Monoclonal antibody against canine coronavirus N protein, immune colloidal gold test strip and preparation method thereof

Abstract

The present invention discloses a monoclonal antibody for canine coronavirus N protein, an immune colloidal gold test strip, and a preparation method thereof, and belongs to the field of biological detection technology. The present invention provides a hybridoma cell line, the hybridoma cell line is named 4A8, the deposit number of the 4A8 is CCTCC NO: C2024304, and the monoclonal antibody 4A8 secreted by the hybridoma cell line. Also disclosed is the use of the hybridoma cell line or the monoclonal antibody 4A8 in the preparation of a detection reagent or a detection kit for canine coronavirus. In addition, the present invention also discloses an immune colloidal gold test strip for detecting canine coronavirus N protein and a preparation method thereof. Among the 47 clinical samples tested, the total compliance rate of the colloidal gold test strip was 89.36%. The CCoV colloidal gold test strip detection method established by the present invention is convenient and sensitive, and is of great significance for the diagnosis, prevention and control of canine coronavirus disease.

Description

Technical Field

[0001] The present invention relates to the field of biological detection technology, in particular to a monoclonal antibody against canine coronavirus N protein, an immune colloidal gold test strip and a preparation method thereof. Background Art

[0002] Canine coronavirus (CCoV) disease is an acute enteric infection caused by canine coronavirus (CCoV). It is widely distributed worldwide, with the predominant genotype in China being CCoV-IIa. Currently, pet ownership in my country is increasing annually, and CCoV is often co-infected with canine parvovirus (CPV), canine rotavirus (CRV), and canine distemper virus (CDV), making diagnosis difficult and prone to widespread transmission. Therefore, establishing a rapid diagnostic test for CCoV disease is of great public health significance. Currently, several methods are available for detecting CCoV. Elia et al. developed an ELISA assay using the recombinant M protein (rMP) of type II CCoV. However, this method is time-consuming and labor-intensive, making it unsuitable for rapid and on-site testing. Decaro et al. developed an RT-qPCR assay targeting the M gene for the detection and quantification of CCoV RNA in dog feces. This method is highly sensitive but typically requires specific primers, skilled technicians, and specialized equipment.

[0003] Therefore, developing a rapid and sensitive detection technology is of great significance. Currently, the technologies used in China to detect CCoV are generally RT-qPCR, colloidal gold immunochromatography, and RT-PCR. However, research and development of colloidal gold test strips for canine coronavirus are limited, and the test strips are expensive and costly. Therefore, reducing testing costs, achieving domestication of the technology, and developing a rapid detection method are of great significance. Summary of the Invention

[0004] The present invention aims to provide a monoclonal antibody against canine coronavirus N protein, an immune colloidal gold test strip and a method for preparing the same, in order to solve the problems of the prior art. The test strip developed by the present invention has a higher sensitivity than commercial test strips.

[0005] To achieve the above object, the present invention provides the following solutions:

[0006] Technical solution 1: A hybridoma cell line, the hybridoma cell line is named 4A8 (Hybridoma cellline 4A8), the preservation number of 4A8 is CCTCC NO: C2024304, the preservation date is October 18, 2024, and it is deposited in the China Center for Type Culture Collection, and the preservation address is Wuhan University, Wuhan, China.

[0007] Technical solution 2: A monoclonal antibody 4A8 secreted by the hybridoma cell line.

[0008] Furthermore, the heavy chain subtype of the monoclonal antibody 4A8 is IgG2a, and the light chain subtype is κ chain.

[0009] Technical Solution 3: The preparation method of the monoclonal antibody 4A8 is produced by secretion of the hybridoma cell line 4A8.

[0010] Technical Solution 4: Use of the hybridoma cell line or the monoclonal antibody 4A8 in the preparation of a detection reagent or a detection kit for canine coronavirus.

[0011] Technical Solution 5: A use of the hybridoma cell line or the monoclonal antibody 4A8 in the preparation of a drug for preventing and treating diseases caused by infection with canine coronavirus.

[0012] Technical Solution 6: Use of the hybridoma cell line or the monoclonal antibody 4A8 in the preparation of a canine coronavirus vaccine.

[0013] Technical Solution 7: An immune colloidal gold test strip for detecting canine coronavirus N protein, wherein the immune colloidal gold test strip uses the monoclonal antibody 4A8 described in claim 2 or 3 as a gold-labeled antibody.

[0014] Technical Solution 8: The preparation method of the immune colloidal gold test strip includes the step of spraying monoclonal antibody 4B6 on an NC membrane as a detection line. The monoclonal antibody 4B6 is secreted by the 4B6 hybridoma cell line. The 4B6 hybridoma cell line (Hybridoma cell line 4B6) has a deposit number of CCTCCNO: C2024305, a deposit date of October 18, 2024, and is deposited in the China Center for Type Culture Collection, Wuhan University, Wuhan, China. The heavy chain subtype of the monoclonal antibody 4B6 is IgG1, and the light chain subtype is κ chain.

[0015] Furthermore, the preparation method further comprises the step of diluting goat anti-mouse IgG with a streak diluent and spraying the diluent below the detection line on the NC membrane at 1.0 mL / cm as a quality control line.

[0016] The present invention discloses the following technical effects:

[0017] The present invention immunizes mice with prokaryotically expressed and purified CCoV-N protein, and further screens for specific anti-CCoV-N monoclonal antibodies. Through paired screening, 4A8 was selected as the gold-labeled antibody and 4B6 as the intercepting antibody, and a CCoV colloidal gold test strip detection method was established. This method is convenient, sensitive, and has a high compliance rate. It can be used for rapid detection of clinical CCoV infection, in order to provide a basis for early diagnosis of CCoV infection. The colloidal gold test strips developed by the present invention are easy to operate and can save time and cost at the same time, because they do not require skilled technicians or special equipment and can directly determine the results within 15 minutes. Compared with the PCR method, the colloidal gold test strips are simple and quick to operate, and the results are visible to the naked eye. They can be used in animal hospitals, large-scale dog farms, small outpatient clinics, remote areas, etc., to achieve rapid clinical detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0019] Figure 1 For the amplification of CCoV-N gene, where M: DL 2000Marker; 1: CCoV-N gene amplification product;

[0020] Figure 2 For the identification of the pET-30a-CCoV-N recombinant plasmid, A: M: DL2000Marker; 1-5: PCR identification of positive clones; 6: negative control; B: M: DL10000Marker; 1: double enzyme digestion identification of the pET-30a-CCoV-N recombinant plasmid;

[0021] Figure 3 For the expression of recombinant N protein, A: M: protein marker; 1: pET-30a empty vector induced by IPTG; 2: pET-30a-CCoV-N transformed bacteria without IPTG induction; 3: pET-30a-CCoV-N transformed bacteria induced by IPTG; B: M: protein marker; 1: pET-30a empty vector induced by IPTG; 2: supernatant of pET-30a-CCoV-N transformed bacteria induced by IPTG; 3: precipitate of pET-30a-CCoV-N transformed bacteria induced by IPTG; 4: pET-30a-CCoV-N transformed bacteria induced by IPTG;

[0022] Figure 4To optimize the induction temperature for recombinant N protein expression, M: protein marker; 1: supernatant of pET-30a-CCoV-N transformed bacteria without IPTG induction; 2-6: supernatant of pET-30a-CCoV-N transformed bacteria with induction temperatures of 16°C, 37°C, 20°C, 24°C, and 30°C, respectively;

[0023] Figure 5 To optimize the induction time of recombinant N protein expression, M: protein marker; 1-5: supernatant of pET-30a-CCoV-N transformed bacteria with induction time of 2h, 4h, 6h, 8h, and 10h, respectively; 6: supernatant of pET-30a-CCoV-N transformed bacteria without IPTG induction;

[0024] Figure 6 This is the optimization of recombinant N protein expression induced by different concentrations of IPTG, where M: protein marker; 1: supernatant of pET-30a-CCoV-N transformed bacteria without IPTG induction; 2-6: supernatant of pET-30a-CCoV-N transformed bacteria with IPTG induction concentrations of 0.2 mmol / mL, 0.6 mmol / mL, 1 mmol / mL, 1.5 mmol / mL, and 2 mmol / mL, respectively;

[0025] Figure 7 This is the purification analysis of CCoV-N recombinant protein, where M: protein marker; 1: supernatant of pET30a-CCoV-N transformed bacteria with high expression; 2: flow-through; 3: wash solution; 4: purified protein eluted with 100% Elution Buffer; 5: purified protein eluted with 80% Elution Buffer; 6: purified protein eluted with 60% Elution Buffer; 7: purified protein eluted with 40% Elution Buffer;

[0026] Figure 8 This is the antigen specificity analysis of CCoV-N recombinant protein, where M: protein marker; 1: pET-30a empty vector; 2: purified CCoV-N recombinant protein;

[0027] Figure 9 is the serum antibody titer of immunized mice;

[0028] Figure 10 The morphology of fusion hybridoma cells is shown in Figure 1, where A: 3d; B: 6d; C: 10d; D: after subcloning;

[0029] Figure 11For identification of chromosome number of hybridoma cells, A: 3D10; B: 4A8; C: 6D9; D: 5B7; E: 7E2; F: 5A6A: 3D10; B: 4A8; C: 6D9; D: 5B7; E: 7E2; F: 5A6;

[0030] Figure 12 is the titer of hybridoma cell supernatant;

[0031] Figure 13 is the ascites titer of the mAb;

[0032] Figure 14 For IFA identification of monoclonal antibodies, A: 3D10; B: 4A8; C: 6D9; D: 5B7; E: 7E2; F: 5A6; G: MOCKA: 3D10; B: 4A8; C: 6D9; D: 5B7; E: 7E2; F: 5A6; G: MOCK;

[0033] Figure 15 For WB identification of monoclonal antibodies, A: 3D10; B: 4A8; C: 6D9; D: 5B7; E: 7E2; F: 5A6A: 3D10; B: 4A8; C: 6D9; D: 5B7; E: 7E2; F: 5A6;

[0034] Figure 16 For the purification analysis of ascites, M: protein Marker; 1: 3D10; 2: 4A8; 3: 6D9; 4: 5B7; 5: 7E2; 6: 5A6M: protein Marker; A: 3D10; B: 4A8; C: 6D9; D: 5B7; E: 7E2; F: 5A6;

[0035] Figure 17 For the quality identification of colloidal gold solution; wherein, A: naked eye observation of colloidal gold solution; B: ultraviolet absorption spectrum of colloidal gold solution;

[0036] Figure 18 Selection of the best antibody pair for colloidal gold;

[0037] Figure 19 For the selection of the best NC membrane;

[0038] Figure 20 Determination of the optimal addition volume for gold-labeled conjugates;

[0039] Figure 21 The optimal concentration of the intercepting antibody;

[0040] Figure 22 The optimal concentration of quality control antibody;

[0041] Figure 23 To determine the optimal reaction time;

[0042] Figure 24 For sensitivity testing;

[0043] Figure 25 For specific detection;

[0044] Figure 26 To test the stability of colloidal gold test strips;

[0045] Figure 27 These are the RT-PCR test results of 47 clinical samples;

[0046] Figure 28 Comparison of the test results of the test strip developed by the present invention and the commercial test strip; wherein, A: the test strip developed by the present invention; B: the commercial test strip;

[0047] Figure 29 The results of the reaction between 4H2 and 4B6 and CCoV-infected cells under an inverted fluorescence microscope;

[0048] Figure 30 The specific protein bands for 4H2 and 4B6 to identify viruses have a molecular weight of 70 kDa;

[0049] Figure 31 The morphology of 4H2 (A) and 4B6 (B) positive hybridoma cells;

[0050] Figure 32 is the chromosome number of 4H2 (A) and 4B6 (B);

[0051] Figure 33 These are the identification results of 4H2(1) and 4B6(2). DETAILED DESCRIPTION

[0052] The CoV isolate and pET-30a prokaryotic expression vector were provided by Wuhan Keqian Biological Co., Ltd., which promises to distribute them to the public within 20 years from the application date. The RNA extraction kit was purchased from Wuhan Keqian Biological Co., Ltd.; the BeyoECLStar (ultra-sensitive ECL chemiluminescence kit) was purchased from Shanghai Beyotime Biotechnology Co., Ltd.; the Page gel rapid preparation kit was purchased from Shanghai Yazyme Biotechnology Co., Ltd.; the DNA gel recovery kit was purchased from Magen; and the plasmid miniprep kit was purchased from Omega. All other experimental materials, unless otherwise specified, were commercially available.

[0053] Example 1

[0054] 1 Construction and identification of recombinant plasmid pET-30a-CCoV-N

[0055] 1.1N gene amplification

[0056] The N gene sequence of the laboratory CCoV isolate and the sequence of the prokaryotic expression vector pET-30a were optimized and analyzed, and primer sequences with vector homology arms were designed and sent to Qingke Bio for gene synthesis.

[0057] Table 1 Primers for amplification and identification of CCoV-N

[0058] Primer name Primer sequences pET-30a-CCoV-F GAAGGAGATATACATATGATGGCCAACCAGGGAC(SEQ ID NO.1) pET-30a-CCoV-R ATTGATGAGGTAACGAACCTCGAGCACCACCACCACCACCA(SEQ ID NO.2)

[0059] The N gene was amplified using the cDNA of the CCoV-N gene as a template.

[0060] 1.2 Rubber recycling

[0061] The PCR product was identified by agarose gel electrophoresis, the target band of CCoV-N was cut, and the PCR product was recovered according to the instructions of the DNA gel recovery kit.

[0062] 1.3 Ligation of CCoV-N gene and pET-30a linearized vector

[0063] Prepare a 20 μl reaction mixture on ice: 1 μl (20 ng) of the CCoV-N gene, 1 μl (100 ng) of the linearized pET-30a vector, 4 μl of 5× CE Multis Buffer, 2 μl of Exnase Multis, and 12 μl of ddH2O. Gently pipette to mix thoroughly and briefly centrifuge to collect the reaction mixture at the bottom of the tube. Incubate at 37°C for 30 minutes, then cool to 4°C or immediately cool on ice.

[0064] 1.4 Transformation of recombinant products

[0065] Thaw BL21 competent cells on ice, take 10 μL of recombinant product and add it to 100 μL of competent cells, flick the tube wall to mix, and let it stand on ice for 30 minutes. Heat shock in a 42℃ water bath for 45 seconds, then immediately cool on ice for 2-3 minutes. Add 900 μL of LB liquid medium (without antibiotics) and shake at 37℃ and 200-250 rpm for 1 hour. + Preheat the LB solid culture medium plate in a 37℃ incubator, take out the bacterial solution after shaking, centrifuge at 5000r / min for 5min, and discard 900μL of supernatant. Resuspend the bacteria with the remaining culture medium and spread it on a sterile coating stick containing K + Gently spread the plate evenly and culture upside down in a 37°C incubator for 12-16 hours.

[0066] 1.5 Identification of bacterial liquid by PCR

[0067] Take the bacterial bottle, mark it, add 4mL LB liquid medium and 4μL K +(final concentration 50 μg / mL), mix well, pick five single colonies, and culture at 37°C, 200 rpm overnight. Take the cultured bacterial liquid and perform colony PCR identification using the identification primers for CCoV-N.

[0068] 1.6 Extraction and identification of recombinant plasmid pET-30a-CCoV-N

[0069] Positive bacteria from the PCR were selected for expansion. The recombinant plasmid was extracted from E. coli DH5α cells according to the instructions of the plasmid miniprep kit and the plasmid concentration was determined. The positive recombinant plasmid was designated pET-30a-CCoV-N. 10 ng of the recombinant plasmid pET-30a-CCoV-N was digested with NdeI and XhoI enzymes to verify the plasmid's size. The CCoV-N gene should be approximately 1149 bp in size, while the linearized pET-30a vector should be approximately 5238 bp in size. Another 5 μL of the recombinant plasmid was sent to Wuhan Qingke Biotechnology Co., Ltd. for sequencing.

[0070] 1.6.1 Small-scale expression and optimization of CCoV-N

[0071] 1.6.2 Small-scale expression of pET-30a-CCoV-N

[0072] The recombinant plasmid pET-30a-CCoV-N with correct sequencing was transformed into BL21 competent cells according to the transformation method, and the transformation bacterial solution was coated with K + Gently spread the plate evenly, culture in a 37℃ incubator for 12h, pick a single colony and inoculate it in K + After overnight culture, dilute the overnight bacteria at 1:100 and transfer to a K-containing + (50 ng / mL) in liquid LB, 37°C, 180 rpm, and culture until OD 600Take out the cells at about nm=0.6-0.8. Then take out 1mL of bacterial solution as the uninduced control, add the inducer IPTG to the remaining culture medium to a final concentration of 1mmol / mL, and continue to culture at 37℃ for 3-5h. Pour the induced bacterial solution and the uninduced bacterial solution into a centrifuge tube, centrifuge at 12000r / min for 1min, discard the supernatant, spin, use a pipette to dry the LB, collect the bacterial solution at 4℃, resuspend with 1×PBS after collecting the bacteria, wash away the excess culture medium: add PBS at a ratio of 1:10 (PBS: bacterial solution) and resuspend. Then ultrasonically disrupt (650W, disrupt for 5s, stop for 5s, amplitude 30%, total 6min), centrifuge at 4℃, 12000r / min for 10min, collect the supernatant into another tube, and resuspend the precipitate with the same volume of PBS. Then, SDS-PAGE electrophoresis was used to detect the expression and solubility of the target protein. Protein gel was prepared according to the gel preparation instructions, and the content of the target protein in the supernatant and precipitate was detected by SDS-PAGE electrophoresis.

[0073] 1.6.3 Optimizing induction temperature

[0074] Mark five bacterial flasks and add 20 mL of LB medium. Add 200 μL of the recombinant plasmid-transformed bacteria to each flask at a ratio of 1:100. Cultivate at 37°C, 200 rpm, and grow to an OD600nm of 0.6. Remove and add IPTG to a final concentration of 1 mmol / mol. Induce the cells at 16°C, 20°C, 24°C, 30°C, and 37°C for 6 h.

[0075] 1.6.4 Optimizing induction time

[0076] Take 5 bacterial bottles and mark them, add 20mL LB medium, add 200μL of recombinant plasmid transformed bacteria solution to each bottle at a ratio of 1:100, and culture at 37℃, 200r / min until OD 600 nm=0.6, IPTG was added at a final concentration of 1 mmol / mol, and induced at 37°C for 2h, 4h, 6h, 8h, and 10h respectively.

[0077] 1.6.5 Optimizing IPTG induction concentration

[0078] Take 5 bacterial bottles and mark them, add 20mL LB medium, add 200μL of recombinant plasmid transformed bacteria solution to each bottle at a ratio of 1:100, and culture at 37℃, 200r / min until OD 600 nm=0.6, IPTG was taken out and added with final concentrations of 0.2 mmol / mL, 0.6 mmol / mL, 1 mmol / mL, 1.5 mmol / mL, and 2 mmol / mL, respectively, and induced at 37°C for 6 h.

[0079] 1.7 Large-scale expression, purification, and Western blot identification of CCoV-N

[0080] 1.7.1 Large-scale expression of recombinant N protein

[0081] Same as 1.6.2.

[0082] 1.7.2 Purification of recombinant N protein

[0083] The recombinant N protein expression supernatant was collected and filtered through a 0.45 μm filter. A 5 mL NiNTA high-speed chromatography medium (6FF) pre-packed column was prepared for protein purification and the procedure was performed according to the manufacturer's instructions.

[0084] 1.7.3 Identify the recombinant N protein by Western blot.

[0085] 1.7.4 Animal immunization

[0086] Purified CCoV-N protein was used as the immunization antigen, and adjuvants were selected from Freund's complete adjuvant and Freund's incomplete adjuvant. Three healthy, six-week-old female BALB / c mice were immunized with a dose of 100 μg per mouse. For the first immunization, the corresponding dose of purified CCoV-N protein was mixed with an equal volume of Freund's complete adjuvant, emulsified, and injected subcutaneously into the dorsal muscles of the mice. Subsequently, CCoV-N protein was mixed with an equal volume of Freund's incomplete adjuvant, emulsified, and administered as a primary immunization for the second and third immunizations every 14 days. Three days after the third immunization, blood was collected from the immunized mice by tail-chopping and coated with CCoV-N protein. Serum titers were determined by indirect ELISA. A blank mouse was used as a negative control. Mice with high serum titers were selected for booster immunizations using intraperitoneal priming without adjuvant at a dose of 50 μg per mouse. Cell fusion was performed three days after the priming. The specific immunization schedule is shown in Table 2.

[0087] Table 2 Mouse immunization program

[0088] Number of immunizations Immunization dose adjuvant Immunization time Immune pathways First Free 100 Freund's complete adjuvant 0 Subcutaneous injection in the back Second exemption 100 Freund's incomplete adjuvant 14 Subcutaneous injection in the back Three exemptions 100 Freund's incomplete adjuvant 28 Subcutaneous injection in the back Strengthen immunity 50 - 36 intraperitoneal injection

[0089] 1.7.5 Indirect ELISA to detect serum titers after mouse immunization

[0090] 1.7.5.1 Establishment of indirect ELISA detection method

[0091] The indirect ELISA method was used to detect positive hybridoma cells for screening. The indirect ELISA method was established. The specific steps are as follows:

[0092] 1) Use purified CCoV-N protein as antigen to coat the ELISA plate. Take two 96-well ELISA plates and set different concentrations of antigen coating in columns 1-7. The initial protein concentration is 4 mg / mL. Perform gradient dilutions of 1:2, 1:4, 1:8, 1:16, 1:32, and 1:64 in sequence. Add 100 μl to each well for coating at 4°C overnight.

[0093] 2) Discard the coating solution from the ELISA plate, wash three times with PBST (200 μl / well), pat dry on absorbent paper, and block with blocking solution (200 μl / well) at 37°C for 2 h.

[0094] 3) Discard the blocking solution from the ELISA plate, wash three times with PBST (200 μl / well), pat dry on absorbent paper, and add 100 μl / well of positive serum diluted 1:50, 1:100, 1:200, 1:400, 1:800, and 1:1600 to rows 1-6 of the first plate. Add 100 μl / well of negative serum diluted 1:50, 1:100, 1:200, 1:400, 1:800, and 1:1600 to rows 1-6 of the first plate. Incubate at 37°C for 1 hour.

[0095] 4) Discard the primary antibody from the ELISA plate, wash three times with PBST (200 μl / well), pat dry on absorbent paper, add 100 μl / well of a 1:7000 dilution of HRP-labeled IgG enzyme-labeled goat anti-mouse secondary antibody to each well, and incubate at 37°C for 1 hour.

[0096] 5) Discard the secondary antibody in the ELISA plate, wash three times with PBST (200 μl / well), pat dry on absorbent paper, add 100 μl TMB system colorimetric solution, develop for 15 minutes in the dark, add 50 μl stop solution to each well to terminate the reaction, and read the OD value on a microplate reader. 630 The absorbance value of nm was measured, and the optimal antigen coating concentration and the optimal serum dilution ratio were selected according to the analysis data displayed by the microplate reader.

[0097] 1.7.5.2 ELISA titer of serum after mouse immunization

[0098] 7 days after the third immunization, blood was collected from the immunized mice by tail cutting and coated with CCoV-N protein, and the serum titer of the immunized mice was determined by indirect ELISA.

[0099] 1.8 Preparation, screening and subcloning of positive hybridoma cells

[0100] 1.8.1 Recovery and Culture of SP2 / 0 Myeloma Cells

[0101] Two weeks before fusion, resuscitate SP2 / 0 cells. Warm RPMI-1640 medium containing 20% ​​FBS in a 37°C water bath. Rapidly remove the SP2 / 0 cells from liquid nitrogen and immediately immerse the cryovial in a 37°C water bath, gently shaking to thaw the cells. Once completely thawed, centrifuge the cryovial at 1000 rpm for 5 minutes. Remove the cryovial and discard the supernatant in a clean hood. Resuspend the cells in RPMI-1640 medium containing 20% ​​FBS, which was previously prepared in a water bath. Add the flask to a T25 cell culture flask and make up to 5 mL with RPMI-1640 medium containing 20% ​​FBS. Gently shake the flask to mix the cells. Incubate in a 5% CO2, 37°C incubator for 12 hours. Replace the medium with fresh medium and observe the cells. Once the cells are in good condition and have grown to 80% of the bottom of the flask, passage them.

[0102] 1.8.2 Preparation of feeder cells

[0103] One day before fusion, a normal BALB / c mouse was sacrificed after blood was collected from the eyeball. After the mouse whole blood was allowed to stand at room temperature for 2 hours, it was centrifuged at 4000 rpm for 10 minutes. The supernatant was collected and inactivated at 56°C for 30 minutes before storage at 4°C. The sacrificed mouse was immediately disinfected by soaking in 75% alcohol for 30 seconds. The mouse's limbs were fixed, the abdomen was exposed, and the abdominal skin was torn open to expose the peritoneal cavity. The mouse peritoneal cavity was repeatedly rinsed with blank RPMI-1640 medium to obtain macrophages. The cell-medium mixture was centrifuged at 1200 rpm for 5 minutes. The supernatant was discarded and the cells were resuspended in 50 mL of HAT complete medium. Gently pipette to mix thoroughly and plate the cells in a 96-well plate at 100 μl / well. Incubate at 37°C in a 5% CO2 incubator until ready to use.

[0104] 1.8.3 Cell fusion

[0105] Preparation of splenocytes from immunized mice: Bleed from the eyeballs of boosted mice and sacrifice. Positive serum was collected as a positive control. Mice were immersed in 75% alcohol for 30 seconds, then removed. The mice were placed in the left lateral decubitus position. The spleens were removed, and the surrounding adipose tissue was gently removed. The spleens were then placed in a cell strainer. Splenocytes were isolated by pressure perfusion. The spleen cell suspension was centrifuged at 1200 rpm for 10 minutes. The supernatant was discarded and the suspension was resuspended in blank RPMI-1640 medium. Cell counts were performed. SP2 / 0 cells were collected, washed once with blank RPMI-1640 medium, and counted. Cell fusion: Splenocytes and SP2 / 0 cells were mixed at a ratio of 5:1 in a 50 mL centrifuge tube and centrifuged at 1200 rpm for 10 minutes. The supernatant was discarded and the bottom of the tube was gently tapped to evenly distribute the cells. In a 37°C water bath, 1 mL of PEG4000 was slowly added over 1 minute. The tube was gently shaken and allowed to rest for 45 seconds. Within the first second, slowly add 1 mL of blank RPMI-1640 medium to the centrifuge tube, shaking the tube as you add. Within the second, slowly add 2 mL of blank RPMI-1640 medium, shaking the tube as you add. Within the third second, slowly add 3 mL of blank RPMI-1640 medium, shaking the tube as you add, and finally fill the tube to 50 mL. Centrifuge at 1200 rpm for 10 minutes, discard the supernatant, and add 50 mL of complete HAT medium. Remove the cell plate from which the feeder cells were plated the day before and evenly distribute the confluent cells to each well using a dispenser. Incubate at 37°C in a 5% CO2 incubator.

[0106] 1.8.4 Screening and Subcloning of Positive Hybridoma Cells

[0107] After fusion, observe cells daily. On day 3, perform a half-medium change by aspirating a portion of the medium from each well and replacing it with fresh HAT complete medium. When colonies reach an appropriate size, remove the supernatant for indirect ELISA analysis. Positive hybridoma cells are subcloned and screened again to ensure that the cells are monoclonal.

[0108] 1.8.5 Cryopreservation and Thawing of Positive Hybridoma Cells

[0109] Cryopreservation of positive hybridoma cells: Expand the positive monoclonal hybridoma cells and transfer the cells in the 96-well plate to a 24-well plate for culture. When the cells grow to about 80%, transfer the cells to a 6-well plate for continued culture. When the cells grow to 80% again, transfer the cells to a cell flask for expanded culture. When the cells grow to 70-80% in the cell flask, gently blow the cells off, centrifuge at 1200r / min for 5 minutes, discard the supernatant, add 1mL of cell freezing solution, mix well by pipetting, and transfer to a cell cryopreservation tube. Freeze the cell cryopreservation tube in a -80℃ refrigerator within 15 minutes and transfer to a liquid nitrogen tank for long-term storage within 24-48 hours. Revive the cells regularly and check the cell activity and ability to secrete antibodies.

[0110] Resuscitation of positive hybridoma cells: Remove hybridoma cells frozen in liquid nitrogen and rapidly shake in a 37°C water bath until the cryopreservation solution is completely thawed. Centrifuge at 1000 rpm for 5 minutes, discard the cryopreservation solution, and resuspend the cell pellet completely in RPMI-1640 complete medium. Transfer the cell pellet to a cell plate and culture in a 37°C, 5% CO2 cell culture incubator. After 24 hours, when most cells have attached, change the medium and observe the cell growth status daily after recovery.

[0111] 1.9 Identification of hybridoma cells

[0112] 1.9.1 Identification of chromosome number in hybridoma cells

[0113] The colchicine method was used for cytology examination.

[0114] 1.9.2 Monoclonal Antibody Subtype Identification

[0115] Identify the Ig subclass of mouse monoclonal antibodies using the enzyme-labeled secondary antibody ready-to-use kit instructions.

[0116] 1.9.3 Hybridoma cell supernatant titer determination

[0117] The antibody titer of mouse ascites was detected by indirect ELISA. SP2 / 0 myeloma cell supernatant was used as a negative control to detect the titer of hybridoma cell supernatant.

[0118] 1.9.4 Preparation of Hybridoma Cell Ascites and Titer Determination

[0119] 1) Seven days before intraperitoneal injection of hybridoma cells, select 8-week-old BALB / c mice in good condition and inject 0.5 mL of Freund's incomplete adjuvant into the peritoneal cavity of each mouse;

[0120] 2) Gently blow up the hybridoma cells in good condition, centrifuge at 1000 rpm for 3 minutes, discard the supernatant, resuspend the cell pellet in RPMI-1640 basal solution and adjust the cell count to 1×10 6SP2 / 0 cells were used as negative control and injected intraperitoneally with 0.5 mL per mouse, i.e. 0.5×10 6 pcs / piece;

[0121] 3) Observe the abdominal cavity of the mouse daily 10-14 days after inoculation, and collect ascites when the abdomen is noticeably distended.

[0122] 4) Centrifuge the collected ascites at 1500 rpm for 10 min at 4°C and collect the supernatant;

[0123] 5) After overnight storage at 4°C, centrifuge at 12,000 rpm for 5 min at 4°C, remove the lower layer, discard the fat, and store at -20°C until use;

[0124] 6) The antibody titer in mouse ascites was detected by indirect ELISA.

[0125] 1.10 Purification and identification of monoclonal antibodies

[0126] 1.10.1 Ascites purification

[0127] 1) Dilution of Ascites: Prepare a 50 mL centrifuge tube and add 10 mL of 1× equilibration buffer and 12 mL of 2× equilibration buffer. Thaw and transfer the ascites fluid from one monoclonal antibody sample (approximately 2 mL) to the tube. Mix thoroughly and filter through a 0.45 μm filter.

[0128] 2) Pretreatment of the purification column: Place the purification column vertically (with the filler at the bottom). Remove the black stopcock at the top, take the assembled water inlet tube, insert it into the upper port of the purification column, tighten it, connect the peristaltic pump, and adjust the flow rate. First, wash with ddH2O for 10 column volumes at a flow rate of 1.0-2.0, then wash with PBS for 10 column volumes at a flow rate of 1.0-1.5, and then wash with 1× equilibration buffer for 10 column volumes.

[0129] 3) Overnight sample loading: Place the diluted and filtered ascites in an ice box. Insert the inlet tube at a flow rate of 0.1-0.4. Connect the outlet tube to a 50mL centrifuge tube to collect the flow-through. After the column, pour the flow-through back into the ascites centrifuge tube and repeat the sample loading twice.

[0130] 4) Re-equilibrate and wash the purification column: First, wash with 1× equilibration buffer for 10 column volumes at a speed of 1.5; then wash with impurity removal buffer for 10 column volumes at a speed of 1.5;

[0131] 5) Elution: First, clean the purifier. Without connecting the purification column, place the inlet tubing of both pumps A and B in 1× equilibration buffer. Then, use a 10mL syringe to draw approximately 10mL of liquid from the lower port of each pump. To operate the instrument: Open the software → Open Method → ​​WQ folder → Wash. Equilibration + Elution: Connect the purification column, insert the inlet tubing of pump A into 1× equilibration buffer, and the inlet tubing of pump B into the eluent. Prepare 40 2mL EP tubes, add 200μL of pre-chilled Tris-HCl (pH 9.0) per tube, and place them in a tube rack.

[0132] 6) Cleaning the purifier and purification column: After elution, wash with PBS for 10 column volumes. Equilibrate the purification column with 1× equilibration buffer for 10 column volumes at a speed of 1.5. Then, equilibrate the purification column with PBS again at a speed of 1.5 for 10 minutes.

[0133] 7) The purity of the purified ascites was determined using SDS-PAGE.

[0134] 1.10.2 Ultrafiltration Concentration of Monoclonal Antibodies

[0135] Precool the centrifuge to 4°C and set it to 4500r / min for 60min, with both the speed increase and deceleration rate at 8. After balancing the ultrafiltration tube, place it symmetrically in the centrifuge and start centrifugation. Observe it every once in a while to prevent all the liquid from being centrifuged. When there is only 1.5mL of liquid left in the ultrafiltration tube, stop centrifugation and use a protein concentration meter to detect whether the inner tube contains monoclonal antibodies. Then add precooled PBS (0.22μm filtered) to 15mL in the ultrafiltration tube, balance it and centrifuge it again. A total of PBS replacement is required 3 times. The last time, ensure that the liquid in the ultrafiltration tube is 1-1.5mL. Use a 200μL pipette to aspirate the liquid in the ultrafiltration tube, then repeatedly and gently rinse the ultrafiltration membrane (10-20 times), and then aspirate the liquid in the ultrafiltration tube into a 2mL EP tube.

[0136] 1.10.3 Indirect immunofluorescence assay (IFA) of monoclonal antibodies

[0137] 1) F81 cells were cultured in 10% FBSDMEM medium in T25 cell culture flasks at 37°C in 5% CO2.

[0138] 2) When the cells have grown into a dense monolayer, discard the culture medium, wash twice with PBS, and digest with EDTA-free trypsin. Aliquot 100 μL per well of a 96-well plate until the cells have grown into a dense monolayer. Discard the culture medium and inoculate 100 μL / well of CCoV virus diluted in 2% FBS-containing DMEM medium. Incubate for approximately 48 hours and harvest.

[0139] 3) Discard the culture medium from the 96-well plate, wash once with PBS, fix with methanol for 15 minutes at room temperature, discard, and air dry. Then, add 100 μL of 1% Tritan X-100 to each well, incubate at 37°C for 15 minutes, discard, and wash three times with PBS. Add 100 μL of 2% BSA to each well, block at 37°C for 15 minutes, discard the blocking solution, and wash three times with PBS.

[0140] 4) Hybridoma cell supernatant was used as primary antibody and goat anti-mouse IgG Alexa Fluor 488 was used as secondary antibody. 100 μL was added to each well.

[0141] 5) Observe the fluorescence under an inverted fluorescence microscope. Set up a well containing cells not inoculated with virus as a negative control.

[0142] 1.10.4 Western blot identification of monoclonal antibodies

[0143] CCoV virus liquid samples were prepared, subjected to SDS-PAGE electrophoresis and then electroblotted onto PVDF membranes. Monoclonal antibodies were used as primary antibodies, and HRP-labeled goat anti-mouse IgG was used as secondary antibodies, and then images were taken.

[0144] 1.10.5 Preparation of colloidal gold solution

[0145] 1.10.5.1 Pretreatment of glass products

[0146] Clean and disinfect the glassware before use.

[0147] 1.10.5.2 Preparation of Colloidal Gold Solution

[0148] Take 1.0g of chloroauric acid, add distilled water to 100mL, filter with a 0.22μm filter membrane, and place in a clean glass container. Refrigerate and protect from light. Take 100mL of distilled water in a siliconized conical flask, add 1mL of 1% chloroauric acid solution to make the final solution concentration 0.01%, place it on a magnetic heating stirrer and boil for 7 minutes, then quickly add 1.4mL of 1% trisodium citrate aqueous solution at one time while stirring, continue heating for 8 minutes, cool to room temperature, and restore to the original volume with distilled water. Filter with a 0.22μm filter membrane and place in a clean glass bottle. The colloidal gold solution is stored at 2-8°C. Observe the color of the colloidal gold solution with the naked eye and measure the ultraviolet absorbance of the synthesized colloidal gold nanoparticles.

[0149] 1.10.6 Preparation of gold-labeled conjugates

[0150] 1.10.6.1 Exploration of the Optimal Gold Labeling pH and Optimal Labeling Protein Amount

[0151] A square titration test was used. 8 15 mL centrifuge tubes were added with 2 mL of colloidal gold solution and marked. 4 μL, 6 μL, 8 μL, 10 μL, 12 μL, 14 μL, 16 μL, and 18 μL of 0.2 mol / L K2CO3 solution were added to adjust the pH of the colloidal gold solution. The centrifuge tubes were placed on a rotator and rotated for 10 minutes before use. Take 8 1.5mL EP tubes and add 160μL ultrapure water to each of them. Pipette 160μL of antibody with a concentration of 2mg / mL and add it to the first EP tube. Mix it and dilute it 2-fold to the 8th tube. Discard the excess antibody in the 8th tube and keep 160μL. Take the serum dilution plate, mark the corresponding K2CO3 addition amount in each vertical column and the corresponding antibody concentration in each horizontal column. After marking, add 200μL of the corresponding colloidal gold solution with 0.2mol / mL K2CO3 to each well, mix gently, and let it stand at room temperature for 5min. Then add 20μL of the antibody with the corresponding concentration to each well, mix gently, and let it stand at room temperature for 5min to allow the colloidal gold particles to fully combine with the antibody. Use a spray gun to add 20μL to each well. Gently mix the solution with 10% NaCl and let it stand at room temperature for 5 minutes. Observe the color change and simultaneously measure the UV absorbance of the synthesized gold-labeled antibody nanoparticles. The optimal amount of labeled antibody is determined by the amount of antibody added to the last well in the plate where the liquid does not change color. The pH represented by the corresponding amount of 0.2 mol / L K2CO3 solution added is the optimal pH for labeling. Following the above steps, the optimal pH and amount of labeled protein were determined for each of the six screened monoclonal antibodies and two existing monoclonal antibodies in the laboratory.

[0152] 1.10.6.2 Preparation of gold-labeled conjugates

[0153] First, add 2mL of gold solution to the centrifuge tube, place the centrifuge tube on a rotator, rotate for 5 minutes, and observe whether dead gold (and gold particle precipitation) appears. If there is no dead gold, add 0.2mol / mLK2CO3 solution with the optimal pH corresponding to the monoclonal antibody, rotate and mix for 5 minutes, then add 200μL of the monoclonal antibody with the optimal concentration, rotate and mix for 5 minutes, and let it stand at room temperature for 30 minutes. After the gold-labeled solution stands for 30 minutes, add 0.244mL of 10% BSA to make the final concentration of BSA 1%. After rotating and mixing for 5 minutes, block for 30 minutes. The blocked solution is centrifuged at 2000r / min at 4℃ for 5 minutes, discard the precipitate, transfer the supernatant to another centrifuge tube, centrifuge at 9000r / min at 4℃ for 10 minutes, carefully discard the supernatant, wash the precipitate once with resuspension buffer and resuspend it at 1 / 10. The obtained is the gold-labeled conjugate, which is stored in a refrigerator at 4℃ for later use.

[0154] 1.11 Assembly and preparation of test strips

[0155] 1) Pretreatment of the gold conjugate pad and sample pad: Wet the glass fiber membrane with the conjugate pad treatment solution. After wetting, place it in a 37°C oven to dry overnight (at least 8 hours).

[0156] 2) Coating (striking): Attach the NC membrane to a PVC substrate and spray using a film sprayer. Dilute the monoclonal antibody with streaking diluent and spray at 1.0 mL / cm onto the NC membrane to serve as the test line. Dilute goat anti-mouse IgG with streaking diluent and spray at 1.0 mL / cm onto the NC membrane 4.0 mm below the test line to serve as the quality control line. Dry the coated NC membrane at 37°C for 3 hours and seal for storage.

[0157] 3) Assemble the test strips by cutting the sample pad, conjugate pad, NC membrane, and absorbent paper into appropriate widths and pasting them onto a clean PVC substrate in order, ensuring that each part overlaps by approximately 2 mm to ensure the flow of the sample liquid.

[0158] 4) Cutting: Take the large plate and use a strip cutter to cut it into single test paper strips with a width of 4.0 mm;

[0159] 5) Assembly: Assemble the cut test paper strips into the base groove of the plastic card, cover the plastic card with the upper cover, press it tightly, and then use a shell pressing machine to press the card to form a test paper strip for the next experiment.

[0160] 1.11.1 Screening and pairing of colloidal gold antibodies

[0161] The 8 monoclonal antibodies screened by the present invention were used as gold-labeled antibodies and intercepting antibodies for cross-matching experiments, and test strips were prepared according to the optimal conditions of the gold-labeled antibodies. 4 TCID 50 / mL of CCoV virus liquid was tested, and the color development of the test paper was observed to determine the alternative antibody pairing combination.

[0162] After obtaining the candidate antibody pairing combination, use 10 4 TCID 50 / mL CCoV virus liquid, 10 3 TCID 50 / mL of CCoV virus liquid, sample processing liquid, and F81 cell supernatant were used to test the above-mentioned alternative antibody pairing combinations. According to the color development of the test strips, the pairing with high sensitivity and strong specificity was selected as the most suitable antibody pairing for subsequent experiments.

[0163] 1.11.2 Determination of the amount of gold label conjugate added

[0164] Prepare test strips, where the test line is coated with 5B7 antibody at a concentration of 1 mg / mL and the control line is coated with goat anti-mouse antibody at a concentration of 2 mg / mL. Add 2, 4, 6, 8, 10, 12, and 15 μL of gold-labeled conjugate to the conjugate pad to prepare CCoV-N test strips. Use the prepared test strips to test the same negative and positive samples three times. The optimal amount of gold-labeled conjugate is determined based on the color development of the test strips. Simultaneously, use an immunoassay to measure the T-line colloidal gold signal intensity. The optimal amount with the highest sensitivity and specificity is selected for subsequent experiments.

[0165] 1.11.3 Determination of NC membrane

[0166] NC membranes are available in different sizes based on their pore size and migration rate, which influence the sensitivity and specificity of the test strips. Purchase four common commercially available NC membrane models: Pall90, Pall120, CN95, and CN140. Prepare test strips and streak each of the four NC membranes with antibodies of the same C and T line concentrations. Test the same positive and negative samples three times. Determine the optimal NC membrane based on the color development on the test strips. Simultaneously, use an immunoassay analyzer to measure the T-line colloidal gold signal intensity. Select the optimal NC membrane with high sensitivity and low nonspecificity for subsequent experiments.

[0167] 1.11.4 Determination of the optimal amount of coating antibody for the test line

[0168] Prepare test strips with a fixed control line coating concentration of 2 mg / mL goat anti-mouse antibody. Streak the NC membrane with the antibody diluted to 1, 1.5, 2, 2.5, 3, and 4 mg / mL. After assembling the test strips, test the same positive sample three times using test strips with different test line (T line) coating concentrations. Determine the optimal T line coating concentration based on the color development. Simultaneously, measure the T line colloidal gold signal intensity using an immunoassay analyzer. The minimum antibody coating concentration required for a stable T line signal is defined as the optimal test line coating antibody amount and used in subsequent experiments.

[0169] 1.11.5 Determination of the optimal amount of coating antibody for the quality control line

[0170] Prepare test strips with a fixed test line coating antibody concentration of 2 mg / mL. Streak the NC membrane with the antibody diluted to 0.5, 1, 1.5, 2, 2.5, and 3 mg / mL. After assembling the test strips, test the same positive sample three times using test strips with different control line (C line) coating concentrations. Determine the optimal C line coating concentration based on the color development of the test strips. Simultaneously, measure the C line colloidal gold signal intensity using an immunoassay analyzer. The minimum goat anti-mouse antibody coating concentration required to achieve a stable C line signal and the optimal control line coating antibody amount were used for subsequent experiments.

[0171] 1.11.6 Optimization of reaction time

[0172] Prepare a test strip. The antibody concentrations marked at the test and control lines represent the optimal coating antibody concentration, and the amount of gold conjugate added represents the optimal addition volume. Use this test strip to test the same positive sample. Detect the aggregated colloidal gold signal at the test and control lines using an immunoassay analyzer three times at 3, 6, 9, 12, 15, 20, and 25 minutes after sample application. Repeat this process three times. The shortest time required for the test and control line signals to stabilize is defined as the optimal reaction time.

[0173] 1.12 Colloidal gold test strip quality inspection

[0174] 1.12.1 Determination of test strip sensitivity

[0175] The test strips were prepared using the optimal conditions of the above experiment, and the same batch of test strips was used to detect the virus content of 10 5 TCID 50 / mL of CCoV standard, and the virus solution was diluted 10 times with the sample treatment solution to obtain 10 4 TCID 50 / mL, 10 3 TCID 50 / mL, 10 2 TCID 50 / mL of sample, test the samples separately, observe the color development results, and determine the minimum detection limit of the sample.

[0176] 1.12.2 Test strip specificity detection

[0177] The test strips were prepared using the optimal conditions of the above experiments. The same batch of test strips were used to detect common canine viruses CCoV, CPV, CDV, CPIV, F81 cell supernatants and negative samples, and the color development results were observed to test the specificity of the test strips.

[0178] 1.12.3 Test Strip Stability Test

[0179] Prepare test strips and store at 37°C. Use the prepared test strips to test the same positive sample three times at 0, 10, 20, and 30 days. Observe the color development of the test strips and simultaneously measure the T-line colloidal gold signal intensity using an immunoassay analyzer to analyze the stability of the test strips.

[0180] 1.12.4 Testing of clinical samples

[0181] The developed test strips were used to test 47 dog fecal swabs, and the test results were recorded and compared with the RT-PCR test results to calculate the coincidence rate.

[0182] 1.12.5 Comparison with Commercial Test Strips

[0183] The virus content was 10 5 TCID 50 / mL of CCoV positive and negative samples, and the CCoV standard was diluted 10 times with the sample treatment solution to obtain 10 4 TCID 50 / mL, 10 3 TCID 50 / mL, 10 2 TCID 50 / mL positive sample. Purchase a colloidal gold test strip for canine coronavirus antigen detection on the market, and test the diluted samples simultaneously with the colloidal gold test strip developed by the present invention. Compare the test results and take photos for comparison.

[0184] 2 Results and Analysis

[0185] 2.1 CCoV-N target gene amplification

[0186] The N gene was amplified using CCoV as a template, and an amplified fragment (1149 bp) with NdeⅠ and XhoⅠ restriction sites was obtained by PCR ( Figure 1 ), which was consistent with the expected size fragment, indicating that the CCoV-N target gene was successfully amplified.

[0187] 2.2 Identification of pET-30a-CCoV-N recombinant plasmid

[0188] Pick five single colonies for culture, take the cultured bacterial solution and use primers for PCR identification. The results are as follows Figure 2 As shown in A in Figure 1, the target band appeared at 1149 bp, which was consistent with the expected size. The amplified N gene was homologously recombined with the linearized vector pET-30a, and the double enzyme digestion identification results of the CCoV-N recombinant expression vector were as shown in Figure 1. Figure 2 As shown in Figure B, the target bands appeared at 1149 bp for the N gene and 5238 bp for the linearized vector pET-30a, respectively, consistent with the expected sizes. After scale-up, the plasmid was extracted and the concentration was measured. Sequencing and alignment showed 100% accuracy, indicating that the pET30a-CCoV-N recombinant plasmid was successfully constructed.

[0189] 2.3 Expression and identification of CCoV-N recombinant protein

[0190] IPTG was added to the positive transformed bacteria for induction. The SDS-PAGE results were as follows: Figure 3A in the figure shows a target protein band at around 43 kDa, which is consistent with the expected size. Adding IPTG can significantly increase the expression of the target protein. The bacterial solution was further ultrasonically disrupted and the supernatant and precipitate were separated. The SDS-PAGE results are shown in Figure 2. Figure 3 Middle B shows that most of the target protein is present in the bacterial supernatant in a soluble expression form, which is conducive to protein purification.

[0191] Optimization of 2.4CCoV-N protein expression conditions

[0192] 2.4.1 Effect of induction temperature on protein expression

[0193] The results are as follows Figure 4 As shown, IPTG was added at a final concentration of 1 mmol / mL, and the cells were induced at 16°C, 20°C, 24°C, 30°C, and 37°C for 6 h. After ultrasonication, the supernatant was subjected to SDS-PAGE, and it was found that the protein expression level was highest at 37°C.

[0194] 2.4.2 Effect of induction time on protein expression

[0195] The results are as follows Figure 5 As shown, IPTG was added at a final concentration of 1 mmol / mL, and the cells were induced at 37°C for 2 h, 4 h, 6 h, 8 h, and 10 h, respectively. The bacterial solution was ultrasonically disrupted, and the supernatant was subjected to SDS-PAGE. It was found that the protein expression level was the highest when the cells were induced at 37°C for 8 h.

[0196] 2.5 Effects of different IPTG concentrations on protein expression

[0197] The results after adding IPTG at final concentrations of 0.2mmol / mL, 0.6mmol / mL, 1mmol / mL, 1.5mmol / mL, and 2mmol / mL are as follows: Figure 6 As shown, under the condition of induction at 37°C for 8 h, the highest protein expression level was obtained when the final concentration of IPTG was 0.6 mmol / mL.

[0198] Purification and identification of 2.6CCoV-N recombinant protein

[0199] According to the optimized conditions, the bacterial solution was expressed in large quantities and the bacterial solution was treated with Ni + After affinity chromatography purification, the results of SDS-PADE identification were as follows Figure 7 As shown, the target protein band was detected at approximately 43 kDa, consistent with the expected size. The flow-through and wash buffer control results were normal. The protein eluted with 100% Elution Buffer was high in amount, and the purification effect was good, resulting in a high-purity N protein.

[0200] Antigenic specificity analysis of 2.7CCoV-N recombinant protein

[0201] The antigenicity of CCoV-N recombinant protein was verified by Western Blot using CCoV mouse positive serum as primary antibody. Figure 8 As shown, there is a target protein band at around 43 kDa, which is consistent with the expected size, indicating that the CCoV-N recombinant protein has good antigenic specificity.

[0202] 2.8 Establishment of indirect ELISA detection method

[0203] The P / N ratio for each well was calculated, using the OD value of the positive serum as the P value and the OD value of the negative serum as the N value. As shown in Table 3, the maximum P / N ratio was achieved at a serum dilution of 1:800 and an antigen dilution of 0.5 μg / mL. These conditions were selected for subsequent screening of positive hybridomas.

[0204] Table 3 Establishment of indirect ELISA detection method

[0205]

[0206]

[0207] 2.9 Results of serum titer determination in immunized mice

[0208] The serum titer of immunized mice was detected by the established indirect ELISA method. Figure 9 As shown, the serum titers of the three mice all reached 10 5 , all met the fusion conditions, and mouse No. 2 with the highest serum titer was selected for cell fusion.

[0209] 2.10 Positive hybridoma cell screening and subcloning

[0210] like Figure 10 As shown in Figures AC, it can be observed that the hybridoma cells that have successfully fused began to aggregate on the 3rd day after cell fusion. Then on the 6th day, the hybridoma cells became transparent and clear. On the 10th day, the hybridoma cells aggregated into a large cell cluster. The hybridoma cell supernatant was collected and screened by indirect ELISA. The cell wells with high OD values ​​were subcloned and cultured by limiting dilution. After three subclonings, 8 hybridoma cell lines were obtained and named 3D10, 4A8, 6D9, 5B7, 7E2, 5A6, 4H2, and 4B6. Among them, the positive hybridoma cells of 3D10, 4A8, 6D9, 7E2, 5B7, and 5A6 had good morphology, as shown in Figure 4. Figure 10 As shown in D; the morphology of 4H2 and 4B6 positive hybridoma cells is shown in Figure 31 .

[0211] 2.11 Identification of chromosome number in positive hybridoma cells

[0212] The chromosome number results of 3D10, 4A8, 6D9, 7E2, 5B7, and 5A6 positive hybridoma cells are as follows Figure 11 As shown in the figure, the chromosome counts of the six positive hybridoma cells were all between 98±5, which is consistent with the chromosome number of hybridoma cells, indicating that they are hybridoma cells. Figure 32 By counting chromosomes, it can be concluded that the chromosome numbers of the two positive hybridoma cells are both between 98±5, which is consistent with the chromosome number of hybridomas, indicating that they are hybridoma cells.

[0213] 2.12 Hybridoma cell supernatant assay results

[0214] The titer of hybridoma cell supernatant was tested by indirect ELISA. The titer test results of hybridoma cell supernatant of 3D10, 4A8, 6D9, 7E2, 5B7 and 5A6 are as follows: Figure 12 As shown, the highest titer of 3D10 is 2 12 , the lowest titer of 5A6 is 2 4 The remaining antibody titers were between 2 9 -2 11 The titer test results of 4H2 and 4B6 hybridoma cell supernatants showed that the titers were 2 10 , 2 11 .

[0215] 2.13 Ascites titer determination results of monoclonal antibodies

[0216] The results of the ascites titer test of 3D10, 4A8, 6D9, 7E2, 5B7, and 5A6 monoclonal antibodies are as follows: Figure 13 As shown: The highest titer of 3D10, 4A8, and 5A6 is 10 6 The lowest titer of 5B7 and 7E2 is 10 4 , the titer of 6D9 is 10 5 The titers of 4H2 and 4B6 are both 10 5 .

[0217] 2.14 Monoclonal Antibody Subtype Identification

[0218] As shown in Table 4, the antibody subtypes of 3D10, 6D9, 7E2, 5B7, and 5A6 are all IgG1, and 4A8 is IgG2a, and the light chain type is κ chain. The antibody subtypes of 4H2 and 4B6 are all IgG1, and the light chain type is κ chain.

[0219] Table 4 Subtype results of monoclonal antibodies

[0220] Antibody Subtype light chain 3D10 IgG1 κ 4A8 IgG2a κ 6D9 IgG1 κ 5B7 IgG1 κ 7E2 IgG1 κ 5A6 IgG1 κ 4H2 IgG1 κ 4B6 IgG1 κ

[0221] 2.15 Indirect immunofluorescence assay with monoclonal antibodies

[0222] like Figure 14 As shown in the figure, the screened CCoV-N protein monoclonal antibodies 3D10, 4A8, 6D9, 7E2, 5B7, and 5A6 can react with CCoV-infected cells and show specific fluorescence under an inverted fluorescence microscope. The CCoV-N protein monoclonal antibodies 4H2 (A) and 4B6 (B) can react with CCoV-infected cells and show specific fluorescence under an inverted fluorescence microscope, as shown in the figure. Figure 29 shown.

[0223] 2.16 Western blot identification of monoclonal antibodies

[0224] The results of 3D10, 4A8, 6D9, 7E2, 5B7, 5A6 are as follows Figure 15 As shown in the figure, the CCoV-N protein monoclonal antibodies screened can all recognize the virus-specific protein band with a molecular weight of about 70kDa (phosphorylated N protein). The 4H2 (A) and 4B6 (B) CCoV-N protein monoclonal antibodies screened can all recognize the virus-specific protein band with a molecular weight of 70kDa (phosphorylated N protein). Figure 30 shown.

[0225] 2.17 Identification of Purified Ascites

[0226] The identification results of 3D10, 4A8, 6D9, 7E2, 5B7, and 5A6 are as follows Figure 16 As shown in the figure, the monoclonal antibody purified from ascites has a band at 50kDa, which is the monoclonal antibody heavy chain, and a band between 20-25kDa is the monoclonal antibody light chain, which is consistent with the expected results of the experiment and the purification effect is good. The concentration of the purified monoclonal antibody after ultrafiltration is above 1mg / mL. The identification results of 4H2 and 4B6 are shown in the figure. Figure 33 shown.

[0227] 2.18 Preparation and Testing of Colloidal Gold Solution

[0228] The present invention plans to use a colloidal gold solution with a particle size of 40nm, such as Figure 17 As shown in A in FIG, the colloidal gold solution is wine red and transparent when observed with the naked eye. The absorption spectrum of the colloidal gold solution is analyzed by scanning between 400-600 nm using a UV-visible spectrophotometer. Figure 17 As shown in B in FIG, it is a single peak, and the maximum absorption peak wavelength is 524 nm. The results show that the colloidal gold solution prepared by the present invention has good performance and meets the test requirements.

[0229] 2.19 Optimal pH value and optimal labeled antibody concentration for gold-labeled antibodies

[0230] After adding 20 μl of 10% NaCl solution, gently mix and let it stand at room temperature for 5 minutes, Figure 18 As shown, it can be observed that the color of the gold-labeled conjugates in different wells changes. The conditions corresponding to the wells with a gold-labeled conjugate color closer to the wine red of the original colloidal gold solution and the highest UV absorbance value are selected as the optimal conditions. Based on the addition amount of 0.2M K2CO3 per 2mL of colloidal gold solution and the addition of 200μl of antibody concentration as the benchmark, the optimal gold-labeled pH and optimal labeled protein amount of the 8 monoclonal antibodies screened as gold-labeled antibodies are shown in Table 5.

[0231] Table 5 Optimal gold labeling pH and optimal labeled protein amount for monoclonal antibodies

[0232]

[0233]

[0234] 1.20 Selection of the Optimal Antibody Pair for Colloidal Gold

[0235] After the antibodies were paired, the optimal conditions were selected to prepare the test strips. 4 TCID 50 / mL of CCoV virus liquid for testing, select Figure 18 As shown, the antibody pair combination was selected: gold label antibody: 4A8, blocking antibody: 4B6, for further experiments. 4 TCID 50 / mL CCoV virus liquid, 10 3 TCID 50 / mL CCoV virus solution, negative sample, F81 cell supernatant were tested, such as Figure 18 shown.

[0236] 2.21 Determination of the optimal NC membrane

[0237] Different types of NC membranes have different sensitivity and specificity. In order to determine the best NC membrane for the test, the same positive sample and negative sample were tested. The reaction results are as follows: Figure 19 As shown, CN95 with higher sensitivity and specificity was selected as the best NC membrane for subsequent experiments.

[0238] 2.22 Determination of the optimal addition volume of gold-labeled conjugate

[0239] As the volume of gold-labeled conjugate added increases, the amount of antibody captured by the T-line test line and the amount of gold-labeled conjugate also increase, and the sensitivity will also increase accordingly; however, if the volume of gold-labeled conjugate added is too much, the nonspecific adsorption of the test strip will also increase. The pre-treated gold-labeled conjugate pad is sprayed with gold and different volumes of gold-labeled conjugate to test the same positive and negative samples, and the color development of the test strip and the detection signal are compared. The reaction results are as follows Figure 20 As shown, 8 μl was selected as the optimal addition volume for subsequent experiments.

[0240] 2.23 Selection of the optimal coating concentration of T line intercepting antibody

[0241] After preparing the test strips, test the same positive sample and negative sample and compare the color development and detection signal of the test strips. Figure 21 As shown, as the T-line concentration increases, the color development and detection signal of the test strip increase accordingly. At higher T-line concentrations, it can completely capture the antigen, resulting in minimal differences in the color development and detection signal, but at the same time, nonspecific adsorption of the T-line is also enhanced. Considering the cost and nonspecificity, 2 mg / mL was selected as the optimal T-line coating antibody concentration.

[0242] 4.24C Line Antibody Optimal Coating Concentration Selection

[0243] The NC membrane was coated with goat anti-mouse IgG antibodies at concentrations of 0.5, 1, 1.5, 2, 2.5, and 3 mg / mL, and the T-line antibody concentration was fixed at 2 mg / mL to optimize the C-line coating concentration. After preparing the test strips, the same positive and negative samples were tested and the color development and detection signals of the test strips were compared. The results are as follows Figure 22 As shown, as the C-line antibody concentration increases, the color development and detection signal of the test strip increase accordingly. At higher T-line concentrations, it can completely capture the antigen, and the color development and detection signal are similar. Therefore, 2.5 mg / mL antibody concentration is selected as the optimal antibody coating amount for the C-line.

[0244] 2.25 Determination of the optimal reaction time

[0245] A batch of test strips were prepared using the optimized conditions of the above test strips, and the same batch of positive samples were tested. The color development and detection signals of the test strips were compared to optimize the reaction time and obtain the best observation and detection effect of the test strips. The results are as follows Figure 23 As shown in the figure, as the reaction time increases, the color development degree and detection signal of the T-line and C-line test strips will increase accordingly. When the reaction time is 15 minutes, the color development degree and detection signal of the T-line and C-line test strips are not much different. Therefore, 15 minutes is selected as the optimal reaction time for interpreting the test strip results.

[0246] 2.26 Evaluation of the sensitivity of colloidal gold test strips

[0247] A batch of test strips were prepared using the optimized conditions of the above test strips. 5 TCID 50 / mL of CCoV standard, respectively, according to the original solution, 1:10, 1:100, 1:1000 with sample treatment solution, the sample treatment solution as a negative control, with the test strips for detection, observe the test strip color. Figure 24 As shown in the figure, when the CCoV standard diluted 1:100 was tested with the test strip, there was still a faint band on the T line, while when the CCoV standard diluted 1:1000 was tested with the test strip, there was no T line. Therefore, the test strip has good sensitivity and the virus content is 10 3 TCID 50 / mL is the lowest detection limit of the test strip of the present invention.

[0248] 4.27 Specificity Evaluation of Colloidal Gold Test Strips

[0249] The test strips were prepared according to the optimized conditions and the samples were tested to identify the specificity of the test strips. Figure 25 As shown, only when the sample to be tested contains CCoV antigen, the test line (T line) and the quality control line (C line) are colored and the T / C value is high. When the sample contains other viral antigens, only the quality control line (C line) is colored, while the test line (T line) is not colored, which shows that the antigen detection test paper of the present invention has high specificity.

[0250] 2.28 Stability Evaluation of Colloidal Gold Test Strips

[0251] The colloidal gold test strips placed at 37°C were tested on the same positive sample at 0d, 10d, 20d, and 30d. The results were as follows: Figure 26 As shown, there is no obvious difference in the brightness of the C and T lines of the test strip on different days, which shows that the test strip of the present invention has good stability.

[0252] 2.29 Testing of clinical samples

[0253] 47 dog fecal swabs were collected and tested using the test strips and RT-PCR method developed by the present invention, and the results were analyzed and compared. The RT-PCR test results are as follows: Figure 27 As shown in Table 6, 18 of the 47 dog fecal swabs were positive and 29 were negative. After comparing the test results of the test strip developed by the present invention, the results are shown in Table 6. Among the 47 dog fecal swabs tested by the test strip, 21 were positive and 26 were negative. Therefore, the total consistency rate of the test strip developed by the present invention and the RT-PCR method is 89.36%.

[0254] Table 6 Clinical sample testing

[0255]

[0256] 2.30 Comparison with commercial test strips

[0257] I bought a certain imported brand of canine coronavirus colloidal gold test strips and tested the CCoV virus liquid with different virus amounts using the test strips developed by the present invention. The results were as follows: Figure 28 As shown, when the amount of virus detected is 10 3 TCID 50 When the CCoV virus liquid was 100 mL / mL, the test strips developed by the present invention still had visible bands, while the commercial test strips had no bands. This shows that the sensitivity of the test strips of the present invention is about 10 times better than that of the commercial test strips. That is, the detection effect of the test strips developed by the present invention is better than that of the commercial test strips.

[0258] The present invention successfully constructed the pET-30a-CCoV-N recombinant plasmid and expressed the CCoV-N recombinant protein in prokaryotes. After immunization, 6 high-efficiency, high-affinity, and high-specificity anti-CCoV-N monoclonal antibodies were screened and named 3D10, 4A8, 6D9, 5B7, 7E2, and 5A6, respectively. 4A8 subsequently had good specificity and sensitivity when used as a gold-labeled antibody. The present invention used the 4A8 and 4B6 antibody pairs as gold-labeled antibodies and intercepting antibodies, respectively, to establish a colloidal gold test strip detection method for canine coronavirus. The hybridoma cell line 4A8, with a deposit number of CCTCCNO: C2024304, was deposited in the China Center for Type Culture Collection, with a deposit address of Wuhan University, Wuhan, China; the hybridoma cell line 4B6, with a deposit number of CCTCCNO: C2024305, was deposited in the China Center for Type Culture Collection, with a deposit address of Wuhan University, Wuhan, China. The minimum detection limit is 10 3 TCID 50 / mL, and has no cross-reaction with CDV, CPV and CPIV, can provide results within 15 minutes, and has good sensitivity and specificity. The test strip of the present invention was further tested on 47 clinical samples, and the results showed that the total compliance rate of the colloidal gold test strip of the present invention was 89.36%.

[0259] The embodiments are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. A hybridoma cell line, characterized in that: The hybridoma cell line is named 4A8, and the deposit number of 4A8 is CCTCC NO: C2024304. It is deposited in China Center for Type Culture Collection, and the deposit address is Wuhan University, Wuhan, China.

2. A monoclonal antibody 4A8 secreted by the hybridoma cell line according to claim 1.

3. The monoclonal antibody 4A8 according to claim 2, characterized in that The heavy chain subtype of the monoclonal antibody 4A8 is IgG2a, and the light chain subtype is κ chain.

4. A method for preparing the monoclonal antibody 4A8 according to claim 2 or 3, characterized in that: The hybridoma cell line 4A8 according to claim 1 is used for secretion.

5. Use of the hybridoma cell line according to claim 1 or the monoclonal antibody 4A8 according to claim 2 or 3 in the preparation of a detection reagent or a detection kit for canine coronavirus.

6. Use of the hybridoma cell line according to claim 1 or the monoclonal antibody 4A8 according to claim 2 or 3 in the preparation of a medicament for preventing and treating diseases caused by infection with canine coronavirus.

7. Use of the hybridoma cell line according to claim 1 or the monoclonal antibody 4A8 according to claim 2 or 3 in preparing a canine coronavirus vaccine.

8. An immune colloidal gold test strip for detecting canine coronavirus N protein, characterized in that: The immunocolloidal gold test strip uses the monoclonal antibody 4A8 described in claim 2 or 3 as a gold-labeled antibody.

9. The method for preparing the immune colloidal gold test strip according to claim 8, wherein The method includes the steps of spraying the monoclonal antibody 4B6 onto an NC membrane as a detection line, wherein the monoclonal antibody 4B6 is secreted by a 4B6 hybridoma cell line, the deposit number of the 4B6 hybridoma cell line is CCTCC NO: C2024305, and the cell line is deposited in the China Center for Type Culture Collection, Wuhan University, Wuhan, China; the heavy chain subtype of the monoclonal antibody 4B6 is IgG1, and the light chain subtype is κ chain.

10. The preparation method according to claim 9, characterized in that The preparation method comprises the steps of diluting goat anti-mouse IgG with a streak diluent and spraying the diluent below the detection line on the NC membrane at 1.0 mL / cm as a quality control line.

Images