Application of PARPi sensitizer in treatment of malignant tumors

Abstract

The invention provides application of a PARPi sensitizer in treatment of malignant tumors, and particularly relates to the technical field of biological medicines. A large number of experiments prove that TRMT10A is crucial for recruitment from BRCA1 to DNA damage sites for the first time, so that HR repair is promoted. The deletion of TRMT10A inhibits HR repair, so that tumor cells are more sensitive to PARPi. The invention discloses that the expression of TRMT10A in mCRPC is up-regulated, and the TRMT10A is regulated and controlled by ubiquitin specific peptidase 10 (USP10). Spautin-1 significantly results in the deficiency of TRMT10A, and sensitizes the tumor to PARPi in both patient-derived xenograft (PDX) and cell-derived xenograft (CDX). The research reveals that the ATM-TRMT10A-BRCA1 axis plays an important role in sensibilization of the PARP inhibitor, and a new angle is provided for exploring synthesis lethality. The mechanism can be therapeutically utilized through the combination of PARPi and Spautin-1, which may benefit more extensive patients with non-BRCA malignant tumors, and has important clinical significance.

Description

Technical Field

[0001] The present invention belongs to the technical field of tumor treatment, and specifically relates to the use of a PARPi sensitizer in the treatment of malignant tumors. Background Art

[0002] Castration-resistant prostate cancer (mCRPC) is a deadly disease known for its aggressive nature and resistance to androgen-antagonist therapy. Poly(ADP-ribose) polymerase (PARP) inhibitors (PARPi) are particularly effective in homologous recombination (HR)-deficient cells, such as those lacking BRCA1 / 2. However, the utility of PARPi monotherapy is significantly limited, with only 10% to 15% of mCRPC patients with BRCA1 / 2 mutations achieving clinical benefit. Therefore, there is an urgent need to develop innovative treatment strategies for patients with non-BRCA-mutated mCRPC. Summary of the invention

[0003] The purpose of the present invention is to overcome the above-mentioned defects and shortcomings in the prior art and to provide a PARPi sensitizer for use in the treatment of malignant tumors.

[0004] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions.

[0005] The invention discloses a pharmaceutical composition, characterized in that the pharmaceutical composition comprises a ubiquitin-specific peptidase 10 inhibitor and a PARP inhibitor.

[0006] Furthermore, the ubiquitin-specific peptidase 10 inhibitor is Spautin-1; and the PARP inhibitor is Olaparib.

[0007] The present invention also discloses a pharmaceutical composition, characterized in that the pharmaceutical composition comprises a TRMT10A inhibitor and a PARP inhibitor.

[0008] Furthermore, the TRMT10A inhibitor is shRNA; the shRNA nucleotide sequence is as shown in SEQ ID No. 1~2; and the PARP inhibitor is olaparib.

[0009] The present invention also discloses an olaparib sensitizer, characterized in that it comprises an inhibitor of TRMT10A and ubiquitin-specific peptidase 10.

[0010] Furthermore, the TRMT10A inhibitor is shRNA; and the ubiquitin-specific peptidase 10 inhibitor is Spautin-1.

[0011] The invention also discloses the use of any of the above-mentioned pharmaceutical compositions or any of the above-mentioned sensitizers in the preparation of drugs for treating malignant tumors.

[0012] The invention also discloses the application of Spautin-1 in preparing medicine for treating malignant tumors.

[0013] Furthermore, the drug also includes Olaparib.

[0014] The present invention also discloses the use of a reagent for detecting the expression level of TRMT10A in the preparation of a product for auxiliary diagnosis of malignant tumors.

[0015] This paper first elucidates the key role of the ATM-TRMT10A-BRCA1 axis in mediating HR repair and enhancing the efficacy of PARPi in mCRPC. A large number of experiments have demonstrated that TRMT10A is essential for the recruitment of BRCA1 to DNA damage sites, thereby promoting HR repair. The loss of TRMT10A inhibits HR repair and makes tumor cells more sensitive to PARPi. It is revealed that TRMT10A expression is upregulated in mCRPC and is regulated by ubiquitin-specific peptidase 10 (USP10). Spautin-1 (a small molecule inhibitor of USP10) significantly leads to TRMT10A deficiency and sensitizes tumors to PARPi in patient-derived xenografts (PDX) and cell-derived xenografts (CDX). Our study reveals the important role of the ATM-TRMT10A-BRCA1 axis in PARP inhibitor sensitization and provides a new angle for exploring synthetic lethality. This mechanism can be therapeutically exploited by the combination of PARPi and Spautin-1, which may benefit a wider range of non-BRCA mCRPC patients.

[0016] Compared with the prior art, the beneficial effects of the present invention are as follows.

[0017] The present invention proposes for the first time that the loss of TRMT10A inhibits HR repair and makes tumor cells more sensitive to PARPi. In the case of BRCA1 non-mutation, the combined use of PARPi and Spautin-1 of the present invention is more superior than PARPi monotherapy. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1Expression of TRMT10A in prostate cancer patients. (A) Expression level of TRMT10A in cancerous and adjacent tissues of prostate cancer patients in the TCGA database. (B) TRMT10A levels in prostate cancer patients with different pathological tumor stages in the TCGA database. (C) RNA expression level of TRMT10A at different stages of prostate cancer disease progression in the GEO database. (D) Expression of TRMT10A in castration-resistant PCa patients in the GEO database. (E~F) Immunohistochemical analysis of TRMT10A expression in tissues of 54 patients with metastatic prostate cancer. (G) Analysis of the relationship between increased TRMT10A levels and overall survival (OS) of patients. (H) Correlation analysis of TRMT10A and HRR genes BRCA1, BRCA2, RAD51, and PALB2 in prostate cancer tumor tissues. (I) Correlation analysis of TRMT10A levels and olaparib drug sensitivity AUC in the DepMap database. (J) The changing trends of BRCA1 and BRCA2 in GSE189186 were compared with the TRMT10A gene levels after olaparib intervention.

[0019] Figure 2 TRMT10A is upregulated in mCRPC patients. (A) TRMT10A mRNA levels in paired prostate cancer samples and normal adjacent tissues from the TCGA database. (B) TRMT10A IHC scores of non-malignant and malignant specimens from 54 patients with metastatic prostate cancer. (C) TRMT10A IHC scores of different Gleason scores in 54 patients with metastatic prostate cancer. (D) Mutation frequencies of TRMT10A and other 14 known HRR genes in the SU2C / PCF 2019 cohort of mCRPC patients from the cobioportal database. (E) Mutation frequencies of TRMT10A in five prostate cancer cohorts from the cobioportal database. Data are presented as median and minimum-maximum range (BC), and P values ​​are presented as **** P < 0.0001, *** P < 0.001, and * P < 0.05. Statistical significance was determined using a two-tailed unpaired t-test (AC).

[0020] Figure 3Knockdown of TRMT10A inhibits BRCA1 recruitment to DNA damage sites. (AB) Knockdown of TRMT10A inhibits DNA damage clearance. Control or TRMT10A knockdown U2OS cells were not treated with IR or treated with IR (2 Gy), harvested at the indicated time points, stained with γ-H2AX antibody (red), and nuclei were stained with DAPI (blue). Representative images of γ-H2AX foci at different time points are shown in (A). Quantification data for calculating the number of foci per nucleus are shown in (B). (C) Schematic diagram of the DR-GFP / EJ5-GFP reporter system. (D) Relative DNA repair efficiency of control or TRMT10A knockdown cells. (EF) TRMT10A knockdown sensitizes U2OS cells to PARP inhibitors. U2OS cells were infected with lentivirus expressing control shRNA (shControl) or TRMT10A shRNA. Western blot shows knockdown efficiency (E). Cells were treated with different doses of olaparib, and cell survival was analyzed 14 days after olaparib treatment (F). (G) Schematic diagram of the recruitment of key DNA repair factors to DNA damage sites. (HO) Control and TRMT10A knockdown were treated with IR (1Gy). Cells were fixed 1 h later and immunostained with the indicated antibodies. Representative images and quantified focus numbers are shown for γ-H2AX (HI), 53BP1 (JK), BRCA1 (LM), and RAD51 (NO), respectively. (P) Schematic diagram showing that TRMT10A regulates DNA repair at the level of BRCA1.

[0021] Figure 4Loss of TRMT10A increases sensitivity to PARP inhibitors. (AB) Analysis of sensitivity of olaparib in different prostate cancer cells (22Rv1, DU145, and PC-3). Western blot was used to detect the expression level of TRMT10A protein in 22Rv1, DU145, and PC-3 cells (A). 22Rv1, DU145, and PC-3 cells were treated with olaparib for 14 days, and cell survival was analyzed by clone formation assay (B). (CH) Knockdown of TRMT10A increases the sensitivity of cells to olaparib. 22Rv1, DU145, and C4-2 cells infected with shRNA-expressing lentivirus were treated with different doses of olaparib, and the cell survival rates of 22Rv1 (CD), DU145 (EF), and C4-2 (GH) were analyzed. (IJ) Overexpression of TRMT10A reduces the sensitivity of cells to olaparib. PC-3 cells expressing vector and TRMT10A WT were treated with olaparib for 14 days. TRMT10A overexpression was detected by western blot (I), surviving colonies were counted, and cell survival was analyzed (J). (KN) TRMT10A affects the sensitivity of PARPi in the CDX model. Control or TRMT10A knockdown DU145 cells (7×10 6 ) was injected subcutaneously into the right side of BALB / c nude mice. When the tumor volume reached 150mm 3 At 4 pm, the mice were randomly divided into groups and treated with vehicle and olaparib (50 mg / kg) for 5 consecutive days per week. The tumor volume was examined every 5 days, and the tumor was removed to compare the tumor size on day 45 (K). The growth curve (L), tumor weight (M), and tumor photos (N) are shown respectively (N=5 per group). Data are expressed as mean±SEM (B, D, F, H, J, L, M), and P values ​​are expressed as ****P<0.0001. **P<0.01, P<0.05. Statistical significance was determined by two-tailed unpaired t-test (B, D, F, H, J, L, M). The experiment was repeated 3 times independently with similar results; a representative experimental data is shown in Figures A, C, E, G, and I.

[0022] Figure 5 TRMT10A gene knockout increases sensitivity to PARPis in vivo. (A)-(D) Figure 4Samples in N were subjected to IHC with the indicated antibodies. Representative images of H&E, Ki-67, Caspase-3, and γ-H2AX staining are shown in (A). Scale bar in 400x field of view: 50 μm. Quantification of Ki-67 (B), Caspase-3 (C), and γ-H2AX (D) staining are shown in the figures, respectively. Statistical analysis was performed using Student's t-test. (E) Body weight curves of DU145 CDX model showed no significant difference between control and TRMT10A knockout CDX models. Data are shown as mean ± SEM (BE), and P values ​​are indicated as ****P < 0.0001, ***P < 0.001. ns indicates no significant change. Statistical significance was determined by two-tailed unpaired t-test (BE).

[0023] Figure 6 Spautin-1 treatment leads to TRMT10A degradation and HR inhibition. (A) Western blot was performed after C4-2 cells were treated with Spautin-1 (0μM, 4μM and 8μM) for 48 hours. (B~G) C4-2 cells were treated with Spautin-1 (0μM, 4μM and 8μM) for 48 hours and then irradiated with IR 1Gy for immunofluorescence. Representative images and quantitative data of focus numbers of γ-H2AX (BC), BRCA1 (DE) and RAD51 (FG). (H) C4-2 cells were treated with different concentrations of olaparib and Spautin-1 for 10 days. The number of colonies formed was counted and the survival rate was calculated. (I) Relative DNA repair efficiency of C4-2 cells after treatment with different doses of Spautin-1 for 24 hours. (JM) Immunohistochemistry was used to detect Figure 7 Antibodies in n. Representative images of H&E, Ki-67, Cleaved Caspase-3, and γ-H2AX staining are shown in (J). Ki-67 (K), Cleaved Caspase-3 (L), and γ-H2AX (M) were quantified. (N) The body weight curves of CDX22Rv1 showed no significant differences among the four treatments. The average number of cells per treatment was calculated (C, E, G), and more than 100 cells were obtained from three biological replicates. Scale bar, 10 µm. Data are presented as mean ± SEM (C, E, G, H, I, K, L, M, N), and P values ​​are presented as ****P < 0.0001. **P < 0.01, *P < 0.05, ns indicates no significant change. Statistical significance was determined by two-tailed unpaired t-test (C, E, G, H, I, K, L, M, N).

[0024] Figure 7Treatment with the USP10 inhibitor Spautin-1 leads to TRMT10A degradation and HR inhibition. (A) 22Rv1 cells were treated with Spautin-1 (0 μM, 4 μM, and 8 μM) for 48 h. Cells were extracted and western blotted with the indicated antibodies. (B) Relative DNA repair efficiency of HEK293T cells after treatment with different doses of Spautin-1 for 24 h. (CH) 22Rv1 cells were treated with Spautin-1 (0 μM, 4 μM, and 8 μM) for 48 h and exposed to IR 1 Gy. After 1 h, cells were fixed and followed by immunofluorescence. Representative images and quantitative data of γ-H2AX (CD), BRCA1 (EF), and RAD51 (GH) foci. (IJ) 22Rv1 cells were treated with different concentrations of olaparib and Spautin-1 for 10 d, and the number of colonies formed was counted. The survival rate (I) and inhibition rate (J) were calculated. (K~N) Spautin-1 increases the sensitivity of PARPi in the 22Rv1-derived cdx model. 22Rv1 cells (1×10 7 ) was injected subcutaneously into the right side of BALB / c nude mice. When the tumor volume reached 150mm 3 At 4 pm, the mice were randomly divided into groups and treated with vehicle (50 mg / kg), olaparib (50 mg / kg), and spautin-1 (8 mg / kg) for 5 consecutive days per week. Tumor volume was examined every 3 days, and tumors were harvested on day 29 (K). Growth curves (L), tumor weights (M), and tumor photos (N) are shown, respectively (N = 5 per group). Data are presented as mean ± SEM (B, D, F, H, I, J, L, M), and P values ​​are indicated, ****P < 0.0001. **P < 0.01, *P < 0.05, ns indicates no significant change. Statistical significance was determined by two-tailed unpaired t-test (B, D, F, H, I, J, L, M). The experiments were repeated three times independently with similar results; data from a representative experiment are shown in Figures A to J. The average number of cells per cell (D, F, H) was calculated, and more than 100 cells were included in 3 biological replicates. Scale bar, 10 µm.

[0025] Figure 8PARPi and Spautin-1 combined to inhibit tumor growth in mCRPC PDX. (AB) PDX models of 4 patients with mCRPC. Tumor tissues of PDX generation 1 or 2 (p1 or P2) were collected for TRMT10A and USP10 IHC detection. PDX#546 and #1092 with high expression of TRMT10A were selected for further experiments. P3 NOD SCID mice were treated intraperitoneally with drug loading, olaparib, and spautin-1. (A) Schematic diagram. (B) Expression of TRMT10A and USP10 in 4 IHC PDX models. (CE) Freshly resected PDX#546 tumor tissue was subcutaneously transplanted into 5-week-old male NOD SCID mice. When the tumor volume reached 150mm 3 At 4 pm, the patients were randomly divided into two groups and treated with vehicle, olaparib (50 mg / kg), and spautin-1 (8 mg / kg) for 5 consecutive days per week, as shown in (A). The tumor volume was examined every 3 days, and the tumor was removed on day 29 to compare the tumor size. The growth curve (C), tumor weight (D), and tumor photos (E) are shown, respectively (n = 5 in each group). (FH) PDX#1092 was treated as PDX#546 in (CE). The tumor volume was examined every 3 days, and the tumor was removed on day 29 to compare the tumor size. The growth curve (C), tumor weight (D), and tumor photos (E) are shown, respectively (n = 5 in each group). Data are expressed as mean ± SEM (CD, FG), with P values, ***P < 0.001. **P < 0.01, *P < 0.05, and the differences were statistically significant by two-tailed unpaired t test (CD, FG).

[0026] Fig. 9 The combination of PARPi and Spautin-1 synergistically inhibits tumor growth in mCRPC PDX. (A)-(D) Figure 8 Samples in E were subjected to IHC with the indicated antibodies. Representative images of H&E, Ki-67, cleaved Caspase-3, and γ-H2AX (A), and quantification of Ki-67 (B), cleaved Caspase-3 (C), and γ-H2AX (D) staining are shown, respectively. (E) Collection Figure 8 Tumor samples in E were subjected to Western blotting with the indicated antibodies. (F) Body weight curves of PDX#546 showed no significant differences among the four treatments. (GJ) Figure 8 The samples in H were subjected to IHC staining. Representative images of H&E, Ki-67, cleaved Caspase-3, and γ-H2AX staining (G) and quantification of Ki-67 (H), cleaved Caspase-3 (I), and γ-H2AX (J) staining are shown, respectively. (K) Figure 8Tumor samples in H were subjected to Western blotting with the indicated antibodies. (L) Body weight curves of PDX#1092 showed no significant differences between the four treatments. Data are presented as mean ± SEM (BD, F, HJ, L), P values ​​are presented, ***P < 0.001. **P < 0.01, *P < 0.05, ns indicates no significant change. Statistical significance was determined by two-tailed unpaired t-test (BD, F, HJ, L). DETAILED DESCRIPTION

[0027] The present invention is further described in detail below with specific embodiments, but it should not be understood that the scope of the above subject matter of the present invention is limited to the following embodiments, and all technologies realized based on the content of the present invention belong to the scope of the present invention.

[0028] Unless otherwise specified, all reagents and materials used in the present invention are commercially available.

[0029] 1. Reagents.

[0030] Chemical reagents such as Olaparib (MCE, HY-10162), cycloheximide (CHX, MCE, HY-12320), MG132 (MCE, HY-13259), and spautin-1 (TargetMol, T1937) were purchased from designated suppliers. TRMT10A antibody (1:1000) for Western Blot was purchased from Proteintech (17294-1-AP). Other antibodies were used at the indicated dilutions: USP10 (CST, #5553, 1:1000), GAPDH (Proteintech, 60004-1-Ig), FLAG (Sigma, F1804, 1:1000), HA (CST, #3724, 1:1000), KU55933 (Sigma, SML1109, 1:1000), Cleaved-caspase3 (CST, #9664, 1:1000), Cleaved PARP (CST, #9541, 1:1000), γ-H2AX (Sigma, 05-636, 1:1000), Ki-67 (abcam, ab15580, 1:1000).

[0031] 2. Methods

[0032] 1. HR and NHEJ experiments.

[0033] The DR-GFP / EJ5-GFP reporter system was used to detect the efficiency of HR and NHEJ repair. HEK293T cells stably expressing shRNA were cultured at 3 × 10 5The cells were seeded into six-well plates at a density of 100 cells / mL. After 24 hours, 500 ng DR-GFP or 500 ng EJ5-GFP plasmids, 150 ng mCherry and 500 ng I-Sce1 were added, and 1.0 μL Lipofectamine 2000 was added to each well for cell transfection. After 48 hours, the cells were collected and analyzed by flow cytometry (FACS). At least 30,000 cells were counted, and the experiment was repeated three times.

[0034] shTRMT10A#1:TTGATCACTTGATGTATTAA (SEQ ID No. 1).

[0035] shTRMT10A#2:GAGGAGGAATATAGCAGAAAT (SEQ ID No. 2).

[0036] 2. Immunofluorescence quantification.

[0037] U2OS cells were seeded into 24-well plates 24 h before IR treatment (1 Gy). For staining, cells were washed twice with PBS and then fixed with 4% PFA and fixed in 0.5% Triton-X-100 solution for 10 min at room temperature. Then, they were blocked with 5% goat serum for 1 h and incubated with specific antibodies at 4 °C overnight. After washing three times with TBST, cells were incubated with secondary antibodies for 1 h at room temperature. After washing three times with TBST, cells were incubated with DAPI for 1 min. After washing with PBS, cells were placed under a microscope for observation. IRIF was quantified by Image-J software. To standardize the counts and density, 10 fields of view were randomly selected for each cell line, and each group contained more than 100 cells.

[0038] 3. Co-immunoprecipitation (Co-IP).

[0039] For co-immunoprecipitation experiments, HEK293T cells were transiently transfected with FLAG-tagged TRMT10A or HA-tagged BRCA1 plasmids. Transfected cells were lysed with NETN buffer (20 mM Tris-HCl, pH 8.0, 1 mM EDTA, 100 mM NaCl, and 0.5% Nonidet P-40) containing 50 mM β-glycerophosphate, 10 mM NaF, and aprotinin. After incubation on ice for 20 min, whole cell lysates were centrifuged at 12,000 g for 30 min, and the soluble fractions were collected and incubated with HA / FLAG at 4°C for 2 to 4 h. Then, the cells were washed at least 6 times with NETN buffer, boiled in 1× SDS buffer for 5 min, and then subjected to Western Blot analysis.

[0040] 4. Western Blot.

[0041] Cells were collected and lysed in pre-cooled NP-40 lysis buffer (50 mM tris, 150 mM NaCl, and 1.0% NP-40, pH 8.0). Protein concentration was determined using a BCA protein quantification kit. Protein samples were electrophoresed in 6.0% to 12.0% SDS-PAGE gels and then transferred to PVDF membranes. The membranes were then blocked with 5% milk and incubated with the designated antibodies overnight at 4 °C. After incubation with secondary antibodies for 1 h at room temperature, protein bands were detected by chemiluminescence.

[0042] 5. Cell colony formation assay.

[0043] Cells were seeded in triplicate at a density of 1000-2000 cells / well in six-well plates. For drug sensitivity testing, cells were exposed to the indicated concentrations of olaparib / spautin-1. After 10-14 days, clones were fixed and stained with crystal violet. Cells were counted and analyzed.

[0044] 6. Radiation.

[0045] Cells were irradiated with 1Gy and 2Gy for immunofluorescence detection, and 10Gy for Western Blot and immunoprecipitation detection. Usually, cells were collected 1 hour after irradiation for subsequent related experiments.

[0046] 7. CDX Tumor Model.

[0047] Animal experiments were approved by the Animal Experiment Ethics Committee of the Cancer Hospital, Chinese Academy of Medical Sciences. DU145, shCtrl, and shTRMT10A were injected subcutaneously into the abdomen of 4-week-old BALB / c nude male mice. 22Rv1 cells were injected subcutaneously into the abdomen of 4-week-old BALB / c nude male mice. The above CDX tumor model mice were given control or olaparib (50 mg / kg) or spautin-1 (8 mg / kg) or combination therapy for 5 days a week. The mice were monitored for tumor growth and overall health. After the treatment, the mice were euthanized and the tumor weights were measured.

[0048] 8. Patient-derived xenografts (PDXs).

[0049] The collection of prostate cancer specimens was approved by the Institutional Review Board of the Affiliated People's Hospital of Nanchang University (NO.2021012). A total of four patient tumor samples (#546, #1092, #1102, and #1267) were collected. Fresh tumor tissue (2×2×2 mm 3) was injected subcutaneously into 5-week-old male NOD SCID mice. The mice were monitored for tumor growth every three days. When the tumor reached 2 cm in diameter, the tumor was aseptically harvested and re-implanted into new mice. The initial tumor-bearing mice were referred to as "generation 0" (P0). The P3 generation #546 and #1092 PDX models were used. When the tumor reached 150 mm 3 The mice were randomly divided into several groups for treatment. The mice were intraperitoneally injected with control or olaparib (50 mg / kg) or spautin-1 (8 mg / kg) or combined treatment for 5 consecutive days per week. The tumor volume of the mice was measured every three days and recorded using the formula: 0.5×length×width 2 .

[0050] 9. Bioinformatics analysis.

[0051] TRMT10A gene expression in prostate cancer and corresponding clinical information were obtained from the Cancer Genome Atlas (TCGA) project (https: / / portal.gdc.cancer.gov). The counts of differentially expressed TRMT10A in prostate and prostate cancer tissues were obtained from the GEO database, with accession numbers GSE6099 and GSE28680, respectively. In addition, a CRISPR-Cas9 gene knockout screening PARPi response gene dataset was obtained from GSE189186. Unpaired Student's t-test was used for differential expression analysis. Olaparib drug sensitivity AUC and TRMT10A mRNA expression in a series of cell lines can be downloaded from the DepMap database (https: / / depmap.org / portal / ).

[0052] 10.Chart generation and statistical analysis.

[0053] Cell viability and detection data are presented as mean ± SEM of three replicates, and CDXs and PDXs xenograft study data are presented as mean ± SEM of 5 mice. These statistical analyses were performed using GraphPad Prism version 9.4. The differences between the two groups were analyzed using an unpaired Student's t-test. Kaplan-Meier curves for OS were drawn according to TRMT10AIHC staining scores and analyzed using the Log-rank test.

[0054] 2. Experimental results.

[0055] 1. TRMT10A is significantly upregulated in prostate cancer patients and correlates with response to poly(ADP-ribose) polymerase inhibitors (PARPi).

[0056] This study was approved by the Ethics Committee of the First Affiliated Hospital of Xinjiang Medical University (approval number: K202311-45), and informed consent was obtained from all patients. A total of 54 prostate cancers and 30 corresponding adjacent non-cancerous tissues were paraffin-embedded specimens from patients with metastatic prostate cancer. Immunohistochemistry (including IHC): incubation with antibodies (TRMT10A 1:200 dilution; USP10 1:200 dilution; Ki67 1:1000 dilution; cleaved Caspase-3 1:20 00 dilution; γ-H2AX 1:20 00 dilution) was performed by standard immunohistology-chemistry procedures. The IHC staining score was calculated based on the percentage of positive cells and staining intensity, and the score was evaluated by two independent experts under the same conditions. The staining intensity was defined as follows: negative = 0: no staining detected; weak = 1: slight staining, almost invisible; intermediate = 2: moderate staining, clearly visible; strong = 3: obvious strong staining. The percentage of positive cells was defined as follows: <5% = 0; 5-25% = 1; 26-50% = 2; 51-75% = 3; 76-100% = 4. The final score = staining area score x staining intensity score.

[0057] like Figure 1 As shown, by analyzing the TCGA database, it was found that the expression of TRMT10A in prostate cancer tumors was higher than that in normal tissues ( Figure 1 A). Similar results were observed in paired samples ( Figure 2 A). In addition, we compared the TRMT10A levels in patients with different pathological tumor stages and found that in prostate cancer patients, the expression of TRMT10A increased with the severity of tumor stage ( Figure 1 B). We also investigated the TRMT10A RNA profile in the GEO database. Figure 1 As shown in C, in the dataset GSE6099, the level of TRMT10A was significantly increased in patients with metastatic prostate cancer. Importantly, we found from the GEO database that the expression of TRMT10A was significantly increased in patients with castration-resistant PCa ( Figure 1 D). The above experiments showed that TRMT10A is highly expressed in advanced prostate cancer.

[0058] We measured the TRMT10A protein level in 54 patients by immunohistochemistry (IHC). TRMT10A is mainly nuclear and expressed higher in malignant tissues than in non-malignant tissues ( Figure 1 C~F, Figure 2 B). In addition, patients with Gleason scores of 8-10 had stronger TRMT10A staining than those with Gleason scores of 6-7 ( Figure 2C). The overall survival (OS) of patients with elevated TRMT10A levels was significantly shortened ( Figure 1 G, P=0.014). In addition, genomic alteration analysis showed that TRMT10A was mutated in mCRPC patients, with mutation rates ranging from 1.22% to 5.26% in multiple cohorts ( Figure 2 DE). Taken together, these data suggest that TRMT10A expression is associated with more aggressive clinical features and worse prognostic outcomes in prostate cancer patients.

[0059] We found that TRMT10A was positively correlated with HRR genes such as BRCA1, BRCA2, RAD51, and PALB2 in tumor tissues ( Figure 1 H). In addition, we noticed that in the DepMap database, TRMT10A levels were negatively correlated with olaparib drug sensitivity AUC (r=-0.471, P=0.042) ( Figure 1 I). In addition, genome-wide CRISPR-Cas9 knockout of exon 32 showed that the TRMT10A gene level was significantly reduced after olaparib intervention, which was consistent with the change trend of BRCA1 and BRCA2 in GSE189186 ( Figure 1 J). Taken together, these data preliminarily suggest that TRMT10A expression may be associated with PARPi response.

[0060] 2. Knockdown of TRMT10A affects BRCA1 recruitment and HR repair.

[0061] Given that TRMT10A contributes to susceptibility to PARPis, we hypothesized that TRMT10A might regulate PARPis sensitivity by affecting DNA repair processes. To evaluate this hypothesis, we first assessed the dynamic clearance of γ-H2AX after irradiation (IR). γ-H2AX in control cells almost disappeared 8 h after IR, whereas γ-H2AX in TRMT10A knockout cells persisted 8 h after IR ( Figure 3 AB). Notably, the amount of γ-H2AX after IR was not affected by TRMT10A knockdown ( Figure 3 AB). These results indicate that TRMT10A knockout impairs DSB repair. In addition, we established a stable TRMT10A knockout cell line and used the DR-GFP / EJ5-GFP reporter system to assess the DSB repair effect ( Figure 3 C). Knockout of TRMT10A significantly inhibited HR repair but did not inhibit NHEJ ( Figure 3 D). Furthermore, knockout of TRMT10A enhanced their response to PARPi ( Figure 3 EF). In summary, the above experiments indicate that TRMT10A regulates HR repair.

[0062] The HR repair process involves the recruitment of multiple important factors to the DNA damage site, including MDC1, RNF8, RNF168, BRCA1, and RAD51 ( Figure 3 G). We explored whether TRMT10A affects the recruitment of key HR proteins to DNA damage sites by knocking down TRMT10A in U2OS cells. There was no obvious change in the formation of γ-H2AX and 53BP1 in control cells and knockdown cells ( Figure 3 HK). Notably, the formation of BRCA1 and RAD51 was significantly reduced in TRMT10A knockout cells ( Figure 3 LO). The above experiments indicate that TRMT10A regulates HR at the BRCA1 level ( Figure 3 P).

[0063] 3. TRMT10A affects the sensitivity of prostate cancer to PARP inhibitors.

[0064] To verify the relationship between TRMT10A and PARPi response, we examined the TRMT10A levels and PARPi sensitivity of different prostate cancer cell lines and observed that PC-3 and DU145 cells with lower TRMT10A expression were more sensitive to olaparib compared with 22Rv1 ( Figure 4 AB). In addition, knockdown of TRMT10A in 22Rv1, DU145, and C4-2 cell lines enhanced the responsiveness of cells to treatment with the PARPi olaparib ( Figure 4 CH). In contrast, overexpression of TRMT10A in PC-3 cells reduced the sensitivity of cells to the PAPRi olaparib ( Figure 4 IJ). To further demonstrate this in vivo, we injected DU145 cells expressing shCtrl or shTRMT10A subcutaneously into BALB / c nude mice to generate xenograft tumors ( Figure 4 K). After these mice were treated with olaparib, tumor growth was significantly delayed in the TRMT10A-deficient group compared with the control group ( Figure 4 LN). Immunohistochemistry showed that the Ki-67 level in the TRMT10A knockout group was significantly lower than that in the control group, while the Caspase-3 and γ-H2AX levels were higher than those in the control group ( Figure 5 AD), indicating enhanced antitumor activity. It is worth noting that there was no significant change in body weight among the groups ( Figure 5 E). These data demonstrate that deficiency of TRMT10A sensitizes prostate cancer cells to olaparib in vitro and in vivo.

[0065] 4. USP10 inhibitor Spautin-1 leads to TRMT10A degradation and HR repair.

[0066] Given that TRMT10A is regulated by USP10, we further examined whether the USP10 inhibitor (Spautin-1) would lead to TRMT10A degradation. To this end, we treated 22Rv1 and C4-2 cells with different concentrations of Spautin-1 for 48 hours. A significant decrease in TRMT10A protein levels was observed, indicating that TRMT10A was inhibited by Spautin-1 ( Figure 7 A, Figure 6 A). We then evaluated the effect of USP10 inhibition on the DNA repair process. Under spautin-1 treatment, HR repair efficiency was significantly reduced ( Figure 7 B). In addition, the formation of BRCA1 and RAD51 was significantly reduced in cells treated with spautin-1, while γ-H2AX was not affected ( Figure 7 CH, Figure 6 BG). Together, these results suggest that Spautin-1 can pharmacologically promote TRMT10A degradation and inhibit HR repair. Since Spautin-1 inhibits HR repair, we hypothesized that Spautin-1 treatment might increase the sensitivity of cells to PARPi. To verify this, we treated 22Rv1 and C4-2 cells with different concentrations of olaparib and Spautin-1 and detected colony formation efficiency. Figure 7 IJ and Figure 6 As shown in HI, the colony formation rate in the combined treatment group was significantly reduced compared with the control group. The above experiments confirmed the synergistic effect of Olaparib and Spautin-1 in improving the therapeutic effect of cancer.

[0067] To further demonstrate the synergistic effect of Olaparib and Spautin-1 in vivo, we injected 22Rv1 cells subcutaneously into BALB / c nude mice to generate xenograft tumors ( Figure 7 K). By treating mice with vehicle, olaparib, spautin-1, and combination therapy, we confirmed that tumor growth was significantly delayed in the combination therapy group compared with the olaparib monotherapy group ( Figure 7 LN). Figure 7 As shown in JM, in the combined treatment group, the Ki67 level was significantly decreased, but the expression of Caspase-3 and γ-H2AX was increased.

[0068] 5. Patient-derived tumor xenografts (PDXs) are key preclinical models for evaluating drug response and efficacy. Therefore, we evaluated the synergistic effects of olaparib and spautin-1 on PDX models with elevated TRMT10A expression from four patients with metastatic castration-resistant prostate cancer (mCRPC) ( Figure 8 A). Specifically, we selected PDX models #546 and #1092 with high expression levels of TRMT10A and USP10 for further study ( Figure 8 B). In the PDX#546 model, the combination of Olaparib and Spautin-1 significantly inhibited tumor growth and reduced tumor weight compared with Olaparib alone ( Figure 8 CE). Immunohistochemical analysis showed that the Ki-67 level in the combined treatment group was significantly lower than that in the olaparib group alone, while the cleaved Caspase-3 and γ-H2AX levels were higher than those in the olaparib group alone ( Fig. 9 AD). Western blot analysis of tumor tissues also showed that the levels of cleaved Caspase-3, cleaved PARP, and γ-H2AX were increased in the combined treatment group ( Fig. 9 E). These results suggest that the combination therapy enhanced antitumor activity. Notably, there was no significant change in body weight between the groups, suggesting that the combination therapy was well tolerated ( Fig. 9 F). These effects were replicated in the PDX#1092 model, where the combination therapy reduced tumor volume by 42.9% compared to olaparib alone ( Figure 8 FH). Further immunohistochemistry and Western blot evaluation revealed similar enhancement of apoptosis and DNA damage markers ( Fig. 9 GK), there was no significant difference in body weight between the groups ( Fig. 9 L). In conclusion, the combination of Olaparib and Spautin-1 can significantly enhance the anti-tumor effect, verifying the potential of this combination therapy.

[0069] In summary, the present invention discloses for the first time that TRMT10A is upregulated in mCRPC, and targeting USP10 through Spautin-1 can inhibit the expression of TRMT10A and induce homologous recombination deficiency (HRD). The combination of PARPi and Spautin-1 can effectively delay tumor growth in patient-derived xenograft (PDX) and cell-derived xenograft (CDX) models.

[0070] The above description is only a preferred embodiment of the present invention and is not intended to limit the scope of the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A pharmaceutical composition, characterized in that The pharmaceutical composition comprises a ubiquitin-specific peptidase 10 inhibitor and a PARP inhibitor.

2. The pharmaceutical composition according to claim 1, characterized in that The ubiquitin-specific peptidase 10 inhibitor is Spautin-1; the PARP inhibitor is Olaparib.

3. A pharmaceutical composition, characterized in that The pharmaceutical composition comprises an inhibitor of TRMT10A and a PARP inhibitor.

4. The pharmaceutical composition according to claim 3, characterized in that The TRMT10A inhibitor is shRNA; the shRNA nucleotide sequence is shown in SEQ ID No. 1-2; and the PARP inhibitor is olaparib.

5. An olaparib sensitizer, characterized in that: Contains inhibitors of TRMT10A and ubiquitin-specific peptidase 10.

6. The sensitizer according to claim 5, characterized in that The TRMT10A inhibitor is shRNA; the ubiquitin-specific peptidase 10 inhibitor is Spautin-1.

7. Use of the pharmaceutical composition according to any one of claims 1 to 4 or the sensitizer according to any one of claims 5 to 6 in the preparation of a medicament for treating malignant tumors.

8. Application of Spautin-1 in the preparation of drugs for treating malignant tumors.

9. The use according to claim 7, characterized in that The drugs also include Olaparib.

10. Application of reagents for detecting TRMT10A expression levels in the preparation of auxiliary diagnostic products for malignant tumors.

Images