Molecular marker combination of wheat ear sprouting resistance related gene and application thereof
By designing primer combinations of OCO1, LCYE, and WRKY2, and combining them with KASP primers for PCR amplification and fluorescence detection, the problem of low efficiency in screening for wheat ear sprouting resistance was solved, achieving efficient breeding and germplasm resource improvement.
Patent Information
- Application Number
- CN202411498669.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-10-25
- Publication Date
- 2026-03-20
- Estimated Expiration
- 2044-10-25
AI Technical Summary
Current technologies for molecular marker screening of wheat ear sprouting resistance-related genes have low efficiency, which cannot meet the needs of large-scale breeding screening, resulting in economic losses and low breeding efficiency.
A molecular marker combination including primer pairs OCO1, LCYE, and WRKY2 was designed, and PCR amplification was performed using a KASP primer combination. The polymorphism of wheat ear sprouting resistance-related genes was detected using fluorescent molecular markers, and a kit is provided for wheat breeding.
It enables efficient screening of wheat ear germination resistance genes, shortens breeding time, improves breeding efficiency, reduces manpower and material resources consumption, is applicable to selection under various environmental conditions, and improves the improvement effect of wheat germplasm resources.
Smart Images

Figure CN119242840B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of plant breeding, and particularly relates to a molecular marker combination of a wheat ear sprouting resistance related gene and application thereof. BACKGROUND
[0002] Wheat ear sprouting can cause a series of physiological and biochemical changes, including the activities of plant hormones and hydrolytic enzymes, the decomposition of grain proteins and storage substances, and the dramatic changes of grain quality characteristics, thereby leading to yield reduction and unsuitable processing, and further affecting economic benefits. At present, once the ear sprouting event occurs in the wheat production area, it will bring direct and indirect economic losses to local farmers.
[0003] The wheat OCO1 gene is located in a 2.4 Mb presence / absence variation (PAV) interval on the 3D chromosome. This interval is deleted in most white-grained wheat varieties, and wheat materials containing this interval mostly have the ability to resist ear sprouting, indicating that the OCO1 gene is closely linked to the wheat ear sprouting resistance phenotype. At present, it is known that various plant hormones can affect ear sprouting resistance, among which abscisic acid (ABA) is the main regulating hormone. The initial synthesis of ABA is carried out in the cytoplasm, LCYE is responsible for the conversion of lycopene to lutein and beta-carotene, and participates in the biosynthesis of carotenoids. Carotenoids are catalyzed by ZEP encoded maize xanthophyll epoxidase to form violaxanthin, and then oxidized by 9-cis-epoxy carotenoid dioxygenase to form xanthophyll aldehyde. Subsequently, xanthophyll aldehyde is transported to the cytosol, catalyzed by short-chain alcohol dehydrogenase and aldehyde oxidase, and activated by the molybdenum cofactor sulfase encoded by ABA3, and finally forms biologically active ABA. ABA also participates in plant stress response, in which WRKY transcription factors play an important role. Compared with wild-type plants, overexpression of TaWRKY2 transgenic Arabidopsis improves tolerance to salt, drought and / or freezing stress. Regulating TaWRKY2 in wheat or other crops can improve their tolerance to various abiotic stress conditions, which may also include tolerance to ear sprouting.
[0004] Molecular marker assisted breeding uses molecular markers that are closely linked and co-segregated with target genes to accurately associate genotypes and phenotypes of different individuals in hybrid offspring, and then assists in selection. Compared with traditional breeding, molecular marker assisted breeding has the advantages of shortening the breeding period, improving breeding efficiency, saving manpower and material resources, being not limited by time and environment, and being able to select samples at different stages or under various environmental conditions. However, the screening efficiency of existing markers is low, which cannot meet the needs of large-scale breeding screening. SUMMARY
[0005] In order to solve the problems in the prior art, the present application provides a molecular marker combination of a wheat ear sprouting resistance related gene and application thereof.
[0006] In a first aspect, the present application provides a molecular marker combination, which comprises the nucleotide sequences shown in SEQ ID NO. 1-3.
[0007] The nucleotide sequence shown in SEQ ID NO. 1 has polymorphism at position 102, and the polymorphism is A / T;
[0008] The nucleotide sequence shown in SEQ ID NO. 2 has polymorphism at position 107, and the polymorphism is C / G;
[0009] The nucleotide sequence shown in SEQ ID NO. 3 has polymorphism at position 24, and the polymorphism is G / C.
[0010] The nucleotide sequence shown in SEQ ID NO. 1 is:
[0011] TGATAGCCTTAGACGAGACGCATTATCAAGACGGTTACAAAGATGGTTATGATGATGGCATGGTATCTGGAAAAGAAGAAGGAAGGCAGGTCGGTTTAAAGTTGGGTTTCCAGGTAGGTGA.
[0012] The nucleotide sequence shown in SEQ ID NO. 2 is:
[0013] CGTCAGCGCTCATTCTTCCTCTTTGGATTGGCCTTGATAATTCAACTGGATAACGAAGGCATTCAAACATTCTTCGAGAGCTTTTTCCGGTTACCCAAATGGATGTGGCGAGGATTCCTTGGTTCGA.
[0014] The nucleotide sequence shown in SEQ ID NO. 3 is:
[0015] CAAGTGGTAGAAGTGAGCAACAAGAGCAGCAGCGGCGACAACAACAAGCAGGTTGAGGACGGATACAATTGGAGGAAGTACGGGCAGAAGCAAGTTAAGGGCAGCGAGAACCCGCGGAGCTACTACAAGTGCACCTA.
[0016] In a second aspect, the present application provides a primer combination, which comprises an OCO1 primer pair, an LCYE primer pair and a WRKY2 primer pair.
[0017] The OCO1 primer pair comprises:
[0018] TaOCOl_D_COM: TGATAGCCTTAGACGAGACGC,
[0019] TaOCOl_D_FAM: TCACCTACCTGGAAACCCAA,
[0020] TaOCOl_D_HEX: TCACCTACCTGGAAACCCAT;
[0021] The LCYE primer pair comprises:
[0022] LCYE_B_1451_COM: CGTCAGCGCTCATTCTTCCTC,
[0023] LCYE_B_1451_FAM: TCGAACCAAGGAATCCTCGCC,
[0024] LCYE_B_1451_HEX: TCGAACCAAGGAATCCTCGCG;
[0025] The WRKY2 primer pair comprises:
[0026] WRKY2_B_524_COM: TAGGTGCACTTGTAGTAGCTCC,
[0027] WRKY2_B_524_FAM: CAAGTGGTAGAAGTGAGCAACAAG,
[0028] WRKY2_B_524_HEX: CAAGTGGTAGAAGTGAGCAACAAC.
[0029] Further, a fluorescent molecule can be connected to the primer comprising the polymorphic site, for example FAM is connected to the primer labeled with FAM as above, and HEX is connected to the primer labeled with HEX. In fact, other fluorescent molecules can be connected besides FAM and HEX, for example Cy3, Cy5, TET or ROX.
[0030] The nucleotide sequence of FAM comprises: gaaggtgaccaagttcatgct, and the nucleotide sequence of HEX comprises: gaaggtcggagtcaacggatt.
[0031] In a third aspect, the present application provides a kit comprising the molecular marker combination or the primer combination.
[0032] In a fourth aspect, the present application provides the use of the molecular marker combination, the primer combination or the kit in detecting wheat spike sprouting resistance.
[0033] The application further provides the use of the molecular marker combination, the primer combination or the kit in any of the following:
[0034] i) detecting wheat ear emergence resistance related genes OCO1, LCYE and WRKY2;
[0035] ii) breeding wheat with low ear emergence rate;
[0036] iii) molecular marker assisted breeding of wheat;
[0037] iv) identification of wheat germplasm resources;
[0038] v) improvement of wheat germplasm resources.
[0039] In a fifth aspect, the application provides a method for identifying wheat ear emergence resistance, comprising:
[0040] detecting the polymorphism of the molecular marker combination in the wheat to be tested, and judging the ear emergence resistance of the wheat to be tested according to the detection result.
[0041] Further comprising:
[0042] extracting the genomic DNA of the wheat to be tested, performing PCR amplification using the KASP primer combination described above, and judging the ear emergence resistance of the wheat to be tested according to the amplification result.
[0043] Further, in a total system of 10 μL, the reaction system of the PCR amplification comprises:
[0044] 2× KASP Master Mix 5~10 μL, KASP Assay Mix 1~3 μL, wheat template DNA with a concentration of 50~150 ng / μL 1~3 μL, MgCl20.05~0.3 μL, and the rest is ddH2O;
[0045] The reaction program comprises:
[0046] 93~97℃ 8~15min; 93~97℃ 15~30s, 61~55℃ 30~60s, 10~15 cycles of decreasing 0.5~1℃ each cycle; 93~97℃ 15~30s, 52~60℃ 30~60s, 30~40 cycles.
[0047] Further, the judging the ear emergence resistance of the wheat to be tested according to the detection result comprises:
[0048] the wheat with the detection result of T of the molecular marker shown as SEQ ID NO. 1 has higher ear emergence resistance than C.
[0049] The wheat with the detection result of C of the molecular marker as shown in SEQ ID NO. 2 has higher resistance to ear sprouting than G;
[0050] The wheat with the detection result of G of the molecular marker as shown in SEQ ID NO. 3 has higher resistance to ear sprouting than C.
[0051] Further, a primer combination labeled with a fluorescent molecule can be used for detection, and the detection result of the molecular marker is judged according to the fluorescence detection result.
[0052] For example, TaOCO1_D_FAM, LCYE_B_1451_FAM and WRKY2_B_524_FAM primers are labeled with FAM; TaOCO1_D_HEX, LCYE_B_1451_HEX and WRKY2_B_524_HEX primers are labeled with HEX.
[0053] At this time, if the fluorescence detection result is calibrated as blue and orange, it indicates that the genotype of the sample wheat is two different homozygous types, if the fluorescence detection result is calibrated as green, it indicates that the genotype of the sample wheat is a heterozygous type, and if the fluorescence detection result is calibrated as black, it indicates that the genotype of the sample wheat is blank.
[0054] When OCO1 fluorescence is orange, LCYE is C at the 1451th base of the coding sequence, and fluorescence is orange, and WRKY2-B is G at the 524th base of the coding sequence, and fluorescence is orange, the ear sprouting resistance of the wheat is the highest.
[0055] The present application has the following beneficial effects:
[0056] The present application obtains new SNP sites based on the wheat ear sprouting resistance related genes OCO1, LCYE and WRKY2, and designs the corresponding KASP primer combination. The polymorphism detection result based on these SNP sites can realize the detection of the wheat ear sprouting resistance. The SNP sites and the KASP primer combination provided by the present application can be used for the improvement of wheat germplasm resources, and have important application value in the field of wheat breeding. BRIEF DESCRIPTION OF DRAWINGS
[0057] In order to more clearly illustrate the technical solutions in the present application or prior art, the following will briefly introduce the drawings needed to be used in the embodiments or prior art description. Obviously, the drawings in the following description are some embodiments of the present application, and those skilled in the art can also obtain other drawings according to these drawings without creative labor.
[0058] Figure 1is a schematic diagram of primer development provided by embodiment 1 of the present application.
[0059] Figure 2 is the evaluation and detection result of the KASP primer combination designed in embodiment 1 provided by embodiment 2 of the present application.
[0060] Figure 3 is the evaluation and detection result of the KASP primer combination in the Triticum aestivum x Chuanmai 23 parent population provided by embodiment 3 of the present application.
[0061] Figure 4 is the evaluation and detection result of the KASP primer combination in the Triticum aestivum x Yanfeng 168 parent population provided by embodiment 4 of the present application. DETAILED DESCRIPTION
[0062] In order to make the objects, technical solutions and advantages of the present application clearer, the technical solutions in the present application will be described clearly and completely below in combination with the drawings in the present application. Obviously, the described embodiments are part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor fall within the protection scope of the present application.
[0063] The experimental methods involved in the following embodiments are all conventional methods in the art if not specifically mentioned, for example, the conditions suggested by the manuals in the art or the manufacturer's instructions can be referred to.
[0064] The experimental materials and reagents involved in the following embodiments can be obtained from commercial channels if not specifically mentioned.
[0065] Embodiment 1
[0066] In this embodiment, sequence analysis and molecular marker development are performed on the wheat spike germination related genes OCO1, LCYE and WRKY2-B, and the flow is as follows:
[0067] The present application finds the genes OCO1, LCYE and WRKY2-B that may be related to spike germination by searching the literature and databases related to seed dormancy germination and ABA signal, wherein:
[0068] The OCO1 gene has an ID of TraesCS3D02G468600, a copy number of 3, a chromosome of 3A / 3B / 3D, and a gene coding sequence length of 411;
[0069] The LCYE gene has an ID of TraesCS3B03G0624200, a copy number of 3, a chromosome of 3A / 3B / 3D, and a gene coding sequence length of 1611;
[0070] The WRKY2-B gene has a gene ID of TraesCS1B03G0235500, a copy number of 3, a chromosome of 1A / 1B / 1D, and a gene coding sequence length of 1377.
[0071] According to the gene sequence of the wheat (search for literature), the SNP sites linked to the genes OCO1, LCYE and WRKY2-B are screened by comparison, and the polymorphism of the SNP sites will cause the change of the amino acid sequence. The KASP primers (primer development schematic diagram as shown) are designed for the SNP sites, and finally the primers designed artificially are evaluated by using the Ensembleplants website (http: / / plants.ensembl.org / ), and the SNP sites obtained are as follows: Figure 1
[0072] The SNP site of the OCO1 gene is located at the 121st site of the coding sequence, and the polymorphism is A / T.
[0073] The SNP site of the LCYE gene is located at the 1451st site of the coding sequence, and the polymorphism is C / G.
[0074] The SNP site of the WRKY2-B gene is located at the 524th site of the coding sequence, and the polymorphism is C / G.
[0075] The KASP primer combination designed in the application includes the following primers:
[0076] Table 1 primer name and sequence
[0077]
[0078] The KASP marker system contains two specific primers and one universal primer. The front end of one specific primer is added with a specific sequence GAAGGTGACCAAGTTCATGCT capable of combining with FAM fluorescence; the front end of the other specific primer is added with a specific sequence GAAGGTCGGAGTCAACGGATT capable of combining with HEX fluorescence. The primer sequences are synthesized by Shengong Bioengineering (Shanghai) Co., Ltd.
[0079] Example 2
[0080] This embodiment provides the application of the KASP primer combination provided in Example 1 in the identification of a natural population of wheat.
[0081] 1. Experimental materials
[0082] The specific wheat names involved in the embodiment are shown in Tables 2-5, which include wheat local varieties, conventional breeding varieties and foreign wheat varieties. All materials in the following examples are preserved and provided by the Crop Genetic Breeding Team of the Wheat Institute of Sichuan Agricultural University.
[0083] Table 2 Biomaterial information - first part
[0084]
[0085] Table 3 Biomaterial information - second part
[0086]
[0087] Table 4 Biomaterial information - third part
[0088]
[0089] Table 5 Biomaterial information - fourth part
[0090]
[0091] All the test material seeds in Tables 2-5 were germinated at room temperature for about 7 days, and the tender leaves were cut, and the genomic DNA was extracted by the conventional CTAB method (the extraction method is a conventional method, and the extraction method used in this embodiment is described in the literature (Porebski S, Bailey L G, Baum B R. Modification of a CTAB DNA extraction protocol for plants containing high polysaccharide and polyphenol components[J]. Plant molecular biology reporter, 1997, 15: 8-15).
[0092] PCR amplification was performed using the KASP primers designed in Table 1.
[0093] The PCR reaction system was as follows: 2x KASP Master Mix 5 μL (Beijing Jiacheng), KASP Assay Mix 1.4 μL, wheat template DNA with a concentration of 100 ng / μL 1 μL, MgCl20.08 μL, and ddH2O was added to 10 μL; wherein, the KASP Assay Mix included the following: the primer FAM with a concentration of 100 μM 12 μL, the primer HEX with a concentration of 100 μM 12 μL, the universal primer with a concentration of 100 μM 30 μL, and ddH2O was added to 100 μL;
[0094] The PCR reaction program was as follows: 95℃ for 10 min; 95℃ for 20 s, 61-55℃ for 40 s, decreasing by 0.6℃ per cycle, for a total of 10 cycles; 95℃ for 20 s, 55℃ for 40 s, for a total of 35 cycles. PCR results were analyzed using a KASP fluorescence analyzer (Bio-Rad CFX96 Touch Real-Time PCR Detection System).
[0095] Wheat grains at the waxy maturity stage (as shown in Table 3) were collected from the field and air-dried at room temperature for 7 days. After threshing, 50 grains were taken for a grain germination experiment, repeated three times. The rupture of the embryo epidermis was used as the germination standard, and the average grain germination rate was calculated on the 7th day.
[0096] Table 6 Results of molecular marker t-test
[0097]
[0098] Table 7 Detection results of OCO1-LCYE-WRKY2 label combination
[0099]
[0100] Fluorescence detection results of molecular markers as follows Figure 2 As shown: All markers were successfully genotyped, FAM was orange, HEX was blue, heterozygote was green, and blank was black. The marker detection results and grain germination rate are listed in Table 6. Analysis of the relationship between different SNPs and grain germination rate based on genotype and grain germination rate is shown in Table 6, indicating that these intragene markers are associated with germination rate; the superior SNPs in the OCO1, LCYE, and WRKY2-B genes are T, C, and G, respectively. This invention subsequently performed statistical analysis on the superior allele combination effects of the OCO1, LCYE, and WRKY2-B genes in the wheat population, and the results are shown in Table 7. When the SNP type of the three genes is TCG, the grain germination rate is significantly lower than other combinations (…). P The value ≤0.01 indicates that the aggregation of the superior SNP types (TCGs) of these three genes can effectively reduce the germination rate and improve the wheat's resistance to ear germination. Therefore, the aggregation of this marker combination in wheat materials can provide a reference for breeding wheat materials resistant to ear germination.
[0101] Example 3
[0102] This embodiment applies the KASP primer combination provided in Example 1 to the selection of wheat materials resistant to pre-sprouting in the progeny of the parental population of Caucasian wheat × Chuanmai 23, including the following process:
[0103] 1. Experimental materials
[0104] Wheat Chinese Spring is a pre-harvest sprouting resistant wheat, and the marker detection result of OCO1-LCYE-WRKY2 is T-C-G; Chuanmai 23 is a pre-harvest sprouting susceptible wheat, and the marker detection result of OCO1-LCYE-WRKY2 is A-G-G. The materials in the following table are a F3 hybrid population of Wheat Chinese Spring x Chuanmai 23. All the materials in the following examples are preserved and provided by the Crop Genetics and Breeding Team of the Wheat Institute of Sichuan Agricultural University.
[0105] 2. Experimental method
[0106] Genotype separation and resistant / susceptible pre-harvest sprouting phenotype separation will occur in the population of Wheat Chinese Spring x Chuanmai 23. In order to verify whether the KASP primer combination provided in Example 1 can screen resistant pre-harvest sprouting materials, the present application first detects the OCO1 genotype. DNA is extracted from field leaves, and the KASP primer of the present application is used for amplification, and the genotypes of LCYE and WRKY2 are detected from the detected OCO1 excellent allele genotype (T). Finally, materials in which the excellent SNP types (T-C-G) of the three genes are aggregated together are screened out. The grains at the ripening stage are collected, and the grain germination rate is detected.
[0107] 3. Experimental results
[0108] The detection results are shown in Table Figure 3 . It is shown that the aggregation of the excellent SNP types (T-C-G) of the three genes can effectively reduce the germination rate, so as to screen out pre-harvest sprouting resistant wheat materials.
[0109] Table 8 Marker detection results in the parent population of Wheat Chinese Spring x Chuanmai 23-Part 1
[0110]
[0111] Table 9 Marker detection results in the parent population of Wheat Chinese Spring x Chuanmai 23-Part 2
[0112]
[0113] Table 10 Marker detection results in the parent population of Wheat Chinese Spring x Chuanmai 23-Part 3
[0114]
[0115] Example 4
[0116] The KASP primer combination provided in Example 1 is further applied to the detection of pre-harvest sprouting resistance traits of the offspring of Wheat Chinese Spring x Yefeng 168.
[0117] 1. Experimental materials:
[0118] Wheat Chinese Spring is a pre-harvest sprouting resistant wheat, the marker detection result of OCO1-LCYE-WRKY2 is T-C-G; Yufeng 168 is a pre-harvest sprouting sensitive wheat, the marker detection result of OCO1-LCYE-WRKY2 is A-G-G. The materials in the following table are a F3 hybrid population of Wheat Chinese Spring x Yufeng 168. All the materials in the following examples are preserved and provided by the Crop Genetic Breeding Team of the Wheat Institute of Sichuan Agricultural University.
[0119] 2. Experimental method:
[0120] Genotype separation and resistant / sensitive pre-harvest sprouting phenotype separation will occur in the population of Wheat Chinese Spring x Yufeng 168. In order to verify whether the marker primer combination of the present application can screen resistant pre-harvest sprouting materials, the genotypes of OCO1 and LCYE were detected by the developed KASP marker primer set, and WRKY2 did not have genotype separation in the parents. DNA was extracted from field leaves, and the KASP primer of the present application was used for amplification; the grains at the hardening stage were collected, and the grain germination rate was detected.
[0121] 3. Experimental results:
[0122] The detection results are shown in Table 11. Figure 4 It is shown that the excellent SNP types (T-C-G) of the three genes can be effectively reduced in germination rate, thereby screening pre-harvest sprouting resistant wheat materials.
[0123] Table 11 Marker detection results in the parent population of Wheat Chinese Spring x Yufeng 168-Part 1
[0124]
[0125] Table 12 Marker detection results in the parent population of Wheat Chinese Spring x Yufeng 168-Part 2
[0126]
[0127] Finally, it should be noted that: the above examples are only used to illustrate the technical solutions of the present application, but not to limit it; although the present application has been described in detail with reference to the foregoing examples, those skilled in the art should understand that: it can still modify the technical solutions recorded in the foregoing examples, or make equivalent replacement for part of the technical features; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the spirit and scope of the technical solutions of the embodiments of the present application.
Claims
1. A molecular marker combination, characterized in that, The molecular marker combination includes molecular markers with nucleotide sequences as shown in SEQ ID NO. 1-3; As shown in SEQ ID NO.1, position 102 of the nucleotide sequence exhibits a polymorphism of A / T; As shown in SEQ ID NO.2, the nucleotide sequence at position 107 is polymorphic, with a polymorphism of C / G; As shown in SEQ ID NO.3, the nucleotide sequence at position 24 is polymorphic, with a polymorphism of G / C.
2. A primer combination, characterized in that, Including OCO1 primer pair, LCYE primer pair, and WRKY2 primer pair; The OCO1 primer pair includes: TaOCO1_D_COM:TGATAGCCTTAGACGAGACGC, TaOCO1_D_FAM:TCACCTACCTGGAAACCCAA, TaOCO1_D_HEX:TCACCTACCTGGAAACCCAT; The LCYE primer pair includes: LCYE_B_1451_COM:CGTCAGCGCTCATTCTTCCTC, LCYE_B_1451_FAM: TCGAACCAAGGAATCCTCGCC, LCYE_B_1451_HEX: TCGAACCAAGGAATCCTCGCG; The WRKY2 primer pair includes: WRKY2_B_524_COM:TAGGTGCACTTGTAGTAGCTCC, WRKY2_B_524_FAM:CAAGTGGTAGAAGTGAGCAACAAG, WRKY2_B_524_HEX:CAAGTGGTAGAAGTGAGCAACAAC.
3. A reagent kit, characterized in that, Includes the primer combination described in claim 2.
4. The application of the molecular marker combination of claim 1, the primer combination of claim 2, or the kit of claim 3 in detecting wheat ear germination resistance.
5. The application of the molecular marker combination of claim 1, the primer combination of claim 2, or the kit of claim 3 in the cultivation of wheat with low spikelet germination rate.
6. A method for identifying wheat ear germination resistance, characterized in that, include: The polymorphism of the molecular marker combination as described in claim 1 is detected in the wheat to be tested, and the ear germination resistance of the wheat to be tested is determined based on the detection results.
7. The method according to claim 6, characterized in that, include: Genomic DNA was extracted from the wheat to be tested and PCR amplification was performed using the primer combination described in claim 2. The ear sprouting resistance of the wheat to be tested was determined based on the amplification results.
8. The method according to claim 7, characterized in that, The PCR amplification reaction procedure includes: 93~97℃ for 8~15min; 93~97℃ for 15~30s, 61~55℃ for 30~60s, decreasing by 0.5~1℃ per cycle, for a total of 10~15 cycles; 93~97℃ for 15~30s, 52~60℃ for 30~60s, for a total of 30~40 cycles.
9. The method according to any one of claims 6-8, characterized in that, The determination of the ear germination resistance of the wheat under test based on the test results includes: As shown in SEQ ID NO.1, wheat with a molecular marker detection result of T has higher resistance to ear germination compared to wheat with A; As shown in SEQ ID NO.2, wheat with molecular marker detection result C has higher resistance to ear sprouting compared to wheat with G; As shown in SEQ ID NO.3, wheat with a molecular marker detection result of G has higher resistance to ear sprouting compared to wheat with C.
Citation Information
Patent Citations
Wheat preharvest sprouting resistance character-related KASP molecular markers and application thereof
CN107217098A
Development and application of KASP marker of low-temperature-resistant gene COLD1 in rice seedling stage
CN115094157A