MSM liquid culture medium is a common culture medium in the art, the present application does not elaborate on the formula of the MSM liquid culture medium; the above volume ratio can be 1:2:1, or 1:1:1, or 2:1:1, which is not limited in the embodiments of the present application; Specifically, the preparation process of the composite bacterial suspension is as follows: After strains A1, A2, and A3 were activated, the bacterial suspension was centrifuged at 4 °C for 5 min (8000 r / min), and the supernatant was discarded. The bacterial cells were washed three times with sterilized MSM liquid medium and centrifuged again to collect the cells. The bacterial suspension was prepared with MSM liquid medium, and the OD 600 Adjust to 1.0, mix the suspensions of the three strains in a volume ratio of 1:1:1, and store them in a 4°C refrigerator for later use; S103, obtaining biochar: drying, crushing, and sieving poplar branches, and then pyrolyzing them to obtain biochar; Specifically, the preparation method of biochar is as follows: Wash the poplar branches and place them in an oven, dry them, and then crush them through a 60-mesh sieve; place the poplar wood chips in a crucible and put them into a muffle furnace; continue to introduce nitrogen, raise the furnace temperature to the pyrolysis temperature of 600 °C at a heating rate of 5 °C / min, and keep it warm for 2 hours; after the pyrolysis is completed, wait for the muffle furnace to cool to room temperature, take out the biochar, wash it with 0.1% dilute hydrochloric acid and ultrapure water, dry it, and grind it for use; Furthermore, the surface morphology of biochar was observed using a scanning electron microscope; the biochar sample was glued to a conductive glue and gold was sprayed for 45 seconds to enhance the surface conductivity of the biochar sample; the conductive glue was placed on the sample stage, vacuumed, and the voltage was increased; the sample position was found, and the image was scanned and saved according to the shooting magnification; the accelerating voltage was 3 kV when the morphology was photographed; the specific surface area, pore volume and pore size of the biochar were determined using a fully automatic specific surface and porosity analyzer; the biochar was placed in an adsorption instrument, and the sample was subjected to nitrogen adsorption and desorption tests at a temperature of 200°C; based on the adsorption isotherm data, the BET equation was used to fit and calculate the specific surface area of ​​the poplar biochar; The surface morphology of poplar biochar obtained by pyrolysis at 600℃ is shown in Figure 2. Figure 2 shown by Figure 2 It can be seen that the graphitization degree of biochar is high, the wall surface is relatively rough, the structure is neat and orderly, and it contains a certain number of pores, most of which are circular or elliptical in shape. In addition, it can be observed that some debris remains on the surface of biochar, which may be formed by the accumulation of ash formed during the carbonization process on the surface. The specific surface area of ​​poplar biochar is shown in Table 1. It can be seen from Table 1 that the average pore size of poplar biochar is 2.96 nm. Relevant literature shows that the pore size of biochar is divided into microporous, mesoporous and macroporous structures, ranging from 0 to 2 nm, 2 to 50 nm, and above 50 nm, respectively. The average pore size of the three types of biochar involved in this paper is between 2 and 50 nm, so it is judged that its pore structure is mesoporous. In addition, the specific surface area of ​​poplar biochar is as high as 198.26 m2 / g, indicating that the prepared biochar has a large specific surface area and good porosity, which can provide a good habitat for the growth and reproduction of degradation strains. Table 1 Specific surface area of ​​poplar biochar

[0029] For example, biochar with the same characteristics can also be obtained through other methods, and the embodiments of the present application do not limit the method for obtaining biochar; Optionally, S101-S102 may be executed first and then S103, or S103 may be executed first and then S101-S102, or S101-S102 and S103 may be executed simultaneously. The embodiment of the present application does not limit the execution order of S101-S102 and S103. S104, solidifying the composite bacterial suspension and biochar to obtain an immobilized composite bacterial community; In one implementation, S104 includes: mixing the composite bacterial suspension with biochar, culturing at a constant temperature and shaking, and then discarding the supernatant by multiple centrifugation to obtain an immobilized composite bacterial community; Among them, the ratio of the composite bacterial suspension to the biochar is in the range of 5ml~15ml:1g; optionally, the above ratio can be 5ml:1g, 10ml:1g, or 15ml:1g, which is not limited in the embodiments of the present application.

[0030] Specifically, the preparation process of the immobilized composite bacterial community is as follows: Weigh 2 g of biochar in a 100 mL conical flask, sterilize it at high temperature and high pressure, and then cool it to room temperature. Add 20 ml of activated composite bacterial suspension to the conical flask, place it in a constant temperature shaking incubator at 30°C and 150 rpm for one day, then take it out, and then centrifuge it in a centrifuge at 5000 rpm for 5 minutes at 4°C, and discard the supernatant. Wash the lower layer of bacteria with sterilized MSM liquid culture medium, centrifuge it for 5 minutes, and discard the supernatant. Repeat this process 3 times, and the solid obtained by centrifugation is the immobilized composite bacterial community.

[0031] Furthermore, 1 ml of 2.5% glutaraldehyde solution was added to a 1.5 ml centrifuge tube, and the immobilized composite bacterial community was immersed in the solution for fixation and placed at 4 °C overnight. The treated samples were placed in a scanning electron microscope for photography to observe the attachment of the composite bacterial community to the biochar.

[0032] The attachment of the composite bacterial community to biochar is shown in Figure 3 As shown. Figure 3 It can be seen that a certain amount of bacteria is attached to the surface of the immobilized carrier biochar, and the microorganisms can migrate, reproduce and quickly absorb nutrients and dissolved oxygen on the surface and pores of the biochar. The results show that the poplar biochar prepared by pyrolysis can enrich more functional strains and has a good immobilization effect, thereby preparing an immobilized composite bacterial community with excellent degradation efficiency.

[0033] Furthermore, in order to verify the ability of the composite bacterial community to degrade PAEs, 19 mL of sterilized MSM liquid culture medium was added to a sterile conical flask, followed by the addition of a mother solution containing six PAEs to make the total PAEs concentration in the conical flask 30 mg / L (the concentration of a single PAEs was 5 mg / L).

[0034] Then, 1 mL of A1 bacterial solution, 1 mL of A2 bacterial solution, 1 mL of A3 bacterial solution, 1 mL of bacterial suspension of composite bacterial flora and 2 g of immobilized composite bacterial flora were added to the conical flasks under the above conditions, and 3 replicates were set for each treatment. The culture was carried out at 150 r / min and 30°C in the dark, and samples were taken on the 1st, 2nd, 3rd, 4th, 5th, 6th and 7th days of culture to determine the residual concentration of PAEs.

[0035] The above six PAEs refer to dimethyl phthalate (DMP), diethyl phthalate (DEP), dibutyl phthalate (DBP), butyl benzyl phthalate (BBP), di(2-ethyl)hexyl phthalate (DEHP) and di-n-octyl phthalate (DnOP). In inorganic salt culture medium, the total degradation effect of single strains (A1, A2, A3), free composite bacterial flora (i.e. composite bacterial flora in composite bacterial suspension) and immobilized composite bacterial flora on the six PAEs is as follows Figure 4 As shown. Figure 4It can be observed that with the increase of culture time, the degradation rate of ∑PAEs by single strains and two groups of functional bacteria increased steadily. On the 7th day, the degradation rate tended to be stable. After the culture period, the degradation rates of ∑PAEs by single strains A1, A2, and A3 reached 49.46%, 51.45%, and 52.67%, respectively, and the degradation rates of ∑PAEs by free composite bacteria and immobilized composite bacteria reached 63.25% and 84.27%, respectively. The results showed that both single strains and composite functional bacteria can effectively degrade the six PAEs, and the degradation efficiency of composite bacteria is better. In addition, the degradation rate of ∑PAEs by immobilized bacteria during the culture period was higher than that of free bacteria, indicating that the immobilization effect is good and the immobilized microbial technology can improve the degradation ability of bacteria to PAEs.

[0036] In addition, the degradation products of dibutyl phthalate (DBP) by the above-mentioned A1 bacterial solution and immobilized composite bacterial community were tested to clarify the degradation pathways of DBP by single bacteria (such as A1) and immobilized composite bacterial community, and then to explore the degradation efficiency of PAEs by single bacteria and immobilized composite bacterial community.

[0037] Specifically, the degradation pathways of the single bacteria A1 and the immobilized composite bacterial community for DBP were analyzed and detected by liquid chromatography-mass spectrometry. The degradation pathway of the single bacteria A1 (also known as the degradation chain of the single bacteria A1 for DBP) is as follows: Figure 5 As shown in FIG. 1 , the degradation pathway of DBP by the immobilized composite bacterial community (also called the degradation chain of DBP by the immobilized composite bacterial community) is as follows: Figure 6 shown.

[0038] Depend on Figure 5 It can be seen that four metabolites were detected in the degradation of DBP by the single strain A1, and its degradation pathway may be: DBP first undergoes β-oxidation to form diethyl phthalate, then forms monoethyl phthalate through deesterification, and then continues to form phthalic acid through deesterification.

[0039] At the same time, it was verified that the degradation pathways of single strain A2 and single strain A3 were basically the same as that of single strain A1.

[0040] Depend on Figure 6 It can be seen that the degradation pathway of the composite bacterial community can be: through the synergistic action of different strains (A1, A2 and A3), DBP first undergoes β-oxidation to form diethyl phthalate, then forms monoethyl phthalate through deesterification, and then continues to form phthalic acid through deesterification. Thereafter, phthalic acid is further decomposed into 1,3-isobenzofurandione through a dehydration condensation process.

[0041] Depend on Figure 5 and Figure 6It can be seen that a single strain can degrade DBP into phthalic acid (i.e., primary decomposition of DBP), while the composite bacterial community provided in the examples of the present application can degrade DBP into 1,3-isobenzofurandione (i.e., further decomposition of DBP). This shows that the composite bacterial community provided in the examples of the present application is more thorough in the metabolic decomposition of dibutyl phthalate (DBP) than a single bacterium. On this basis, it can be further believed that the composite bacterial community provided in the examples of the present application can, through mutual synergy, make its metabolic decomposition of PAEs more thorough than a single bacterium, thereby improving the degradation efficiency of PAEs.

[0042] The embodiment of the present application also provides an application of an immobilized composite bacterial community for degrading phthalates, based on the above-mentioned immobilized composite bacterial community, for degrading phthalates in contaminated soil.

[0043] The phthalates include at least one of dimethyl phthalate (DMP), diethyl phthalate (DEP), dibutyl phthalate (DBP), butyl benzyl phthalate (BBP), di(2-ethyl)hexyl phthalate (DEHP) and di-n-octyl phthalate (DnOP).

[0044] In one application scenario, 200 g of aged PAEs-contaminated soil is placed in a clay pot, and the prepared immobilized composite bacterial community is added to the potted plant at a ratio of 3% of the mass of the PAEs-contaminated soil and mixed evenly.

[0045] Among them, phthalates include DMP, DEP, DBP, BBP, DEHP and DnOP.

[0046] In order to verify the degradation effect of the above application on PAEs, an experimental group to which the composite bacterial suspension was applied under the same conditions was set as a control group, and a blank group without any treatment under the same conditions was set up. The PAEs degradation rate in the PAEs-contaminated soil was detected on the 7th day, the 21st day, and the 40th day, respectively.

[0047] The embodiment of the present application also provides an application of an immobilized composite bacterial community for degrading phthalates. The immobilized composite bacterial community prepared based on the above-mentioned preparation method of an immobilized composite bacterial community for degrading phthalates is used to degrade phthalates in plants.

[0048] In one application scenario, 200 g of aged PAEs-contaminated soil was placed in a clay pot, lettuce was selected as the test vegetable, and the prepared immobilized composite bacterial community was added to the potted plant at a ratio of 3% of the mass of the PAEs-contaminated soil and mixed evenly. The lettuce seeds were soaked in a 75% ethanol solution for 5 minutes, and then washed with sterile water 3 times for disinfection. The surface-sterilized lettuce seeds were then sown in the soil to reduce the accumulation of PAEs in the lettuce during its growth, thereby achieving the degradation of phthalates in the lettuce.

[0049] Among them, phthalates include DMP, DEP, DBP, BBP, DEHP and DnOP.

[0050] In order to verify the degradation effect of the above application on PAEs, three replicates were set for each treatment. The experimental group with the composite bacterial suspension applied under the same conditions was set as the control group, and the blank group without any treatment under the same conditions was set. Lettuce samples were collected on the 7th, 21st and 40th day after the lettuce emerged, and the PAEs degradation rate in the lettuce samples was determined.

[0051] An embodiment of the present application also provides an application of an immobilized composite bacterial community for degrading phthalates. The immobilized composite bacterial community prepared based on the above-mentioned preparation method of an immobilized composite bacterial community for degrading phthalates is used to simultaneously degrade phthalates in contaminated soil and phthalates in plants.

[0052] In one application scenario, 200 g of aged PAEs-contaminated soil was placed in a clay pot, lettuce was selected as the test vegetable, and the prepared immobilized composite bacterial community was added to the potted plant at a ratio of 3% of the mass of the PAEs-contaminated soil and mixed evenly. The lettuce seeds were soaked in a 75% ethanol solution for 5 min, and then washed with sterile water 3 times for disinfection. The surface-sterilized lettuce seeds were then sown in the soil, so that during the growth of the lettuce, the immobilized composite bacterial community could not only reduce the accumulation of PAEs in the lettuce, thereby degrading the phthalates in the lettuce, but also degrade the PAEs in the contaminated soil.

[0053] Among them, phthalates include DMP, DEP, DBP, BBP, DEHP and DnOP.

[0054] In order to verify the degradation effect of the above application on PAEs, three replicates were set for each treatment, and the experimental group applied with the composite bacterial suspension under the same conditions was set as the control group. Lettuce samples were collected on the 7th, 21st and 40th day after lettuce emergence, and the PAEs degradation rate in contaminated soil and lettuce samples was determined.

[0055] The degradation rate of PAEs in the above-mentioned contaminated soil is calculated by subtracting the residual concentration of PAEs in the contaminated soil in the experimental group / control group from the residual concentration of PAEs in the contaminated soil in the blank group, and then dividing the result by the residual concentration of PAEs in the contaminated soil in the blank group.

[0056] The PAEs degradation rate in the above lettuce samples was calculated by subtracting the PAEs residual concentration in the lettuce in the experimental group / control group from the PAEs residual concentration in the lettuce in the blank group, and then dividing the result by the PAEs residual concentration in the lettuce in the blank group.

[0057] The results of the contaminated soil test are as follows: Figure 7 As shown. Figure 7 It can be seen that after applying free and immobilized bacterial communities, the degradation rate of ∑PAEs in the soil increased with time. Among them, the degradation rate of ∑PAEs in the immobilized bacterial community increased rapidly, and after 40 days, the degradation rate of ∑PAEs was as high as 74.56%, which was significantly higher than that of the control group (30.41%). The results show that in the soil environment, the surface of biochar can provide a matrix for bacterial attachment, and its physical structure can provide a barrier for bacteria to avoid being affected by other environmental stresses, thereby helping bacteria maintain activity in complex soil environments. At the same time, biochar promotes contact between microorganisms and organic pollutants and increases the biodegradation rate. Therefore, biochar provides a more favorable remediation environment for immobilized microorganisms.

[0058] The results of the lettuce samples are as follows: Figure 8 As shown. Figure 8 It can be seen that after 40 days, the degradation rate of ∑PAEs in lettuce of the immobilized bacterial group reached 54.79%, indicating that the fixed composite bacterial group has a good degradation effect and can degrade most of the PAEs in lettuce. At the same time, during the culture period, the degradation rate of ∑PAEs in lettuce of the fixed bacterial group was higher than that of the control group, indicating that microbial immobilization technology can promote the biodegradation of organic pollutants in lettuce.

[0059] The various embodiments in this specification are described in a progressive manner, and the same or similar parts between the various embodiments can be referenced to each other, and each embodiment focuses on the differences from other embodiments.

[0060] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present application.

Claims

1. A method for preparing an immobilized composite bacterial community for degrading phthalates, characterized in that: include: Activates glutamicum, Gordonia, and Acinetobacter; The composite bacterial suspension is prepared by using activated glutamicum, Gordonia and Acinetobacter; The composite bacterial suspension and biochar are solidified to obtain an immobilized composite bacterial community; The 16S rRNA sequence of Bacillus glutamicum is shown in SEQ ID NO: 1, the 16S rRNA sequence of Gordonia spp. is shown in SEQ ID NO: 2, and the 16S rRNA sequence of Acinetobacter spp. is shown in SEQ ID NO:

3.

2. The method for preparing a phthalate-degrading immobilized composite bacterial community according to claim 1, characterized in that: The method of preparing a composite bacterial suspension using activated glutamicum bacteria, Gordonia and Acinetobacter comprises: After centrifuging the activated Bacillus glutamicum, Gordonia and Acinetobacter, the supernatant was discarded, and the cells were centrifuged again to obtain Bacillus glutamicum, Gordonia and Acinetobacter; Glutamibacillus cells, Gordonia cells and Acinetobacter cells are respectively prepared into bacterial suspensions using MSM liquid culture medium, and compounded in a volume ratio of 1-2:1-2:1 to obtain the composite bacterial suspension.

3. The method for preparing a phthalate-degrading immobilized composite bacterial community according to claim 2, characterized in that: The composite bacterial suspension and biochar are solidified to obtain an immobilized composite bacterial community, including: The composite bacterial suspension is mixed with biochar in a ratio of 5 ml to 15 ml: 1 g, cultured at a constant temperature with shaking, and then centrifuged multiple times to discard the supernatant to obtain an immobilized composite bacterial community.

4. The method for preparing an immobilized composite bacterial community for degrading phthalates according to claim 1, characterized in that: The activated Glutamibacillus, Gordonia and Acinetobacter species include: Glutamibacillus, Gordonia and Acinetobacter were inoculated into LB liquid culture medium respectively and cultured to logarithmic growth phase to obtain activated glutamic acid Bacillus, Gordonia and Acinetobacter.

5. The method for preparing an immobilized composite bacterial community for degrading phthalates according to claim 1, characterized in that: The preparation method of the biochar is: The poplar branches are dried, crushed, sieved, and then pyrolyzed to obtain the biochar.

6. An application of an immobilized composite bacterial community for degrading phthalates, the immobilized composite bacterial community prepared by the preparation method of an immobilized composite bacterial community for degrading phthalates according to any one of claims 1 to 5, characterized in that: The immobilized composite bacterial community is used to degrade phthalates in contaminated soil.

7. An application of an immobilized composite bacterial community for degrading phthalates, the immobilized composite bacterial community prepared by the preparation method of an immobilized composite bacterial community for degrading phthalates according to any one of claims 1 to 5, characterized in that: The immobilized composite bacterial community is used to degrade phthalates in plants.

8. An application of an immobilized composite bacterial community for degrading phthalates, the immobilized composite bacterial community prepared by the method for preparing an immobilized composite bacterial community for degrading phthalates according to any one of claims 1 to 5, characterized in that: The immobilized composite bacterial community is used to simultaneously degrade phthalates in contaminated soil and phthalates in plants.

Images