Kit and method for identifying adulteration of Chinese turtle shells

Abstract

The invention discloses a kit and a method for identifying adulteration of Chinese turtle shells. Belongs to the technical field of traditional Chinese medicine identification. The invention develops and verifies a sensitive and accurate method for detecting and quantifying the Chinese turtle shell, and the ddPCR absolute quantification method can reduce false positive and false negative reports. The method developed by the invention can be used as a tool of a medicine supervision mechanism and a law enforcement mechanism, so that the medicine supervision mechanism and the law enforcement mechanism can identify and quantify the Chinese turtle shells and solve the adulteration identification problem.

Description

Technical Field

[0001] The invention relates to the technical field of Chinese medicine identification, and more specifically to a kit and an identification method for identifying adulteration of Chinese soft-shell turtle shell. Background Art

[0002] Animal-derived Chinese medicinal materials are an important part of China's medical treasure house. Among the commonly used animal medicinal materials in China, the Chinese soft-shell turtle (Trionycis carapax) is clearly defined as the carapace of the Chinese soft-shell turtle (Trionyx sinensis Wiegmann) in the 2020 edition of the Chinese Pharmacopoeia. It has the effects of nourishing yin and suppressing yang, reducing fever and removing steaming, and softening and dispersing nodules. In addition to being used as a medicinal material, the Chinese soft-shell turtle is also the "king" or "minister" ingredient in several common Chinese patent medicines in clinical practice, such as Biejia Jianwan, Danbie Capsules, Ginseng Biejia Jianwan, Qinghao Biejia Tablets, Compound Biejia Soft Liver Tablets, Biejia Hemorrhoids Capsules, etc. Therefore, protecting the excellent germplasm resources of Chinese soft-shell turtle and preventing counterfeit products from flooding the market have become the top priority to ensure the quality of Chinese soft-shell turtle and its related medicines.

[0003] However, the sources of Chinese soft-shell turtle shell on the market are very confusing, mixed with species such as Florida soft-shell turtle (Apalone ferox), horned soft-shell turtle (Apalone spinifera) and edge soft-shell turtle (Lissemys punctata scutata). Drug regulatory authorities are extremely concerned about this. In order to curb the adulteration of Chinese soft-shell turtle shell and its Chinese patent medicine, an accurate identification method is needed.

[0004] The 2020 edition of the Chinese Pharmacopoeia only controls the properties, moisture and extracts of Chinese soft-shell turtle shell, and does not make provisions for identification. Research on Chinese soft-shell turtle shell and deep-processed products is also mostly focused on chemical composition and pharmacology, with few qualitative reports. At present, the identification of Chinese soft-shell turtle shell is mainly based on medicinal properties, ultraviolet spectroscopy, thin layer and polymerase chain reaction (PCR) technology. Among them, ultraviolet spectroscopy and thin layer identification lack specificity. Although PCR technology has the characteristics of strong specificity and high sensitivity, the preparation process of Chinese soft-shell turtle shell deep-processed products has a high temperature and complicated steps. Specific DNA fragments may be destroyed. In addition, the matrix is ​​complex and extraction is more difficult, which makes PCR technology difficult to apply to Chinese soft-shell turtle shell deep-processed products.

[0005] Digital PCR (dPCR) has the advantages of absolute quantification, high sensitivity and specificity, and its core principles are limiting dilution, endpoint PCR and Poisson distribution. Droplet digital PCR (ddPCR) is a digital PCR technology in which the reaction solution is randomly distributed into thousands or even millions of droplets, which are PCR amplified separately. Through Poisson statistical analysis based on amplification endpoint fluorescence, the DNA copy number can be obtained, thereby achieving powerful absolute quantification. Using this method, the amplification quality of target nucleic acids in mixed samples can be significantly improved, especially in conventional PCR due to the low abundance of DNA in mixed samples and low amplification efficiency. In addition, due to the relative dilution of the reaction system, ddPCR can reduce the impact of PCR inhibitors on the reaction.

[0006] Droplet PCR technology has been widely used in food safety and medical systems. However, there is a lack of research on the application of droplet PCR to quality control of highly processed products such as bones, which have low DNA content, are susceptible to severe degradation, and may contain high levels of PCR inhibitors.

[0007] In summary, how to provide a method based on droplet digital PCR to identify adulteration in deep-processed products of Chinese soft-shell turtle shell is an urgent problem that technicians in this field need to solve. Summary of the invention

[0008] In view of this, the present invention provides a kit and an identification method for identifying adulteration of Chinese soft-shell turtle shell.

[0009] In order to achieve the above object, the present invention adopts the following technical solution:

[0010] The kit for identifying adulteration of Chinese soft-shell turtle shell comprises the following primer probe sets:

[0011] A primer probe set for detecting Chinese soft-shelled turtle, comprising:

[0012] The upstream primer of the sequence shown in SEQ ID No.1,

[0013] The downstream primer of the sequence shown in SEQ ID No.2,

[0014] and a probe having a sequence as shown in SEQ ID No.3.

[0015] Furthermore, the method further comprises the following primer probe set:

[0016] A primer probe set for detecting Florida soft-shell turtle, comprising:

[0017] The upstream primer of the sequence shown in SEQ ID No.4,

[0018] The downstream primer of the sequence shown in SEQ ID No.5,

[0019] and a probe having a sequence as shown in SEQ ID No.6;

[0020] A primer probe set for detecting horned turtle, comprising:

[0021] The upstream primer of the sequence shown in SEQ ID No.7,

[0022] The downstream primer of the sequence shown in SEQ ID No.8,

[0023] and a probe having a sequence as shown in SEQ ID No.9;

[0024] Universal primer probe set, comprising:

[0025] The upstream primer of the sequence shown in SEQ ID No.10,

[0026] The downstream primer of the sequence shown in SEQ ID No.11,

[0027] and a probe having a sequence as shown in SEQ ID No.12.

[0028] A method for identifying adulteration of Chinese soft-shell turtle shell, comprising testing a sample with the above-mentioned kit.

[0029] Further, the following steps are included:

[0030] (1) Extracting DNA from samples;

[0031] (2) Detecting the copy number of sample DNA based on ddPCR using the above-mentioned kit;

[0032] (3) Based on the copy number of the sample DNA, the turtle composition of the test sample is obtained.

[0033] Furthermore, in step (2), the total system of the ddPCR reaction system is 20 μl, including: 10 μl 2XddPCR Supermix, 0.9 μl of 20 μM upstream and downstream primer mixture, 0.5 μl of 10 μM probe, 0.5 μl of sample DNA, and nuclease-free water to make up to 20 μl.

[0034] Furthermore, in step (2), the amplification program of ddPCR is: 95°C, 10 minutes; then 95°C, 30 seconds, 58°C, 60 seconds, 45 cycles; then 98°C, 10 minutes; stored at 16°C; all steps are performed using a heating rate of 1°C / s.

[0035] It can be seen from the above technical solution that, compared with the prior art, the beneficial effects achieved by the present invention are:

[0036] The present invention develops and validates a sensitive and accurate method for detecting and quantifying Chinese soft-shell turtle shell, and the ddPCR absolute quantification method can reduce false positive and false negative reports. The method developed by the present invention can be used as a tool for drug regulatory agencies and law enforcement agencies, enabling them to identify and quantify Chinese soft-shell turtle shell and solve the problem of adulteration identification. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0038] Figure 1 The Sanger sequencing method for identifying the Chinese soft-shelled turtle samples in Example 1 of the present invention, wherein (a) is the sequencing results of three soft-shelled turtles, numbered 1, 2, and 3 are Chinese soft-shelled turtles, Florida soft-shelled turtles, and horned soft-shelled turtles, respectively; (b) is the sequence comparison of Chinese soft-shelled turtles, Florida soft-shelled turtles, and horned soft-shelled turtles;

[0039] Figure 2 Quantitative results of single and quadruple ddPCR detection in Example 4 of the present invention, wherein (a) is an isocratic dilution result diagram of the ddPCR system for detecting Chinese soft-shell turtle shell. In the single ddPCR detection on the left, the DNA input of channels 1-7 is 0.5 ng; 0.25 ng; 0.125 ng; 0.0625 ng; 0.0313 ng; 0.0156 ng; 0.0078 ng, and channel 8 is a negative control; in the quadruple ddPCR detection on the right, the DNA input of channels 1-7 is 0.5 ng; 0.25 ng; 0.125 ng; 0.0625 ng; 0.0313 ng; 0.0156 ng; 0.0078 ng, and channel 8 is a negative control; (b) is the final DNA concentration and DNA copy number detected by the two ddPCR methods;

[0040] Figure 3 Specificity and amplification efficiency of the ddPCR system in Example 4 of the present invention, wherein (a) is the specificity of the three species probes; (b) is the amplification efficiency of the three species probes in the single-plex and quadruple ddPCR systems, 1 represents the single-plex ddPCR system; 2 represents the quadruple ddPCR system; (c) is the amplification results and probe ratios of the three species in the single-plex and quadruple ddPCR systems;

[0041] Figure 4The quadruple ddPCR system in Example 5 of the present invention detects adulterated samples, wherein (a) is the test results of four different mixing ratios and adulterations, which, from top to bottom and from left to right, represent Chinese soft-shell turtle: Florida soft-shell turtle 1:1, Chinese soft-shell turtle: Florida soft-shell turtle 1:10, Chinese soft-shell turtle: Florida soft-shell turtle 1:100, and Chinese soft-shell turtle: Horned soft-shell turtle 10:1; (b) is the internal reference result of all samples; (c) is the actual percentage of adulterated samples and the detection percentage, and the ratio of all test results to the internal reference. DETAILED DESCRIPTION

[0042] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0043] The drugs required for the present invention are conventional experimental drugs, which are purchased from commercial channels; the experimental methods not mentioned are conventional experimental methods and will not be described in detail here.

[0044] Example 1

[0045] Animal DNA barcoding

[0046] To further determine the reference materials used in the present invention, three pairs of primers were designed for the homologous COI regions of Chinese soft-shell turtle, Florida soft-shell turtle and horned soft-shell turtle. The primer nucleotide sequences are shown in Table 1. The COX1 sequence of animal samples was amplified according to the DNA barcoding technical specifications (Chinese Pharmacopoeia Committee 2020 edition). The obtained COX1 sequence was used to identify species in the Traditional Chinese Medicine DNA Barcoding System (DNA Barcoding System for identification Herbal Medicine, TCMbarcode database, http: / / www.tcmbarcode.cn).

[0047] Table 1 Primer nucleotide sequences

[0048]

[0049] The sequencing results showed that the COI sequence of the sample was completely consistent with the COI sequence in the TCM barcode database ( Figure 1 a).

[0050] Example 2

[0051] ddPCR sequence alignment and primer design

[0052] In order to select appropriate target genes for ddPCR, the mitochondrial DNA (mtDNA) of Chinese soft-shell turtle, Florida soft-shell turtle and horned soft-shell turtle were compared ( Figure 1 b), and designed a pair of specific primers and probes according to the results, and designed a pair of universal primers and probes as internal references. The details are as follows:

[0053] The mtDNA sequences of all species in the present invention are from NCBI's GenBank (https: / / www.ncbi.nlm.nih.gov / genbank / ). The accession numbers for the sequences of PS (Sinensis trifasciata), AS (Florida softshell turtle) and AF (Horned softshell turtle) are MG431983.1, JF966197.1 and KX882744.1, respectively.

[0054] The mtDNA sequences of the above three species were aligned using ApE_win_current software (https: / / jorgensen.biology.utah.edu / wayned / ape / ). Based on this, four pairs of primers and probes were designed, including three pairs of specific primers and probes and one pair of universal primers and probes. Primers and probes were designed according to the "qPCR Guide" of Eurogene Technology (https: / / www.eurogentec.com / assets / 7787b90a-cf84-4acf-8e37-f36487b9f091 / guide-en-qpcr-guide.pdf) using BeaconDesigner8 software V8.14 (http: / / www.premierbiosoft.com) and synthesized by ACCURATEBIOTECHNOLOGY (Hunan) at the HPLC purification level. The 5′ end of the probe is labeled with FAM, VIC, CY5 or CY5.5, and the 3′ end is quenched with non-fluorescent black hole quencher 1 or black hole quencher 3 (BHQ1 or BHQ3). The sequences of the primers and probes are shown in Table 2.

[0055] Table 2 ddPCR primer and probe sequences

[0056] Gene Forwardprimer Reverseprimer Probe PS-ND1 ACCGATCTACCCTATGCAAGTGGGAATGGT FAM-CCCACCCTCGCCCTATTACTAAATTCATCC, SEQ ID ATTGG, SEQ ID No. 2 AGCCC-BHAQ1, SEQ ID No. 3

[0057] No.1

[0058] AS-12S GGCTACATTTTCTAC CTCAGTTTACTACTAA CY5-CAGAACCATGAAACACGGTCAATAGAAA, SEQ ID ATCCTTC, SEQ ID No.5TAAACA-BHQ3, SEQ IDNo.6

[0059] No.4

[0060] AF-ND4 CCCATACAACTCCAA GGTTCGTGATGATGC VIC-AATGACAACCTCAGGCTGGCTATCTCA, SEQ ID No.7TACTAA, SEQ ID No.8TCG-BHQ1, SEQ ID No.9GP-16S GAGTCCTTATCGACG ACCCTTAATAGCTGTT CY5.5-TCCTGATCCAACATCGAGGTACG, SEQ ID No.10GCA, SEQ ID No.11CG-BHQ3, SEQ ID No.12

[0061] Example 3

[0062] ddPCR workflow

[0063] According to previous studies and instructions, the primer-probe concentration ratio was set at 900 nM:250 nM and the annealing temperature was set at 58°C.

[0064] In a nuclease-free tube, add 10 μl 2X ddPCR Supermix, 0.9 μl upstream and downstream primer mixture (20 μM), 0.5 μl probe (10 μM), 0.5 μl sample DNA, and sufficient nuclease-free water to make up to 20 μl.

[0065] After mixing all reagents by simple vortexing and centrifugation, the mixture was added to a disposable microdroplet generation chip (FOREVERGNE, Guangdong, China) according to the manufacturer's instructions, and droplet generation oil (400 μl) was added to the chip, and droplets were generated using a MicroDrop-20A microdroplet generator. The droplets (about 50 μl) were transferred to a 96-well plate and then sealed with a punctureable heat-sealed film. PCR amplification was performed in a T100TM Thermal Cycler (Bio-Rad, Munich, Germany) using the following conditions:

[0066] 95°C, 10 min; then 95°C, 30 sec, 58°C, 60 sec, 45 cycles; then 98°C, 10 min; hold at 16°C; all steps were performed using a heating rate of 1°C / s.

[0067] Finally, the droplets were tested for fluorescence signal detection in a MicroDrop-20A biochip analyzer (FOREVERGNE, Guangdong, China), and data were analyzed using QuantaSoft 1.7 software.

[0068] All experiments were repeated twice. All reagents and consumables were purchased from FOREVERGNE (Guangdong). BLAST (http: / / blast.ncbi.nlm.nih.gov / ) was used to verify the specificity of each probe hybridization sequence.

[0069] Example 4

[0070] Specificity and sensitivity of ddPCR systems

[0071] (1) To verify the specificity of primers / probes, single ddPCR tests were performed on Chinese soft-shell turtles, Florida soft-shell turtles, and horned soft-shell turtles.

[0072] (2) The quadruple ddPCR method was used to detect Chinese soft-shell turtle, Florida soft-shell turtle and horned soft-shell turtle (0.9 μl (20 μM) of each upstream and downstream primer mixture and 0.5 μl (10 μM) of each probe) and compared with the single ddPCR method. All experiments were repeated twice.

[0073] (3) For sensitivity analysis (the sample tested was Chinese soft-shell turtle shell), the DNA concentration of the PCR reaction solution of the single-plex and quadruple ddPCR systems was diluted twice, from 1.00 ng / μl to 0.0156 ng / μl. All ddPCR tests were repeated twice. The limit of detection (LOD) was defined as the lowest DNA copy number that could detect a positive signal in three replicates, and the limit of quantification (LOQ) was determined based on the RSD (≤25%).

[0074] The results are as follows:

[0075] (1) Sensitivity of ddPCR system (only PS-ND1 was added to verify the sensitivity of a single detection method)

[0076] At different DNA dilutions, when the final DNA concentration was 1.9 copies, the specific fragment could be stably detected. The initial limit of quantification (LOQ) determined by the present invention was at least 13.23 copies, and the initial limit of detection (LOD) was 2.7 copies ( Figure 2 ).

[0077] Note: Figure 2(b) is a three-repetition experiment. The single weight and multiple weight of the first column are obtained from one experiment, the single weight and multiple weight of the second column are obtained from one experiment, and the single weight and multiple weight of the third column are obtained from one experiment.

[0078] (2) Singleplex ddPCR method accurately identifies medicinal animals (specificity)

[0079] The target copy number detected by ddPCR was calculated based on the negative and positive droplets in the test results. Therefore, the annealing temperature and primer / probe concentration that can clearly distinguish between negative and positive droplets were first determined. Based on the guidelines, at an annealing temperature of 58°C and a primer / probe concentration of 900 / 250nM, the positive fluorescence signals detected by the four primers / probes were most clearly distinguished from the negative fluorescence signals.

[0080] To investigate the specificity of the optimized ddPCR system, all samples were cross-tested using single-plex ddPCR ( Figure 3 a), Results show that the optimized detection system specifically amplifies DNA.

[0081] (3) Comparison of the quadruple ddPCR detection method and the single ddPCR method

[0082] To construct the quadruple ddPCR method, single-plex and quadruple ddPCR were performed on samples of Chinese soft-shell turtle, Florida soft-shell turtle and horned soft-shell turtle, and the amplification efficiencies of the two were compared ( Figure 3 Singleplex and quadruplex copy number results in c) Figure 3 b, Figure 3 c). In addition to the Chinese soft-shell turtle, Florida soft-shell turtle and horned soft-shell turtle samples, the internal reference can also be used for positive amplification in a variety of soft-shell turtles, which can be used to detect sample purity to a certain extent. When the percentage of all positive results detected exceeds 80% of the internal reference value, the presence of other soft-shell turtles is not considered. The results of single and quadruple ddPCR tests showed that the stability of the ddPCR system was good when the annealing temperature was 58°C and the primer / probe concentration was 900 / 250nM.

[0083] Example 5

[0084] Quadruple ddPCR to detect adulteration in mixed samples

[0085] Before DNA extraction, samples of different weights were weighed and mixed to extract mixed DNA. Chinese soft-shell turtle, Florida soft-shell turtle and horned soft-shell turtle were mixed in pairs at a ratio of 1:1, 1:10 and 1:100 for quadruple ddPCR.

[0086] The results showed that even at an unbalanced ratio of 1:100, the system was able to stably detect low-abundance DNA with a copy number of less than 10 ( Figure 4). And the system can roughly find the mixing ratio. However, after repeated experiments, it was found that mitochondrial DNA is not suitable for accurate quantification because there is no clear relationship between mitochondrial DNA and cell number, and there are obvious differences in the amount of mitochondrial DNA between different tissues.

[0087] Example 6

[0088] Detection of turtle shell in Shengui Lurong pills by quadruple ddPCR

[0089] Test samples: 6 samples extracted from Shengui Lurong Pills.

[0090] The sample genomic DNA was extracted using an animal genomic DNA extraction kit, and all operations were performed strictly in accordance with the kit instructions.

[0091] The results showed that turtle shell components other than Chinese soft-shell turtle shell were detected in all 6 samples of Shengui Lurong Pills, and the internal standard ratios of the 6 samples were all lower than 80%, indicating that turtle shell components other than Florida soft-shell turtle and Horned soft-shell turtle were present. The test results are listed in Table 3. Therefore, it is considered that the Shengui Lurong Pills are adulterated.

[0092] Table 3 Detection of turtle shell DNA in Shengui Lurong Pills

[0093]

[0094]

[0095] The various embodiments in this specification are described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same or similar parts between the various embodiments can be referenced to each other.

[0096] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A kit for identifying adulteration of Chinese soft-shell turtle shell, characterized in that: The primer probe sets include the following: A primer probe set for detecting Chinese soft-shelled turtle, comprising: The upstream primer of the sequence shown in SEQ ID No.1, The downstream primer of the sequence shown in SEQ ID No.2, and a probe having a sequence as shown in SEQ ID No.

3.

2. The kit according to claim 1, characterized in that Also included are primer probe sets as described below: A primer probe set for detecting Florida soft-shell turtle, comprising: The upstream primer of the sequence shown in SEQ ID No.4, The downstream primer of the sequence shown in SEQ ID No.5, and a probe having a sequence as shown in SEQ ID No.6; A primer probe set for detecting horned turtle, comprising: The upstream primer of the sequence shown in SEQ ID No.7, The downstream primer of the sequence shown in SEQ ID No.8, and a probe having a sequence as shown in SEQ ID No.9; Universal primer probe set, comprising: The upstream primer of the sequence shown in SEQ ID No.10, The downstream primer of the sequence shown in SEQ ID No.11, and a probe having a sequence as shown in SEQ ID No.

12.

3. A method for identifying adulteration of Chinese soft-shell turtle shell, characterized in that: The sample is tested using the kit described in any one of claims 1 or 2.

4. The method according to claim 3, characterized in that The steps include: (1) Extracting DNA from samples; (2) Detecting the copy number of sample DNA based on ddPCR using the kit described in any one of claims 1 or 2; (3) Based on the copy number of the sample DNA, the turtle composition of the test sample is obtained.

5. The method according to claim 4, characterized in that In the step (2), the total system of the ddPCR reaction system is 20 μl, including: 10 μl 2X ddPCR Supermix, 0.9 μl of 20 μM upstream and downstream primer mixture, 0.5 μl of 10 μM probe, 0.5 μl of sample DNA, and nuclease-free water to make up to 20 μl.

6. The method according to claim 4, characterized in that In step (2), the amplification program of ddPCR is: 95°C, 10 minutes; then 95°C, 30 seconds, 58°C, 60 seconds, 45 cycles; then 98°C, 10 minutes; stored at 16°C; all steps are performed using a heating rate of 1°C / s.

Images