Application of PDLIM4 gene in the preparation of drugs for inhibiting proliferation of non-small cell lung cancer

Abstract

The present invention provides the use of the PDLIM4 gene in the preparation of a drug for inhibiting the proliferation of non-small cell lung cancer, and belongs to the technical field of tumor suppressor gene research. The present invention finds that the PDLIM4 gene is highly expressed in tumors of non-small cell lung cancer, and patients with high expression of the PDLIM4 gene have a good prognosis; the proliferation of non-small cell lung cancer cells that overexpress the PDLIM4 gene is inhibited, and the proliferation of non-small cell lung cancer cells that knock down the PDLIM4 gene is accelerated, so confirming that the reagent that can achieve overexpression of the PDLIM4 gene is of great significance for inhibiting the proliferation of non-small cell lung cancer cells. Overexpression of the PDLIM4 gene in non-small cell lung cancer cells can enhance the chemotherapeutic effect of the chemotherapy drug doxorubicin, and can be used as a chemosensitizer. BRD4 is an upstream regulatory factor for the elevated expression of the PDLIM4 gene in non-small cell lung cancer, and can be used to promote the expression of the PDLIM4 gene.

Description

Technical Field

[0001] The present invention belongs to the technical field of tumor suppressor gene research, and in particular relates to the application of PDLIM4 gene in preparing a drug for inhibiting the proliferation of non-small cell lung cancer. Background Art

[0002] The morbidity and mortality of lung cancer rank first among malignant tumors. Lung cancer (LC) is divided into small cell lung cancer (SCLC) and non-small cell lung cancer (NSCLC). NSCLC is more common than SCLC. Non-small cell lung cancer accounts for more than 85% of lung cancer and includes many types, such as lung adenocarcinoma (LUAD), lung squamous cell carcinoma (LUSC), large cell carcinoma, etc. The 5-year survival rate of patients with non-small cell lung cancer is less than 15%. It is imperative to further study the molecular mechanisms of the occurrence and development of non-small cell lung cancer and explore new potential tumor treatment targets and chemotherapy sensitization methods.

[0003] The PDLIM4 gene is also known as the RIL gene (reversion-induced LIM), which is reported to affect the formation and function of the cytoskeleton. The prior art CN11318934A discloses that PDLIM4 can be used as a gastric cancer marker, and that PDLIM4 is differentially expressed in cancerous tissues and adjacent tissues of human gastric cancer (upregulated in cancerous tissues). In addition, the Shandong University master's thesis "Study on the Expression Regulation of Human PDLIM4 Gene in Prostate Cancer" discloses that tumor suppressor genes are silenced in prostate cancer tissues and hormone-dependent prostate cancer cells of the Han Chinese population, and that methylation of its promoter region plays an important role in gene silencing, and demethylation can restore expression at the transcription and protein translation levels. However, its role in non-small cell lung cancer has not been sufficiently explored and discovered. Summary of the invention

[0004] In view of this, the object of the present invention is to provide the use of PDLIM4 gene in the preparation of a drug for inhibiting the proliferation of non-small cell lung cancer.

[0005] The present invention provides an application of the PDLIM4 gene in preparing a drug for inhibiting proliferation of non-small cell lung cancer cells, and overexpresses the PDLIM4 gene in non-small cell lung cancer cells.

[0006] The present invention provides the use of a reagent for overexpressing the PDLIM4 gene in preparing a drug for inhibiting the proliferation of non-small cell lung cancer cells.

[0007] Preferably, the agent for overexpressing the PDLIM4 gene includes a recombinant vector for overexpressing the PDLIM4 gene or a recombinant vector for overexpressing the BRD4 gene.

[0008] The present invention provides the use of a reagent for overexpressing the PDLIM4 gene in the preparation of a chemotherapeutic drug sensitizer.

[0009] Preferably, the chemotherapy drug comprises doxorubicin.

[0010] Preferably, the agent for overexpressing the PDLIM4 gene includes a recombinant vector for overexpressing the PDLIM4 gene or a recombinant vector for overexpressing the BRD4 gene.

[0011] The present invention provides a non-small cell lung cancer cell line over-expressing the PDLIM4 gene, which is obtained by transferring a recombinant vector over-expressing the PDLIM4 gene into non-small cell lung cancer cells.

[0012] Preferably, the non-small cell lung cancer cells are H1299 or A549.

[0013] The present invention provides the use of a reagent for overexpressing the PDLIM4 gene in preparing a reagent for promoting the expression of the P21 gene.

[0014] Compared with the prior art, the present invention has the following beneficial effects: the present invention finds that the PDLIM4 gene is highly expressed in tumors through clinical pathological tissue detection, and patients with high expression of the PDLIM4 gene have a good prognosis; the present invention constructs a stable cell line that knocks down and overexpresses the PDLIM4 gene, and finds that the proliferation of non-small cell lung cancer cells that overexpress the PDLIM4 gene is inhibited, and the proliferation of non-small cell lung cancer cells that knock down the PDLIM4 gene is accelerated, so it is confirmed that the reagent that overexpresses the PDLIM4 gene is of great significance for inhibiting the proliferation of non-small cell lung cancer cells. At the same time, overexpressing the PDLIM4 gene in non-small cell lung cancer cells can enhance the chemotherapeutic effect of the chemotherapy drug doxorubicin, and can be used as a chemosensitizer.

[0015] Furthermore, the present invention discovered that BRD4 promotes the gene expression of PDLIM4, thereby leading to an increase in the protein level of PDLIM4. BRD4 is an upstream regulatory factor for the increased expression of the PDLIM4 gene in non-small cell lung cancer. The present invention also explored the downstream substrates of the PDLIM4 gene. The PDLIM4 gene inhibits the degradation of P21 mRNA, leading to increased P21 RNA and protein levels. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1Through clinical pathological tissue detection, it was found that PDLIM4 is highly expressed in tumors, and patients with high expression of PDLIM4 have a good prognosis. A is the use of immunohistochemistry to stain the tumor tissue and adjacent tissue of clinical non-small cell lung cancer patients. Compared with normal tissue, the staining is deeper in tumor tissue. B is the scoring of tumor tissue and adjacent tissue of non-small cell lung cancer. The statistical results show that the median expression in tumor tissue is higher than that in adjacent tissue. C is the analysis of the corresponding tumor tissue and adjacent tissue of each group. The PDLIM4 gene is generally expressed higher in tumor tissue than in adjacent tissue. D and E are PDLIM4 immunohistochemical staining of tumor tissue of patients with non-small cell lung cancer, and the score is based on the area and intensity of the staining particles. The joint analysis with the patient's survival period shows that PDLIM4 is highly expressed and the patient has a good prognosis.

[0017] Figure 2 Stable cell lines with overexpression and knockdown of PDLIM4 were constructed, where A is WB detection of PDLIM4 overexpression in non-small cell lung cancer cell lines H1299 and A549 cells, OV-flag-vector cells are cells overexpressing viral empty vectors; OV-flag-PDLIM4 cells are cells overexpressing PDLIM4; B is WB detection of PDLIM4 knockdown in the non-small cell lung cancer cell line H1299.

[0018] Figure 3 The proliferation of non-small cell lung cancer cells overexpressing the PDLIM4 gene was inhibited, while the proliferation of non-small cell lung cancer cells knocking down PDLIM4 was accelerated. A was performed with OV-flag-vector and OV-flag-PDLIM4 cells for clone formation experiments. Overexpression of the PFLIM4 gene reduced the number of cell clones formed; B was performed using CCK8 experiments to detect cell proliferation; the proliferation of cells overexpressing the PDLIM4 gene was slower than that of cells overexpressing the empty vector; C was performed using EDU experiments to detect cell proliferation. The proliferation of cells overexpressing the PDLIM4 gene was slower than that of cells overexpressing the empty vector; D was performed on the cell cycle analysis of the cells. Compared with cells overexpressing the empty vector, the number of G2 / M phases of cells overexpressing the PDLIM4 gene increased; E was performed on cells knocking down the PDLIM4 gene, and the number of clones formed increased. 3F CCK8 detection, knocking down the PDLIM4 gene, accelerated cell proliferation.

[0019] Figure 4In order to explore whether BRD4 promotes the gene expression of PDLIM4, thereby leading to an increase in the protein level of PDLIM4, the effect of BET family inhibitor JQ1 at a concentration of 0.5 μM on the protein level of PDLIM4 was studied in A. The results showed that as the addition time of JQ1 increased, the protein level of PDLIM4 decreased; B. The BET family inhibitor JQ1 was added at a concentration of 0.5 μM. The results showed that as the addition time of JQ1 increased, the mRNA level of PDLIM4 decreased; C. JQ1 was added at a concentration of 0.01 μM, 0.1 μM, and 1 μM, respectively. , as the concentration of JQ1 increased, the protein level of PDLIM4 decreased; D 0.01μΜ, 0.1μΜ, and 1μΜ JQ1 were added, and as the concentration of JQ1 increased, the mRNA level of PDLIM4 decreased; E BET family members that affect PDLIM4 were detected by knocking down BRD2, BRD3, and BRD4, and it was found that only when BRD4 was knocked down, the mRNA level of PDLIM4 decreased; F BRD4 was knocked down, and protein detection was performed, and the protein level of PDLIM4 decreased; G BRD4 was knocked down, and PDLIM4 mRNA decreased; H Immunofluorescence detection showed that BRD4 knockdown reduced the fluorescence intensity of PDLIM4; I Overexpressed two functional motifs of BRD4, BD1 and BD2, and the results showed that overexpression of BD1 could reduce the expression of PDLIM4. The results showed that the BD1 motif of BRD4 has a regulatory effect on PDLIM4; J The immunohistochemistry results of clinical lung adenocarcinoma samples showed that the expression of BRD4 and PDLIM4 was correlated; K was a CHIP experiment, and the results showed that BRD4 could directly bind to the promoter of PDLIM4.

[0020] Figure 5To explore the downstream substrates of PDLIM4, PDLIM4 inhibited the degradation of P21 mRNA, leading to increased P21 RNA and protein levels; A was analyzed through the ATCG database and found that the expression of P21 was correlated with that of PDLIM4; B immunofluorescence showed that PDLIM4 and p21 were co-localized in cells; C WB results showed that P21 also increased accordingly when PDLIM4 was overexpressed; D immunofluorescence also showed that the fluorescence intensity of P21 increased when PDLIM4 was overexpressed; E real-time quantitative PCR showed that the mRNA level of P21 increased when PDLIM4 was overexpressed; F the protein level of P21 decreased when PDLIM4 was knocked down; G the mRNA level of P21 decreased when PDLIM4 was knocked down; H the protein levels of PDLIM4 and P21 decreased when JQ1 was added; I the mRNA level of P21 decreased when JQ1 was added; J both PDLIM4 and P21 increased accordingly when BRD4 was overexpressed. It shows the existence of BRD4 / PDLIM4 / P21 pathway; K is an overexpression of BRD4, and the mRNA level of P21 increases; L is a knockdown of BRD4, and both PDLIM4 and P21 decrease accordingly; M is an overexpression of the BD1 motif of BRD4, which can inhibit the expression of PDLIM4 and P21; N is an overexpression of BRD4, and the protein levels of PDLIM4 and P21 no longer increase under the condition of knockdown of PDLIM4; O is an RNA degradation experiment, showing that knockdown of the PDLIM4 gene can lead to accelerated degradation of P21 RNA; P is a CHIP experiment, and the results show that PDLIM4 can directly bind to the promoter of P21.

[0021] Figure 6 PDLIM4 overexpression enhances the chemotherapeutic effect of doxorubicin on non-small cell lung cancer. A. 0.5 μM doxorubicin was added, and WB results showed that the protein levels of BRD4, PDLIM4, and P21 increased; B. Real-time quantitative PCR results showed that the mRNA levels of BRD4, PDLIM4, and P21 increased after the addition of doxorubicin; C. The cells were treated with the BET inhibitor JQ1, and then doxorubicin was added, but the protein levels of PDLIM4 and p21 could not be increased; D. The cells were treated with the BET inhibitor JQ1, and then doxorubicin was added, but the mRNA levels of PDLIM4 and p21 could not be increased; E. BRD4 was knocked down, and the cells were treated with doxorubicin, but the protein levels of PDLIM4 and p21 could not be increased; F. BRD4 was knocked down, and the cells were treated with doxorubicin, and the mRNA levels of PDLIM4 and p21 p21 mRNA cannot be increased; G PDLIM4 was knocked down, and the cells were treated with doxorubicin, and the p21 protein level could not be increased; H PDLIM4 was knocked down, and the cells were treated with doxorubicin, and p21 mRNA could not be increased; I Compared with the cells overexpressing empty vector, the cell survival rate of cells with high expression of PDLIM4 was significantly reduced after the addition of doxorubicin. DETAILED DESCRIPTION

[0022] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0023] Example 1

[0024] Expression level of PDLIM4 in lung adenocarcinoma tissues

[0025] Statistical analysis of the TCGA database data revealed that the PDLIM4 protein level in patients with lung adenocarcinoma was significantly higher ( Figure 1 B and C in ).

[0026] Immunohistochemical staining was performed on 90 pairs of lung adenocarcinoma patient cancer tissue and adjacent tissue microarrays:

[0027] (1) Dewaxing and rehydrating: The sections were baked in a 65°C incubator for 2 h, then dewaxed in wax dewaxing transparent solution 1 and 2 for 10 min, and rehydrated in 100% ethanol, 95% ethanol, 85% ethanol, 75% ethanol, 50% ethanol, and water for 5 min, respectively.

[0028] (2) Heat antigen retrieval: Use an antigen retrieval solution containing 0.5 mM EDTA and 0.05% Tween, place the sections in a 95°C water bath for 25 min of heat antigen retrieval. After retrieval, take out the sections and cool them naturally to room temperature. Wash them with PBS solution three times, 5 min each time.

[0029] (3) Removal of endogenous catalase: The sections were placed in a 3% hydrogen peroxide solution (prepared with 100% methanol) for 10 min to remove endogenous catalase in the tissue sections, and then washed three times with PBS, each time for 5 min.

[0030] (4) Blocking: Use PBS solution to prepare 3% fetal bovine serum solution, use an immunohistochemistry pen to draw a circle around the tissue of the slice, and then add 3% fetal bovine serum solution in the circle for blocking for 10 minutes.

[0031] (5) Incubation with primary antibody: Discard the blocking serum, add 1:100 PDLIM4 primary antibody prepared in PBS to the sections, place in a wet box, and incubate in a 4°C refrigerator for 16 h.

[0032] (6) Incubation with secondary antibody: Take out the wet box from the 4°C refrigerator, wait for the sections to return to room temperature, and then wash them with PBS three times, 5 minutes each time. Then add horseradish peroxidase-labeled secondary antibody (Proteintech, ready-to-use HRP-labeled goat anti-mouse / rabbit secondary antibody), incubate at room temperature for 30 minutes, and wash with PBS solution three times, 5 minutes each time.

[0033] (7) DAB staining: Use DAB staining solution for color development and observe the degree of staining under a microscope. Stop staining in time after about 3 minutes.

[0034] (8) Nuclear staining: Soak in distilled water for 2 minutes, then place in hematoxylin solution for 8 minutes, rinse with tap water 3 times. Differentiate in 70% alcohol containing 1% hydrochloric acid for 3-5 seconds, and return to blue in water for 40 minutes. (You can observe whether the nucleus has been stained blue under a microscope).

[0035] (9) Dehydration, transparency, and sealing with neutral resin sealing medium: Dehydrate in 50% ethanol, 75% ethanol, 85% ethanol, 95% ethanol, and 100% ethanol for 5 min, respectively. Then, use wax dewaxing and transparent solution 1 and 2 for 10 min, respectively. After taking out, wiping and drying, seal the slides with neutral resin sealing medium.

[0036] (10) After the sealing film is dried, the images are taken under a microscope and then statistically scored. Figure 1 A and D in Figure ), and PDLIM4-related survival analysis was performed based on the scores and patient information of tissue origin ( Figure 1 E).

[0037] The results showed that the PDLIM4 gene was highly expressed in tumors, and patients with high expression of PDLIM4 had a good prognosis.

[0038] Example 2

[0039] Construction and expression verification of recombinant lentiviral vectors for overexpression and knockdown of PDLIM4 gene

[0040] Construction of recombinant lentiviral vector for overexpression of PDLIM4 gene

[0041] (1) Design PCR primers: Find the PDLIM4 coding sequence on the National Center for Biotechnology Information website, select pLVX-EF1a-IRES-Puro (purchased from Hunan Fenghui Biotechnology Co., Ltd.) as the vector, use Primer Premier 5 software, add FLAG tag protein sequence to the primers according to the PDLIM4 sequence and vector restriction site, and design appropriate PCR primers. The primer sequence is:

[0042] PDLIM4-EcoR I (SEQ ID No. 1):

[0043] GGAATTCATGGGAGACTACAAGGACGATGATGACAAGATGCTGCC CTGCTTCCAAC

[0044] PDLIM4-Not 1 (SEQ ID No. 2):

[0045] ATAAGAATGCGGCCGCTTAGGTCTGAATGCCAGCCC

[0046] (2) Amplification of PDLIM4 fragment: Using the cDNA obtained by reverse transcription of mRNA of lung adenocarcinoma cell H1299 as a template, PCR amplification of PDLIM4 fragment was performed, and a 50 μl PCR reaction system was prepared. The system is as follows:

[0047] High-fidelity DNA polymerase 1 μl

[0048] 5xSF buffer 10μl

[0049] Primer (10 μM) 2 μl each

[0050] cDNA 2μl

[0051] dNTP (10 μM) 1 μl

[0052] Make up to 50 μl with ddH2O.

[0053] PCR reaction, the procedure is as follows:

[0054] 1. Pre-denaturation at 95℃ for 5 minutes

[0055] 2. Denaturation at 95℃ for 30s

[0056] 3. Annealing at 60℃ for 15s

[0057] 4. Extension at 72℃ for 30s

[0058] 35 cycles of steps 2-4

[0059] Continue extension: 72℃ for 10min.

[0060] (3) Identification and gel recovery: The PCR product was subjected to agarose gel electrophoresis, and the target DNA band of about 1 kb was cut out under ultraviolet light and gel recovery was performed using a gel recovery kit (TIANgel Company).

[0061] (4) Enzyme digestion and ligation: The PCR product recovered from the gel and the lentiviral vector pLVX-EF1a-IRES-Puro were double-digested at 37°C using restriction endonucleases EcoR I and Not I, respectively. The enzyme digestion system is as follows:

[0062] PCR product digestion system:

[0063] EcoR I, Not I 1 μl each

[0064] O buffer 2ul(10x)2μl

[0065] 16 μl of PCR product was recovered from gel.

[0066] Lentiviral vector restriction enzyme digestion system:

[0067] EcoR I, Not I 1 μl each

[0068] O buffer 2ul(10x)2μl

[0069] Lentiviral vector: 1 μg

[0070] Make up to 20 μl with water.

[0071] Incubate at 37°C for 16 hours.

[0072] The double-enzyme digestion product was purified using a universal DNA purification kit (TIANgel), and the purified product was enzyme-ligated.

[0073] Enzyme-linked system:

[0074] 5 μl of purified lentiviral vector product

[0075] PCR fragment purification product 12μl

[0076] T4 ligase 1 μl

[0077] T4 ligase buffer (10x) 2 μl;

[0078] The enzyme was incubated for 16 h at a constant temperature of 16°C in a PCR instrument.

[0079] (5) Conversion

[0080] 1. Thaw the competent DH5a cells on ice.

[0081] 2. Add the above 20 μl ligation product into 30 μl competent cells and gently pipette to mix.

[0082] 3. Place on ice for 30 minutes.

[0083] Heat shock in a 42℃ water bath for 90s and place on ice for 5min.

[0084] 5. Add 500 μl of LB liquid culture medium without antibiotics and culture at 37°C and 200 rpm for 60 min.

[0085] 6. Centrifuge at 3000 rpm for 5 min, leaving about 100 μl of liquid to mix the bacteria.

[0086] 7. Add the bacterial solution to the LB plate, spread it evenly with a sterile spreading rod, and invert and culture at 37℃ for 16 hours.

[0087] (6) Identification: After the plate is recovered, about 50-100 colonies can be seen. Use a 10 μl pipette tip to pick up a single growing colony and put it into 10 μl sterile water. Gently pipette and use it as a PCR template for colony PCR identification.

[0088] The PCR system is:

[0089] DNA polymerase Taq 1 μl

[0090] 10x Taqbuffer 2μl

[0091] Primer (10 μM) 1 μl each

[0092] Bacterial liquid template 4μl

[0093] dNTP (10uM) 1μl

[0094] Make up to 20 μl with ddH2O.

[0095] Agarose gel electrophoresis was performed, and colonies with positive PCR results were obtained after ultraviolet irradiation. 1 μl of the positive bacterial solution was taken, added to 6 ml of liquid LB medium containing antibiotics, and cultured at 37°C and 200 rpm for 16 hours, and then the plasmid was extracted using a plasmid mini-extraction kit (TIANgel Company), and then plasmid PCR identification was performed.

[0096] The PCR system is:

[0097] DNA polymerase Taq 1 μl

[0098] 10x Taqbuffer 2μl

[0099] Primer (10 μM) 1 μl each

[0100] Plasmid 1μl

[0101] dNTP (10uM) 1μl

[0102] Make up to 20 μl with ddH2O.

[0103] Agarose gel electrophoresis was performed and the plasmid with a positive PCR result was obtained after ultraviolet irradiation. The plasmid was sent to Qingke Biotechnology Company for sequencing. After the results were obtained, BLAST was performed on the National Center for Biotechnology Information website to obtain the pLVX-EF1a-IRES-Puro-PDLIM4 plasmid with no mutation in the target fragment and completely correct sequence.

[0104] The PDLIM4 knockdown recombinant lentiviral vector was obtained: PLVX-shRNA2-PDLIM4 (constructed by Ubao Biotech), plasmid functional sequence (SEQ ID No. 3): CCGGGCACACAGGATCCACATCGATCTCGAGATCGATGTGGATCCTGTGTGCTTTTTT.

[0105] Stable cell line construction:

[0106] (1) Cell preparation: 293T cells were cultured in a 10 cm cell culture dish using DMEM medium containing 10% fetal bovine serum and passaged once every 2-3 days.

[0107] (2) Cell plating: When the density of 293T cells reaches 90%, plating is performed. The specific steps are as follows: aspirate the culture medium, add 5 ml of PBS solution for washing, aspirate the PBS, add 1 ml of trypsin containing 0.02% EDTA, act for 1 min, add DMEM culture medium containing 10% fetal bovine serum to terminate digestion, blow off the cells, collect them in a centrifuge tube, centrifuge at 1000 rpm for 3 min, aspirate the supernatant, add culture medium to resuspend for plating.

[0108] (3) Transfection: 12 h after plating, the cell density was about 60%, and the culture medium was replaced with serum-free medium.

[0109] Prepare the transfection system:

[0110] 1.pLVX-EF1a-IRES-Puro-PDLIM4 transfection system:

[0111] 200 μl serum-free medium

[0112] pLVX-EF1a-IRES-Puro-PDLIM4 plasmid 12 μg

[0113] VSVG packaging plasmid 9 μg

[0114] DR packaging plasmid 6 μg

[0115] Lipo 8000 transfection reagent 54 μl

[0116] 2.PLVX-shRNA2-PDLIM4 system:

[0117] 200 μl serum-free medium

[0118] PLVX-shRNA2-PDLIM4 plasmid 12 μg

[0119] VSVG packaging plasmid 9 μg

[0120] DR packaging plasmid 6 μg

[0121] Lipo 8000 transfection reagent 54 μl

[0122] Mix by gently pipetting and incubate for 15 min, then add dropwise to the 293T cell culture dish and place in a 37°C incubator.

[0123] (4) Lentivirus packaging: 8 h after transfection, the culture medium was replaced with DMEM medium containing 10% fetal bovine serum and culture was continued. During the period, care was taken to add culture medium so that the color of the culture medium in the culture dish did not change to yellow and to ensure that the pH value did not change significantly, thereby affecting the lentivirus packaging. 72 h after transfection, the culture supernatant was collected and filtered with a 4.5 μm diameter sterile filter to obtain a lentivirus supernatant containing pLVX-EF1a-IRES-Puro-PDLIM4 and PLVX-shRNA2-PDLIM4.

[0124] (5) Lentivirus infection and screening: Lung adenocarcinoma cells A549 and H1299 (purchased from the ATCC cell bank in the United States) were cultured in 1640 medium containing 10% fetal bovine serum. When the cell density reached 90%, they were plated on a 6 cm cell culture dish. 12 hours after plating, the cell density was about 60%, and 3 μl of lentivirus suspension was added, and polybrene (final concentration of 10 ug / ml, which greatly enhanced the infection efficiency) was added. After 48 hours of infection, puromycin (final concentration of 1 μg / ml) was added for screening. Lung adenocarcinoma cells not infected with lentivirus would be killed. After 72 hours of screening, the surviving cells were stably transfected cell lines infected with pLVX-EF1a-IRES-Puro-PDLIM4 and PLVX-shRNA2-PDLIM4.

[0125] Western blotting of stable cell lines:

[0126] (1) Collecting cells and extracting proteins: Collect lung adenocarcinoma cells from a 6 cm cell culture dish, wash with pre-cooled PBS, centrifuge at 4000 rpm, discard the supernatant, retain the cell pellet, add 400 μl of RIPA cell lysis buffer and protease inhibitor PMSF (final concentration 1 mM, add immediately before use), lyse on ice for 30 min, centrifuge at 12000 rpm at 4°C for 10 min, take 350 μl of supernatant, add 70 μl of 6xprotein loading buffer, mix well by pipetting, place in a 95°C metal bath for 15 min, and store in a -80°C refrigerator after aliquoting to obtain a denatured and stable cell protein sample.

[0127] (2) SDS-PAGE gel electrophoresis: Install the glass plate, fix it, and prepare 10% separation gel for SDS-PAGE gel.

[0128] Separation gel formula:

[0129] Ultrapure water 4ml

[0130] 30% acrylamide 3.3ml

[0131] 1.5M Tris-HCL (PH 8.8) 2.5ml

[0132] 10% SDS 100 μl

[0133] 10% ammonium persulfate 100 μl

[0134] TEMED 4 μl

[0135] After the separation gel solidifies, start preparing the concentrated gel and gently insert the comb, taking care to avoid bubbles under the comb.

[0136] Concentrated gel formula:

[0137] Ultrapure water 2.1ml

[0138] 30% acrylamide 0.5ml

[0139] 1.0M Tris-HCL (PH 6.8) 0.38ml

[0140] 10% SDS 30 μl

[0141] 10% ammonium persulfate 30 μl

[0142] TEMED 3μl

[0143] After the concentrated gel solidifies, gently remove the comb, put it into the electrophoresis tank, add electrophoresis buffer, load the sample with a 10μl small gun tip, add a protein standard molecular weight marker, fill the sample wells with 1x protein loading buffer, turn on the power, and perform 80V constant voltage electrophoresis. After the sample electrophoresis exceeds the concentrated gel, switch to 120V constant voltage electrophoresis, and stop the electrophoresis when bromophenol blue electrophoresis reaches the bottom of the gel.

[0144] (3) Transfer: Place sponge, filter paper, glue, PVDF membrane (needs to be soaked in methanol for 5 min), filter paper, and sponge in the transfer clip from negative to positive. Be careful not to have bubbles between the glue and PVDF membrane. Cover the transfer clip and transfer to the transfer tank. Fill the transfer tank with transfer solution, turn on the power, and transfer at a constant voltage of 80 V for 60 min.

[0145] (4) Blocking: Add 1% Tween 20 to the PBS solution to prepare a PBST solution, then use the PBST solution to prepare a blocking solution containing 5% skim milk, soak the PVDF membrane, and shake it slowly on a shaker at room temperature for 60 minutes.

[0146] (5) Incubation of primary and secondary antibodies: Prepare primary antibody diluent with the following formula:

[0147] Fetal bovine serum: 3g

[0148] 10% sodium azide: 200 μl

[0149] Add PBST to 100 ml.

[0150] Dilute the primary antibody (1:1000) with the primary antibody diluent, place the PVDF membrane and the diluted primary antibody in an incubation box, incubate in a 4°C refrigerator for 16 hours, recover the primary antibody after incubation, and wash it 3 times with PBST solution on a shaker, 5 minutes each time. Add the secondary antibody (1:5000) diluted with 3% fetal bovine serum, incubate in a 4°C refrigerator for 1-2 hours, recover the secondary antibody after incubation, and wash it 3 times with PBST solution on a shaker.

[0151] (6) Color development: The substrates westein Lumaxl Light Peroxide A and B were mixed in a 1:1 ratio to form a working solution. The working solution was covered on the PDVF membrane, placed on an exposure instrument for color development and the image was saved. It can be seen that after infection with pLVX-EF1a-IRES-Puro-PDLIM4, the expression of PDLIM4 protein in lung adenocarcinoma cells was significantly increased, and after infection with PLVX-shRNA2-PDLIM4, the expression of PDLIM4 protein in lung adenocarcinoma cells was significantly decreased ( Figure 2 A and B in ).

[0152] Example 3

[0153] Verification of the effect of PDLIM4 on proliferation ability in stable cell lines

[0154] Colony formation assay:

[0155] After cell passage, 400 stably transfected cell lines were plated in six-well plates. The plated cells were A549 and H1299 cells overexpressing pLVX-EF1a-IRES-Puro-PDLIM4, PLVX-shRNA2-PDLIM4, and pLVX-EF1a-IRES-Puro (empty), respectively. The cells were cultured in a 37°C cell culture incubator, and the culture medium was changed once every 2-3 days. After 10 days, the cells were treated by fixing with 4% paraformaldehyde for 10 minutes, then staining with 0.05% crystal violet for 15 minutes. After staining, the crystal violet was discarded, and the six-well plates were washed with ultrapure water 3-5 times. After being inverted and dried, images were taken. The analysis results showed that after overexpression of PDLIM4, the proliferation of lung adenocarcinoma cells was inhibited, and after knocking down PDLIM4, the proliferation rate of lung adenocarcinoma cells was more obvious ( Figure 3 A and E in ).

[0156] Cell proliferation assay:

[0157] After cell passage, 1000 cells of the stable cell line were plated in a 96-well plate, and three replicate control groups were set up. The plated cells were A549 and H1299 cells overexpressing pLVX-EF1a-IRES-Puro-PDLIM4, PLVX-shRNA2-PDLIM4, and pLVX-EF1a-IRES-Puro, respectively. The proliferation ability of A549 and H1299 stable cell lines was detected using the CCK8 (Cell Counting Kit) kit. The culture medium was replaced every 24 hours, and 180 μl of culture medium and 20 μl of CCK8 were added to each well. After incubation in a 37°C incubator for 2 hours, the absorbance was detected at λ=450nm using an ELISA reader. The data were collected and statistically analyzed. It can be seen that after overexpressing PDLIM4, the proliferation of lung adenocarcinoma cells was inhibited, and the proliferation of lung adenocarcinoma cells was inhibited ( Figure 3 B and F in ).

[0158] Cell cycle detection

[0159] (1) Cell treatment: 1. The cell plating density is about 40%. When the cell density grows to about 80%, the culture medium is aspirated and trypsin is added for digestion. After digestion is complete, the culture medium is finally digested and the cells are blown away. Centrifuge at 300g / 5min, discard the culture medium, add 1ml cold PBS (pre-cooled on ice in advance), wash once at 30g / 5min, centrifuge and discard the supernatant, and flick the precipitate at the bottom of the tube.

[0160] (2) Cell fixation: Add the culture medium to 1 ml of ice-cold 70% ethanol, gently pipette to mix, and fix overnight at 4°C or -20°C. Centrifuge at 600g / 10min, discard the supernatant, add 1 ml of cold PBS, resuspend the cells, centrifuge at 600g / 10min, discard the supernatant, and flick the cells to prevent them from clumping.

[0161] (3) RNase digestion and PI staining: PI staining solution (50 μg / ml PI + 50 μg / ml RNAase) was added to the 500 ml system for staining, and incubated at 37°C in the dark for 30 min. Mix once during the staining process. After staining, store at 4°C or on ice in the dark.

[0162] (4) Flow cytometry analysis: Use a flow cytometer to detect red fluorescence (PE channel) at an excitation wavelength of 4880 nm, and acquire cells at a low speed. The low speed can ensure that the difference between cells is small and ensure higher accuracy. The analysis software (Modifit software) is used to analyze the cell DNA content. The results show that after overexpression of the PDLIM4 gene, the lung adenocarcinoma cell line is blocked at G2 / M ( Figure 3 D).

[0163] EdU detection of cell proliferation

[0164] (1) Cell preparation: Lysine-coated slides were placed on the bottom of a 6-well culture plate and sterilized by ultraviolet irradiation for 30 min. Stable lung adenocarcinoma cell lines A549 and H1299 in the logarithmic growth phase were obtained, digested with trypsin, centrifuged, and the supernatant was discarded. The cells were resuspended in culture medium and the cells were blown off to a single cell suspension. 2 × 10 cells were added to each well. 5 The cells were inoculated into a 6-well culture plate so that the cells were evenly attached to the slide.

[0165] (2) EDU labeling: First, dilute the EDU solution with cell culture medium at a ratio of 1000:1 to prepare an appropriate amount of 50 μM EDU. Add 100 μL of 50 μM EDU to each well. After incubation for 2 h, discard the culture medium and wash the cells twice with PBS, each time for 5 min.

[0166] (3) Cell fixation: 50 μl of 4% paraformaldehyde fixative was added to each well and fixed at room temperature for 30 min. After discarding the fixative, 50 μl of 2 mg / ml glycine was added to each well. After incubation on a decolorizing shaker for 5 min, the cells were washed with PBS three times, each time for 5 min.

[0167] (4) Apollo staining: Add 100 mL of 1X Apollo@ staining reaction solution to each well at room temperature and in the dark, place on a decolorizing shaker and incubate for 30 min, then discard the staining reaction solution. Add 100 μl of 0.5% TritonX-100 in PBS, and wash 2-3 times on a decolorizing shaker, 10 min each time.

[0168] (5) DNA staining: At room temperature and in the dark, first dilute the reagent Hoechst 33342 at a ratio of 100:1 to prepare an appropriate amount of 1X Hoechst 33342 reaction solution. Add 100 μl of 1X Hoechst 33342 reaction solution to each well, incubate on a decolorizing shaker for 30 minutes, then discard the staining reaction solution and add 100 μl of PBS to each well for 1-3 washes.

[0169] (6) Image acquisition and analysis: Immediately after staining, images were acquired using a confocal fluorescence microscope. It was found that overexpression of the PDLIM4 gene inhibited the proliferation of lung adenocarcinoma cells ( Figure 3 C).

[0170] Example 4 Searching for upstream and downstream regulatory factors of the PDLIM4 gene

[0171] In H1299 cells, BRD4 plasmid was transiently transfected and RNA-SEQ analysis was performed. The value of log2FoldChange>1.2 was determined to be a gene that can increase expression with the high expression of BRD4. (All highly expressed genes are in Excel Table 1). Therefore, it was concluded that after overexpression of BRD4, the RNA level of PDLIM4 increased ( Figure 4 A).

[0172] Table 1 RNA-SEQ analysis of some genes with increased expression levels after transient transfection with BRD4 plasmid

[0173]

[0174]

[0175] The function of BET proteins (BRD2, BRD3, BRD4) was inhibited by JQ1, and the cell RNA was extracted for reverse transcription. The mRNA level of PDLIM4 was verified by fluorescence quantitative PCR experiment:

[0176] (1) Cell plating: Lung adenocarcinoma cell lines A549 and H1299 were plated on six-well plates after cell passage and cultured in a 37°C incubator for 12 h.

[0177] (2) Inhibition of BET protein function: 12 hours after cell plating, the culture medium was replaced with 1640 culture medium containing 0.5% fetal bovine serum for starvation. After 24 hours, the BET protein inhibitor JQ1 was added and treated with a time gradient (0h, 6h, 12h, 24h) and concentration gradient (0μM, 0.01μM, 0.1μM, 1μM).

[0178] (3) Trizol method to extract cell mRNA:

[0179] 1. Aspirate the culture medium in the cells and wash the cells with 1 ml PBS. Add 1 ml of cell RNA lysis solution (Trizol), pipette repeatedly, and collect the cells in a 1.5 ml enzyme-free sterile centrifuge tube.

[0180] 2. Add 200 μl of chloroform and shake vigorously.

[0181] 3. Centrifuge at 12000 rpm for 10 min in a 4°C centrifuge.

[0182] 4. Carefully pipette the upper transparent liquid after centrifugation into another 1.5 ml enzyme-free sterile centrifuge tube, add an equal volume of isopropanol and mix well.

[0183] 5. Centrifuge at 12000rpm for 10min. A white precipitate the size of a rice grain can be seen at the bottom of the tube. Carefully discard the supernatant.

[0184] 6. Wash the white precipitate with 1 ml of 75% ethanol. Centrifuge at 4°C, 12,000 rpm for 10 min, discard the supernatant and keep the precipitate.

[0185] 7. Leave at room temperature for 5 to 10 minutes to allow the white precipitate to dry to translucent state. Add DEPC water to dissolve the precipitate depending on the amount of precipitate and measure the RNA concentration.

[0186] (4) Reverse transcription:

[0187] Prepare 20 μl reverse transcription system:

[0188] mRNA 1 μg

[0189] 5xqRT SuperMix (Novozyme) 4μl

[0190] Make up to 20 μl with DEPC water.

[0191] PCR instrument for reverse transcription, reaction procedure:

[0192] 50℃15min

[0193] 85℃5s

[0194] Obtain the reverse transcription product cDNA.

[0195] (5) Fluorescence quantitative PCR:

[0196] The QPCR primers for GAPDH and PDLIM4 were found through published literature, and the sequences are:

[0197] GAPDH-QPCR-F (SEQ ID No. 4): CATGTTCGTCATGGGTGTGAACCAGAPDH-QPCR-R (SEQ ID No. 5): ATGGCATGGACTGTGGTCATGAGTPDLIM4-QPCR-F (SEQ ID No. 6): CATCGTGGGCACCATCGTCA

[0198] PDLIM4-QPCR-R (SEQ ID No. 7): GCCGCTCGTCCAGAAAGAAGTAA Prepare 10 μl of fluorescent quantitative PCR reaction system in a 96-well plate:

[0199] Primers: 0.5 μl each for forward and reverse primers

[0200] cDNA: 1 μl

[0201] DEPC water 3μl

[0202] 2xchamQ SYBR qPCR MasterMix (Novozyme) 5μl

[0203] Fluorescence quantitative PCR was performed on a QS6P QPCR instrument. The reaction procedure was as follows:

[0204] 1.95℃5min

[0205] 2.95℃20s

[0206] 3.60℃20s

[0207] 4.72℃20s

[0208] Steps 2-4 were repeated for 40 cycles. A reasonable threshold was set, fluorescence signals were collected, and CT values ​​were obtained in the exponential amplification phase. The relative expression level of the target gene was measured by 2 -△△Ct The analysis showed that with the increase of JQ1 stimulation time and concentration, the mRNA level of PDLIM4 decreased significantly ( Figure 4 C and E in.

[0209] The function of BET proteins (BRD2, BRD3, and BRD4) was inhibited by JQ1, and cell proteins were extracted, and the PDLIM protein level was verified by western blotting.

[0210] (1) Cell plating: Lung adenocarcinoma cell lines A549 and H1299 were plated on six-well plates after cell passage and cultured in a 37°C incubator for 12 h.

[0211] (2) Inhibition of BET protein function: 12 hours after cell plating, the culture medium was replaced with 1640 culture medium containing 0.5% fetal bovine serum for starvation. After 24 hours, the BET protein inhibitor JQ1 was added and treated with a time gradient (0h, 12h, 24h, 48h) and concentration gradient (0μM, 0.01μM, 0.1μM, 1μM).

[0212] (3) Cell proteins were extracted for western blot analysis (the specific experimental process has been described in detail above). The results showed that as the duration and concentration of JQ1 stimulation increased, the protein level of PDLIM4 decreased significantly ( Figure 4 B and D in ).

[0213] By knocking down the expression of specific BET proteins (BRD2, BRD3, BRD4), cellular proteins were extracted and PDLIM protein levels were verified by western blotting experiments.

[0214] (1) Cell plating: Lung adenocarcinoma cell lines A549 and H1299 were plated on six-well plates after cell passage and cultured in a 37°C incubator for 12 h.

[0215] (2) Plasmid transfection: 12 hours after cell plating, the density was about 40%. Before transfection, the culture medium containing 10% fetal bovine serum was replaced.

[0216] The shRNA plasmids of BRD2, BRD3, and BRD4 were purchased from Qingke Biotechnology.

[0217] The plasmid functional sequence is:

[0218] BRD2-shRNA (SEQ ID No. 8):

[0219] CCGGGCTGCTGATGTACGGCTTATGCTCGAGCATAAGCCGTACAT CAGCAGCTTTTT

[0220] BRD3-shRNA (SEQ ID No.9):

[0221] CCGGGGGAGATGCTATCCAAGAAGCCTCGAGGCTTCTTGGATAG CATCTCCCTTTTTT

[0222] BRD4-shRNA (SEQ ID No. 10):

[0223] CCGGCAGAGTGATCTATTGTCAATACTCGAGTATTGACAATAGAT CACTCTGTTTTTT.

[0224] Prepare the transfection system:

[0225] ShRNA plasmid: 2ug

[0226] Lopo8000 transfection reagent: 4ul

[0227] Serum-free medium: 100ul.

[0228] The specific transfection steps have been described in detail previously.

[0229] Cell proteins were extracted 72 hours after transfection and subjected to western blot analysis (the specific experimental steps have been described in detail above). The results showed that after knocking down BRD4, the protein level of PDLIM4 was significantly reduced, indicating that the upstream protein member of the BET protein family that mainly regulates PDLIM4 is BRD4 ( Figure 4 F, G and H in.

[0230] By overexpressing BD1 and BD2 of BRD4, the functions of the two important domains of BRD4 are competitively inhibited.

[0231] Construct BD1 and BD2 overexpression plasmids with GFP tags on pcDNA3.0 (the specific construction steps have been described in detail before)

[0232] Primer sequences:

[0233] BRD4-BD1-BamHI-F(SEQ ID No.11):

[0234] CGGGATCCAGGCAGACCAACCAACTGC

[0235] BRD4-BD1-xbal-R(SEQ ID No.12):

[0236] GCTCTAGATTGCAAGAAGAGCTTTTCCAG

[0237] BRD4-BD2-BamHI-F(SEQ ID No.13):

[0238] CGGGATCCAAGGTCTCGGAGCAGCTCAAG

[0239] BRD4-BD2-xbaI-R(SEQ ID No.14):

[0240] GCTCTAGAAGGCTCGTCCGGCATCTTG

[0241] After successful construction, amplify the plasmid.

[0242] 3 μg of each plasmid was transfected (the specific experimental steps have been described in detail before).

[0243] After 24-48 hours of transfection, cell proteins were extracted and western blot experiments were performed (the specific experimental steps have been described in detail before). The results showed that after overexpression of BRD4-BD1, the protein level of PDLIM4 was significantly reduced, suggesting that BRD4-BD1 is the one that regulates PDLIM4 among the two important domains in BRD4 ( Figure 4 J in.

[0244] Chromatin immunoprecipitation experiments further verified that BRD4 binds to the promoter of the PDLIM4 gene and regulates the transcription of PDLIM4:

[0245] (1) Cross-linking and cell harvesting

[0246] 1. The cells were subcultured and plated in 10 cm cell culture dishes and divided into untreated group, BRD4 overexpression group and JQ1 group for treatment. After the cells were fully grown, 37% formaldehyde solution was added according to the volume of the culture medium to make the final concentration 1%. The cells were shaken slowly on a shaker at room temperature for 10 minutes to allow DNA and protein to form crosslinks. (PBS can be used to prepare 1% formaldehyde solution).

[0247] 2. Add 1.25 M glycine according to the volume of culture medium to make the final concentration 125 mM. Shake slowly on a shaker at room temperature for 5 minutes to terminate the cross-linking reaction.

[0248] 3. Wash the cells twice with 10 ml of pre-cooled PBS.

[0249] 4. Add 1 ml of solution A, scrape the cells and collect them in a 1.5 ml centrifuge tube. Centrifuge at 4000 rpm and 4°C for 5 min, discard the supernatant and keep the precipitate.

[0250] (2) Ultrasonic fragmentation

[0251] 1. Add 600 μl solution C (add protease inhibitors before use), resuspend the cells, and vortex to lyse the cells. After ultrasound, run DNA gel to check the fragment size (DNA gel concentration is suitable at about 1.5%), and the fragment size of 200-1000 bp is optimal.

[0252] 2. Centrifuge at 12000 rpm, 4°C for 15 min. Take the supernatant and discard the precipitate.

[0253] (3) Preclear samples

[0254] 1. Add 50 μl proteinA / G beads and protamine (final concentration 200 μg / ml. Mother solution 10 mg / ml, prepared with ddH2O) to 400-500 μl supernatant and incubate at 4°C with rotation for 2 h.

[0255] 2. Centrifuge at 12000 rpm, 4°C for 15 min. Take the supernatant and discard the precipitate.

[0256] 3. Take out 20 μl from the supernatant as input.

[0257] (4) Combination

[0258] 1. Take 200μl supernatant, add 4μl primary antibody, 8μl proteinA / G beads, protamine (final concentration 200μg / ml) and BSA (final concentration 1mg / ml), and add Chip1 solution to the total volume to 300μL. Incubate at 4℃ with rotation overnight or for 4-6h. Freeze the remaining supernatant at -80℃ for later use.

[0259] (5) Cleaning

[0260] Centrifuge at 1.4°C, 3000 rpm for 1 min to precipitate beads and discard the supernatant.

[0261] 2. Wash the beads with 400 μl of Chip1 solution, Chip2 solution, Chip3 solution and TE solution in turn. Add DTT (final concentration is 1 mM) to these four solutions during washing.

[0262] (6) Proteinase K digestion

[0263] 1. Add 100 μl of elution buffer (0.5% SDS, 0.1 M NaHCO3 and 5 μg proteinase K). The input sample should also undergo this step and subsequent treatment. The elution buffer should be prepared before use.

[0264] Shake at 25°C on a molecular hybridization instrument overnight or for 6 hours.

[0265] (7) DNA purification, precipitation and dissolution

[0266] 1. Add 300 μL of phenol chloroform to each tube and shake vigorously until white milky substance can be seen. Centrifuge at 8000 rpm, 4℃ for 3 min, take the supernatant and discard the beads. Repeat the extraction 2-3 times until no white milky substance appears and the supernatant is clear.

[0267] 2. Take the supernatant, add 100 μL of chloroform, shake vigorously, centrifuge at 8000 rpm, 4°C for 3 min, and take the supernatant.

[0268] 3. Add 300 μL (3 times volume) of anhydrous ethanol, 10 μL (1 / 10 volume) of 3M NaOAc, and 0.3 μL (1 / 100 volume) of glycogen (20 mg / ml), and precipitate at -20°C for 30 min.

[0269] 4. Centrifuge at 12000rpm for 10min at room temperature.

[0270] 5. Discard the supernatant and wash the precipitate once with 70% ethanol.

[0271] 6. Centrifuge at 12000 rpm for 10 min at room temperature. After absorbing as much ethanol as possible, dry the precipitate.

[0272] 7. Add 40μl TE to dissolve the DNA. The input group can be dissolved with 60-80μl TE.

[0273] (8) PCR reaction: The results of Chip can be reflected by Q-PCR experiment, or by ordinary PCR and then running DNA gel. Then perform fluorescence quantitative PCR (Q-PCR) experiment, Q-PCR primer sequence:

[0274] PDLIM4-chip-F(SEQ ID No.15):CCCAGATCCCCTGTGTATCC

[0275] PDLIM4-chip-R(SEQ ID No.16):AAGCCCGCCTCTACAGCATG

[0276] The Q-PCR primer sequence binds to the promoter sequence of PDLIM4. The results suggest that BRD4 binds to the promoter of the PDLIM4 gene and regulates the transcription of PDLIM4.

[0277] After overexpression of BRD4, cell immunofluorescence analysis was performed

[0278] (1) Cell preparation: Place a lysine-coated slide on the bottom of a 24-well culture plate and sterilize it by ultraviolet irradiation for 30 min. Take the stable lung adenocarcinoma cell lines A549 and H1299 in the logarithmic growth phase, digest them with trypsin, centrifuge, discard the supernatant, resuspend the cells in culture medium, blow the cells apart to a single cell suspension, and inoculate 5 × 104 cells per well in a 24-well culture plate so that the cells are evenly attached to the slide.

[0279] (2) Transfection: ov-flag-BRD4 plasmid purchased from Qingke Biotechnology was transfected with 0.5 μg of plasmid 24 hours later (the specific experimental steps have been described in detail above), the culture medium was discarded, and the cells were washed 1-2 times with PBS. Be careful not to wash off the cells.

[0280] (3) Fixation: Fix the cells with 500 μl of paraformaldehyde for 15 min, discard the culture medium, add 500 μl of PBS and wash by shaking on a shaker for 5 min, for a total of 3 times.

[0281] (4) Penetration: Add 500 μl of 0.5% Triton X-100 in PBS, let stand for 10 min, discard the liquid, add 500 μl of PBS and shake slowly on a shaker for 5 min, repeat 3 times.

[0282] (5) Add 3% BSA and incubate at room temperature for 1 h to block nonspecific proteins.

[0283] (6) Aspirate BSA, add primary antibodies (DAPI, BRD4, PDLIM4 diluted 1:100), and incubate at 4°C for 16 h.

[0284] (7) Recover the primary antibody, wash with PBS 2-3 times, add fluorescent secondary antibody with corresponding excitation wavelength, dilute the secondary antibody with PBS according to the instructions, and incubate at 4°C in the dark for 2 h.

[0285] (8) Add 500 μl PBS and shake slowly on a shaker for 5 min, three times in total.

[0286] (9) The slides were transferred to a glass slide, fixed with neutral resin, and photographed and analyzed under a laser confocal fluorescence microscope. The results showed that when BRD4 was overexpressed, the protein level of PDLIM4 was also significantly increased ( Figure 4 I in.

[0287] Immunohistochemical staining of BRD4 was performed on clinical pathological tissues (the specific steps have been described in detail above): BRD4 and PDLIM4 have consistent expression, that is, in cancer tissues and adjacent tissues with high expression of BRD4, PDLIM4 is also highly expressed, and the two have a significant correlation ( Figure 4 in K).

[0288] In the data analysis of TCGA database, it was found that PDLIM4 and P21 expression had a significant correlation ( Figure 5 A).

[0289] Through immunofluorescence experiments (the specific steps have been described in detail before), it can be seen that PDLIM4 and P21 are co-localized ( Figure 5 B).

[0290] After overexpression and knockdown of PDLIM4, protein immunoblotting and Q-PCR (the specific steps have been described in detail before) showed that the protein level and mRNA level of P21 were significantly increased and decreased after overexpression and knockdown of PDLIM4 ( Figure 5 C, F and G in the figure).

[0291] After overexpression of PDLIM4, immunofluorescence experiments were performed (the specific steps have been described in detail above). After overexpression of PDLIM4, the expression level of P21 was significantly increased ( Figure 5 D).

[0292] After JQ1 stimulation, overexpression of BRD4, knockdown of BRD4, and overexpression of BRD4-BD1, protein immunoblotting experiments were performed (the specific steps have been described in detail above), and the expression levels of PDLIM4 and P21 increased and decreased accordingly ( Figure 5 G, H, I, J, K, L and M in.

[0293] After knocking down PDLIM4, the mRNA level of P21 increased and decreased ( Figure 5 O in the.

[0294] After overexpression of BRD4 and knockdown of PDLIM4, it can be clearly seen through protein immunoblotting experiments and Q-PCR (the specific steps have been described in detail before) that the protein and mRNA levels of PDLIM4 and P21 increased and decreased accordingly ( Figure 5 N and P in the above), combined with the above combination, it can be concluded that BRD4 regulates the mRNA transcription of P21 by regulating the expression of PDLIM4, thereby affecting its expression.

[0295] Example 5

[0296] PDLIM4 can promote the anticancer effect of doxorubicin on lung adenocarcinoma cells A549 and H1299

[0297] After adding the anticancer drug doxorubicin, the protein levels of BRD4, PDLIM4, and P21 in lung adenocarcinoma cells A549 and H1299 were significantly increased: 12 hours after cell plating, the density was about 60%, and doxorubicin (final concentration 0.5μM) was added for 48 hours to stimulate the cells, and the cell proteins were extracted for protein immunoblotting experiments (the specific steps have been described in detail before). The protein levels of BRD4, PDLIM4, and P21 were significantly increased ( Figure 6 A and B in ).

[0298] On the basis of effective stimulation by doxorubicin, treatment with JQ1 (final concentration 1 μm) and transfection of shRNA plasmids of BRD4 and PDLIM4 (the specific steps have been described in detail before) can reduce the corresponding increased protein expression levels, which also further strongly illustrates that BRD4 controls the expression of P21 by regulating the expression of PLDIM4 ( Figure 6 C, D, E, F, G and H in the figure).

[0299] In the stable cell line control group and the PDLIM4 overexpression group, the CCK8 experiment was performed under the stimulation of doxorubicin concentration that can cause obvious apoptosis of lung adenocarcinoma cells:

[0300] First, the optimal concentration of doxorubicin was measured in the cells, that is, the concentration of doxorubicin that can make half of the cells lethal in 36-48 hours, which is about 5μM. The cells were plated in 96-well plates, and doxorubicin was added after the cells adhered to the wall. At the same time, the CCK8 experiment was performed at 0h, 5h, 10h, 20h, and 40h after the addition of doxorubicin. The absorbance was measured with an ELISA instrument (the specific steps have been described in detail before). Data were collected and statistically analyzed to make a cell survival curve. Doxorubicin can cause cell death. When PDLIM4 is overexpressed, cell death is more obvious. It is concluded that the expression of PDLIM4 will increase the apoptotic effect of doxorubicin on lung adenocarcinoma cells ( Figure 6 I in.

[0301] It can be seen from the above examples that the proliferation of non-small cell lung cancer cells overexpressing the PDLIM4 gene is inhibited, so confirming that the reagent that can achieve overexpression of the PDLIM4 gene is of great significance for inhibiting the proliferation of non-small cell lung cancer cells. At the same time, overexpression of the PDLIM4 gene in non-small cell lung cancer cells can enhance the chemotherapeutic effect of the chemotherapy drug doxorubicin and can be used as a chemosensitizer.

[0302] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Use of a reagent for overexpressing the PDLIM4 gene in the preparation of a drug for inhibiting lung adenocarcinoma, characterized in that: The PDLIM4 gene is overexpressed in lung adenocarcinoma cells, and the agent for overexpressing the PDLIM4 gene includes a recombinant vector for overexpressing the PDLIM4 gene.

2. The use according to claim 1, characterized in that: The agent inhibits the proliferation of lung adenocarcinoma cells.

3. The use according to claim 2, characterized in that: The lung adenocarcinoma cells are H1299 or A549.

4. Use of a reagent that overexpresses the PDLIM4 gene in the preparation of a sensitizer for doxorubicin in the treatment of lung adenocarcinoma, characterized in that: The reagent for overexpressing the PDLIM4 gene includes a recombinant vector for overexpressing the PDLIM4 gene.

Images