P-hydroxybenzoic acid hydroxylase gene and application thereof

Abstract

The invention discloses a p-hydroxybenzoic acid hydroxylase gene pobAr and application thereof. The nucleotide sequence of the p-hydroxybenzoic acid hydroxylase gene pobAr is shown as SEQ ID NO.1, and the amino acid sequence of p-hydroxybenzoic acid hydroxylase obtained from the p-hydroxybenzoic acid hydroxylase gene pobAr is shown as SEQ ID NO.2. The invention further discloses a preparation method of the p-hydroxybenzoic acid hydroxylase gene pobAr. According to the invention, a gallic acid production strain escherichia coli W3110 / pACYC177-aroF-pobA is marked as SDL-5 as a female parent, a brand new p-hydroxybenzoic acid hydroxylase gene, marked as pobAr, is provided, the original pobA gene in a plasmid is replaced by the modified gene, and a plasmid pACYC177-aroF-pobAr is constructed. The plasmid is introduced into escherichia coli W3110 to construct a strain SDL-6. Compared with SDL-5, the strain SDL-6 has the advantage that the gallic acid yield is increased by 87.5%. The method is suitable for gallic acid synthesis and has potential industrial application value.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to a p-hydroxybenzoate hydroxylase gene and application thereof. Background Art

[0002] Gallic acid is a natural phenolic acid with many remarkable biological properties such as antioxidant, antibacterial and anti-aging. Therefore, it is widely used as an additive in the production of animal and vegetable oils, milk powder, fish products, bread and other foods. In recent years, the gene encoding 3-deoxy-D-arabinoheptulose-7-phosphate (DAHP) synthase (AroF) aroF and the gene encoding p-hydroxybenzoate hydroxylase (PobA) from Pseudomonas aeruginosa PAO1 were expressed in Escherichia coli through genetic engineering to achieve the synthesis of gallic acid.

[0003] However, wild PobA has good catalytic activity for its natural substrate 4-hydroxybenzoic acid (4-HBA), which can catalyze 4-HBA to produce 3,4-dihydroxybenzoic acid (3,4-DHBA), but its further catalytic activity of 3,4-DHBA to produce gallic acid is almost zero, which seriously limits the production of gallic acid synthesized by E. coli. Therefore, the discovery of PobA with higher catalytic activity for both 4-HBA and 3,4-DHBA and better properties has potential industrial application value in gallic acid production. Summary of the invention

[0004] Purpose of the invention: In view of the problems existing in the prior art, the first purpose of the present invention is to provide a p-hydroxybenzoate hydroxylase gene pobA r The second object of the present invention is to provide a p-hydroxybenzoate hydroxylase gene pobA r The third object of the present invention is to provide a p-hydroxybenzoate hydroxylase gene pobA r Pob r The fourth object of the present invention is to provide a method containing the p-hydroxybenzoate hydroxylase gene pobA r The fifth object of the present invention is to provide a recombinant vector containing the p-hydroxybenzoate hydroxylase gene pobA r or containing the p-hydroxybenzoate hydroxylase gene pobA r The sixth object of the present invention is to provide a recombinant organism containing a recombinant vector. r , the p-hydroxybenzoate hydroxylase gene pobA r The expression protein of p-hydroxybenzoate hydroxylase gene pobA rA derivative protein of the expressed protein, containing the p-hydroxybenzoate hydroxylase gene pobA r or a recombinant vector containing the p-hydroxybenzoate hydroxylase gene pobA r Or the recombinant organism containing the recombinant vector of the p-hydroxybenzoate hydroxylase gene is used in the synthesis of gallic acid.

[0005] Technical solution: In order to achieve the above-mentioned purpose, the present invention provides a p-hydroxybenzoate hydroxylase gene, the nucleotide sequence of the p-hydroxybenzoate hydroxylase gene is shown in SEQ ID NO.1.

[0006] Furthermore, the p-hydroxybenzoate hydroxylase gene pobA r The method comprises the following steps: amplifying the p-hydroxybenzoate hydroxylase gene pobA by using a primer pair with amino acid sequences as shown in SEQ ID NO.3 and SEQ ID NO.4 by a PCR method, and then constructing a recombinant bacterium SDL-5 for transformation and synthesis.

[0007] A p-hydroxybenzoate hydroxylase gene pobA of the present invention r The expressed protein has an amino acid sequence as shown in SEQ ID NO.2.

[0008] A derivative protein of an expressed protein, wherein the derivative protein of the expressed protein is the p-hydroxybenzoate hydroxylase gene pobA of the present invention. r A derivative protein formed by replacing one or more amino acid residues in the expressed protein.

[0009] A method containing the p-hydroxybenzoate hydroxylase gene pobA of the present invention r of the recombinant vector.

[0010] A method containing the p-hydroxybenzoate hydroxylase gene pobA of the present invention r or containing the p-hydroxybenzoate hydroxylase gene pobA of the present invention r A recombinant organism containing a recombinant vector.

[0011] Furthermore, the recombinant organism is a strain.

[0012] The p-hydroxybenzoate hydroxylase gene pobA of the present invention r Or the p-hydroxybenzoate hydroxylase gene pobA of the present invention r Application of the expressed protein in the synthesis of gallic acid.

[0013] Application of the derivative protein of the expression protein of the present invention or the recombinant vector of the present invention in the synthesis of gallic acid.

[0014] The invention relates to the use of the recombinant organism in the synthesis of gallic acid.

[0015] The present invention uses a conservative sequence in the Pseudomonas aeruginosa PAO1 parahydroxybenzoate hydroxylase sequence as a skeleton through database comparison, selects a non-conservative sequence in the amino acid sequence as a potential modification site, selects a suitable site according to the simulated three-dimensional structure, optimizes the charge interaction within the enzyme, and further optimizes the enzyme active center, thereby obtaining a hydroxybenzoate hydroxylase with better properties. The efficiency of the hydroxybenzoate hydroxylase in synthesizing gallic acid is improved.

[0016] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages:

[0017] (1) A novel p-hydroxybenzoate hydroxylase gene pobA provided by the present invention r The protein mutant expressed by the modified gene has higher efficiency in catalyzing the synthesis of gallic acid.

[0018] (2) The present invention uses the gallic acid producing strain Escherichia coli W3110 (carrying the plasmid pACYC177-aroF-pobA) denoted as SDL-5 as the parent, and provides a new p-hydroxybenzoate hydroxylase gene pobA r The modified gene replaces the original p-hydroxybenzoate hydroxylase gene pobA in the plasmid pACYC177-aroF-pobA to construct the plasmid pACYC177-aroF-pobA r The recombinant plasmid was introduced into the starting strain Escherichia coli W3110 to construct the strain SDL-6. The strain SDL-6 constructed by the above method can significantly increase the gallic acid production by 87.5%, and has potential industrial application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 It is the gallic acid synthesis pathway of Escherichia coli;

[0020] Figure 2 is the pACYC177-aroF-pobA plasmid map;

[0021] Figure 3 is the graph of gallic acid content in shake flask fermentation of strain SDL-6 and control SDL-5; DETAILED DESCRIPTION

[0022] The present invention will be further described below in conjunction with the embodiments and drawings.

[0023] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0024] Example 1 Construction of expression vector pACYC177-aroF-pobA and recombinant bacteria SDL-5

[0025] Using the gene sequence (SEQID NO.5) of pACYC177 plasmid (purchased from China Center for Type Culture Collection, catalog number: TS153556) as a template, amplification primers P1 and P2 were designed, and PCR amplification was performed to obtain the pACYC177 plasmid backbone fragment pACYC. PCR reaction system: 1μL pACYC177 plasmid DNA, 1μL P1, 1μL P2, 9.5μL ddH2O, 12.5μL prime STAR HSDNA Polymerase. PCR reaction conditions: 94℃ pre-denaturation for 5min; 94℃ denaturation for 30sec, 55℃ annealing for 30sec, 72℃ extension for 4min, 35cycles; 72℃ extension for 10min; 12℃ insulation.

[0026] Using the gene sequence (SEQID NO.6) of pBV220 plasmid (purchased from China Center for Type Culture Collection, catalog number: TSPLA16466) as a template, primers P3 and P4 were designed, and PCR amplification was performed to obtain the PL promoter fragment; PCR reaction system: 1 μL pBV220 plasmid DNA, 1 μL P3, 1 μL P4, 9.5 μL ddH2O, 12.5 μL prime STAR HSDNA Polymerase. Primers P5 and P6 were designed, and PCR amplification was performed to obtain the PR promoter fragment. PCR reaction system: 1 μL pBV220 plasmid DNA, 1 μL P5, 1 μL P6, 9.5 μL ddH2O, 12.5 μL prime STAR HSDNA Polymerase. The above PCR reaction conditions are: 94°C pre-denaturation for 5 min; 94°C denaturation for 30 sec, 55°C annealing for 30 sec, 72°C extension for 0.5 min, 35 cycles; 72°C extension for 10 min; 12°C insulation.

[0027] Using the wild Escherichia coli (E.coli) W3110 (purchased from China Center for Type Culture Collection, catalog number: S376352) 3-deoxy-D-arabinoheptulose-7-phosphate (DAHP) synthase (AroF) encoding gene aroF encoding gene sequence (NCBIID: 947084) as a template, amplification primers P7 and P8 were designed, and the gene aroF was amplified by PCR. PCR reaction system: 1μL E.coli W3110 genomic DNA, 1μL P7, 1μL P8, 9.5μL ddH2O, 12.5μL prime STAR HSDNA Polymerase. PCR reaction conditions: 94℃ pre-denaturation for 5min; 94℃ denaturation for 30sec, 55℃ annealing for 30sec, 72℃ extension for 1.5min, 35cycles; 72℃ extension for 10min; 12℃ insulation.

[0028] Using the gene sequence (NCBI ID: 882128) of the p-hydroxybenzoate hydroxylase (PobA) encoding gene of Pseudomonas aeruginosa PAO1 (purchased from the American Type Culture Collection, catalog number: KCSP.ATCC.47085D-5) as a template, primers P9 (nucleotide sequence as shown in SEQ ID NO.3) and P10 (nucleotide sequence as shown in SEQ ID NO.4) were designed to amplify the gene pobA by PCR. The PCR reaction system was: 1 μL P. aeruginosa PAO1W3110 genomic DNA, 1 μL primer P9, 1 μL primer P10, 9.5 μL ddH2O, 12.5 μL prime STAR HSDNA Polymerase. PCR reaction conditions: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 sec, annealing at 55°C for 30 sec, extension at 72°C for 1.5 min, 35 cycles; extension at 72°C for 10 min; insulation at 12°C.

[0029] After purification, the five DNA fragments pACYC, PL, PR, aroF, and pobA were connected according to the operation steps of the one-step rapid cloning kit (Yisheng Bio-commercial tool vector, catalog number 10923ES20). The ligation product was transformed into Escherichia coli DH5α (purchased from China Center for Type Culture Collection, catalog number: TS277737) competent cells, cultured at 37°C for 8 hours, and the transformants were selected for shaking culture in LB containing 30 mg / L kanamycin. The plasmid was extracted and verified by enzyme digestion to obtain the expression plasmid pACYC177-aroF-pobA (such as Figure 2 shown).

[0030] The plasmid pACYC177-aroF-pobA was transformed into wild E. coli W3110, spread on LB plates containing kanamycin (30 mg / L), and cultured at 37°C for 8 hours to obtain the original gallic acid production strain, named SDL-5. A single colony was picked into liquid LB, cultured at 37°C overnight, and stored in a glycerol tube.

[0031] SEQ ID NO.5 (>pACYC177 plasmid gene sequence (3941 bp)):

[0032]

[0033]

[0034]

[0035] SEQ ID NO.6 (>pBV220 plasmid gene sequence (3666bp)):

[0036]

[0037]

[0038]

[0039] CTTAAAAATTAAGCCCTGAAGAAGGGCAGCATTCAAAGCAGAAGGCTTTG GGGTGTGTGATACGAAACGAAGCATTGGTTAAAAATTAAGGAG;

[0040] pACYC177 plasmid backbone fragment pACYC amplification primers:

[0041] Forward primer P1: 5′-CCTGCAGCAATGGCAACAAC-3′;

[0042] Reverse primer P2: 5′-GATCCTCCGGCGTTCAGCCT-3′;

[0043] PL promoter amplification primers:

[0044] Forward primer P3: 5′-GAACGCCGGAGGATCCCAATGCTTCGTTTCGTATC-3′;

[0045] Reverse primer P4: 5′-GATCTCTCAC CTACCAAACAATGC-3′;

[0046] PR promoter amplification primers:

[0047] Forward primer P5: 5′-TAGTTGATCCTCAGATCTTTAGCTGTCTTG GTTTGCCCAA-3′;

[0048] Reverse primer P6: 5′-ATTTAATGCATTGATGCC-3′;

[0049] AroF encoding gene aroF amplification primers:

[0050] Forward primer P7: 5′-GCATTGTTTGGTAGGTGAGAGATCGCCTCGCGCT CCGGAACATA-3′;

[0051] Reverse primer P8: 5′-CTGAGGATCAACTATCGCAAACGA-3′;

[0052] Primers for amplification of the PobA coding gene:

[0053] Forward primer P9 (SEQ ID NO.3):

[0054] 5'-GGCATCAATGCATTAAATATGAAGACTCAAGTCGCCAT-3';

[0055] Reverse primer P10 (SEQ ID NO.4):

[0056] 5'-TTGCCATTGCTGCAGGGTTCTGGGCGAGATCGGACA-3'.

[0057] Example 2

[0058] 1. A new p-hydroxybenzoate hydroxylase gene pobA r Preparation

[0059] The synthesis process is as follows Figure 1 As shown in the figure, the amino acid sequence of p-hydroxybenzoate hydroxylase PobA of Pseudomonas aeruginosa PAO1 (NCBI number: AAG03636.1) was used as a template, and the pymol software was used for structural simulation to analyze the four-dimensional structure of p-hydroxybenzoate hydroxylase. Rational design was performed based on the active site and highly conserved regions of p-hydroxybenzoate hydroxylase, optimizing the interaction of charges within the enzyme and modifying the enzyme structure stability. The modified amino acid sequence was prepared by codon optimization and artificial synthesis according to the codon preference of Escherichia coli. r Gene, the gene sequence is shown as SEQ ID NO.1.

[0060] 2. Parahydroxybenzoate hydroxylase gene pobA r Subclone

[0061] PCR amplify the p-hydroxybenzoate hydroxylase gene pobA in step 1 using the following primers: r :

[0062] Tt-1: 5'–GGATCCATGAAGACTCAGGTCGCTATCATTG-3'

[0063] Tt-2: 5'–CTCGAGCTACTCGATCTCTTCATAAGG-3'

[0064] During the above amplification synthesis, a BamHI restriction site was introduced into Tt-1, and a XhoⅠ restriction site was introduced into Tt-2.

[0065] PCR reaction system: 1 μL P. aeruginosa PAO1 genomic DNA (purchased from the German DSMZ strain collection, total DNA extracted), 1 μL Tt-1, 1 μL Tt-2, 9.5 μL ddH2O, 12.5 μL prime STAR HSDNA Polymerase.

[0066] PCR reaction conditions: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 sec, annealing at 55°C for 30 sec, extension at 72°C for 1.5 min, 35 cycles; extension at 72°C for 10 min; insulation at 12°C.

[0067] The yield and specificity of the PCR amplification products were detected by 1% agarose gel electrophoresis and purified using a PCR product recovery kit (BIOMIGA, Shanghai Jinpan Biotechnology Co., Ltd.).

[0068] The purified PCR amplification product and vector pET-28a (Novagen, Shanghai Qifa Experimental Reagent Co., Ltd.) were double-digested with BamHI and XhoⅠ (Takara, Shanghai Haring Biotechnology Co., Ltd.) respectively, and reacted at 37℃ for 2h. The double-digestion reaction system is: 2.5μL BamHI, 2.5μL XhoⅠ, 5μL10×buffer K, 35μL ddH2O. The restriction PCR and vector large fragments were recovered by agarose electrophoresis. After gel cutting, the target fragment and vector were added with 1μL 10×Ligase Buffer and 1μL Ligase, and connected at 16℃ overnight. The ligation reaction product was used to transform Escherichia coli DH5α, and then applied to a culture dish containing 100μg / mL Amp (ampicillin) and cultured at 37℃ for 10-15h.

[0069] Pick multiple single colonies from the transformation plate and extract the plasmid using a plasmid mini-extraction kit purchased from BIOMIGA. The obtained plasmid was double-digested with BamHI and XhoⅠ (Takara, Shanghai Haring Biotechnology Co., Ltd.) and reacted at 37°C for 2 hours to perform upper enzyme digestion. Verify whether the size of the enzyme digestion band is consistent with the theoretical value, and sequence the obtained recombinant plasmid. The sequencing results showed that the cloned target fragment (nucleotide length of 1185bp) was inserted into the pET-28a vector, and the recombinant clone and expression vector pET-28a-pobA was obtained. r , p-hydroxybenzoate hydroxylase gene pobA r The DNA sequence of the PobA is shown in SEQ ID NO.1, and the amino acid sequence of the protein (p-hydroxybenzoate hydroxylase) expressed by the PobA is shown in SEQ ID NO.2. SEQ ID NO.1 (new PobA DNA (1185 bp)):

[0070]

[0071]

[0072] SEQ ID NO.2 (new PobAr (394 amino acids)):

[0073]

[0074] 3. Expression vector pACYC177-aroF-pobA r and the construction of recombinant bacteria SDL-6

[0075] The p-hydroxybenzoate hydroxylase gene pET-28a-pobA obtained in step 3 r As a template, SEQ ID NO.3 and SEQ ID NO.4 were used as primers to obtain the gene fragment pobA by PCR amplification. r PCR reaction system: 1 μL plasmid pET-28a-pobA r , 1μL primer SEQ ID NO.3, 1μL primer SEQ ID NO.4, 9.5μL ddH2O, 12.5μL prime STAR HSDNA Polymerase. PCR reaction conditions: 94℃ pre-denaturation for 5min; 94℃ denaturation for 30sec, 55℃ annealing for 30sec, 72℃ extension for 1.5min, 35cycles; 72℃ extension for 10min; 12℃ insulation.

[0076] Using pACYC177-aroF-pobA prepared in Example 1 as a template, forward primer P1 and reverse primer P6 as a primer pair, PCR amplification was performed to obtain the gene fragment pACYC177-aroF (containing the pACYC177 backbone, promoter PL, gene aroF and promoter PR). PCR reaction system: 1 μL plasmid pACYC177-aroF-pobA, 1 μL P1, 1 μL P6, 9.5 μL ddH2O, 12.5 μL prime STAR HS DNA Polymerase. PCR reaction conditions: 94°C pre-denaturation for 5 min; 94°C denaturation for 30 sec, 55°C annealing for 30 sec, 72°C extension for 5 min, 35 cycles; 72°C extension for 10 min; 12°C insulation. The purified gene fragment pobAr and pACYC177-aroF were connected according to the operation steps of the one-step rapid cloning kit (Yisheng Bio-commercial tool vector, catalog number 10923ES20). The ligation product was transformed into E. coli DH5α competent cells, cultured at 37°C for 8 hours, and the transformants were selected for shaking culture in LB containing 30 mg / L kanamycin, and the plasmid was extracted and verified by enzyme digestion to obtain the expression plasmid pACYC177-aroF-pobAr.

[0077] The plasmid pACYC177-aroF-pobAr was transformed into wild Escherichia coli W3110, spread on LB plates containing kanamycin (30 mg / L), and cultured at 37°C for 8 hours to obtain the transformed strain, named SDL-6. A single colony was picked into liquid LB, cultured at 37°C overnight, and stored in a glycerol tube.

[0078] Example 3 Results of shake flask fermentation of original gallic acid producing strain SDL-5 and modified strain SDL-6 The modified strain SDL-6 obtained in Example 2 and the original gallic acid producing strain SDL-5 obtained in Example were shaken and fermented at 37°C for 24 h. During the fermentation process, 20% ammonia water was used to adjust the culture medium (fermentation medium (g / L): dipotassium hydrogen phosphate 24, potassium dihydrogen phosphate 9.6, magnesium sulfate heptahydrate 1, ammonium sulfate 5, glucose 30, yeast powder 15, citric acid monohydrate 2, trace element solution 3mI / L (trace element solution (g / L): Al2(SO4)3·18H2O 2, CoSO4·7H2O 0.75, CuS04·5H2O2 5, H3BO30.5, MnSO4·H2O2 4, Na2MOO4·2H2O 3, NiSO4·6H2O 2.5, ZnSO4·7H2O 15, FeSO4·7H2O2 5)) pH maintained at 6.5-7.2. Shake flask test results are as follows Figure 3As shown, when strain SDL-6 was compared with the control (strain SDL-5), it was found that: the final gallic acid content of the control (TS) was 0.8 g / L, while that of strain SDL-6 was 1.5 g / L, and the tryptophan content increased by 87.5% compared with the control.

Claims

1. A p-hydroxybenzoate hydroxylase gene pobA r , characterized in that, The p-hydroxybenzoate hydroxylase gene pobA r The nucleotide sequence is shown in SEQ ID NO.

1.

2. The p-hydroxybenzoate hydroxylase gene pobA according to claim 1 r , characterized in that, The p-hydroxybenzoate hydroxylase gene pobA r The method comprises the following steps: amplifying the p-hydroxybenzoate hydroxylase gene pobA by using a primer pair with amino acid sequences as shown in SEQ ID NO.3 and SEQ ID NO.4 by a PCR method, and then constructing a recombinant bacterium SDL-5 for transformation and synthesis.

3. A p-hydroxybenzoate hydroxylase gene pobA according to claim 1 r The expressed protein is characterized in that The amino acid sequence of the expressed protein is shown in SEQ ID NO.

2.

4. A derivative protein of an expressed protein, characterized in that The derivative protein of the expressed protein is the p-hydroxybenzoate hydroxylase gene pobA described in claim 3 r A derivative protein formed by replacing one or more amino acid residues in the expressed protein.

5. A method comprising the p-hydroxybenzoate hydroxylase gene pobA according to claim 1 r of the recombinant vector.

6. A method comprising the p-hydroxybenzoate hydroxylase gene pobA according to claim 1 r Or the p-hydroxybenzoate hydroxylase gene pobA according to claim 5 r A recombinant organism containing a recombinant vector.

7. The recombinant organism according to claim 6, characterized in that The recombinant organism is a strain.

8. The p-hydroxybenzoate hydroxylase gene pobA according to claim 1 or 2 r Or the p-hydroxybenzoate hydroxylase gene pobA according to claim 3 r Application of the expressed protein in the synthesis of gallic acid.

9. Use of the derivative protein of the expression protein according to claim 4 or the recombinant vector according to claim 5 in the synthesis of gallic acid.

10. Use of the recombinant organism according to claim 6 or claim 7 in the synthesis of gallic acid.

Images