Construction method and application of humanized COL3A1 gene mouse model

Abstract

The invention belongs to the field of animal models, and particularly relates to a construction method and application of a humanized COL3A1 gene mouse model. Based on a gene editing means, fixed-point insertion is performed on the human COL3A1 gene, a fertilized ovum with the mutation can develop an adult COL3A1 gene mouse model, and a foundation is laid for researching the structure and the biological effect of III-type collagen. And a favorable model is provided for evaluating related diseases such as skin, heart and tissue fibrosis and related medicines, cosmetics and medical instruments of the diseases.

Description

Technical Field

[0001] The present application belongs to the field of animal models, and specifically relates to a method for constructing a humanized COL3A1 gene mouse model and its application. Background Art

[0002] Collagen is the most abundant protein in the human body, comprising approximately one-third of its protein composition and possessing at least 16 different isoforms. Type III collagen was first discovered and described in a pioneering study by Miller EJ et al. in 1971. In humans, type III collagen is encoded by the COL3A1 gene. Collagen primarily interacts with cells or cell surface receptors through multiple receptor families, regulating their adhesion, migration, proliferation, and differentiation. Collagen has a wide tissue distribution and, therefore, plays a major role in physiological and pathological processes.

[0003] Type III collagen, a member of the fibrillar collagen family, is widely expressed in a variety of elastic human tissues, including the dermis, ligaments, blood vessels, gastrointestinal tract, uterus, and various internal organs such as the lungs and liver. It accounts for approximately 5% to 20% of the body's total collagen content and is widely considered by researchers to be an important structural protein. Among the various collagen family members, type III collagen has been found to possess crucial homeostatic properties, such as maintaining the structural integrity of various organs and tissues. In addition to its homeostatic properties, abnormal expression of type III collagen has been demonstrated in various pathologies. Type III collagen supports tissue and wound healing, participates in embryonic development and normal brain development during embryogenesis, acts as a modifier of the fibrillar network, participates in platelet aggregation, initiates the blood coagulation cascade, mediates immune responses, and participates in inflammatory processes.

[0004] Previous research has focused on the role of type III collagen in cell biology and its connection to human disease. Type III collagen was initially described as a major structural component of hollow organs. Soon after, expression of type III collagen was reported in other tissues, such as bone, gallbladder, placenta, bladder, gastrointestinal tract, fat, heart, and endometrium. Furthermore, differential expression of type III collagen in various diseases has been revealed. While a series of studies have investigated the biological role of type III collagen, differences in the amino acid sequence of COL3A1 in animals and its human counterpart have limited the accuracy of studies on the role of type III collagen in various diseases, hindering its applicability to human diseases.

[0005] Therefore, the development of a humanized COL3A1 gene mouse model is of vital importance. In view of this, this application is hereby filed. Summary of the Invention

[0006] Based on this, one embodiment of the present application provides a method for constructing a humanized COL3A1 gene mouse model and its application.

[0007] Another aspect of the present application provides a method for constructing a humanized COL3A1 gene mouse model, comprising:

[0008] The human COL3A1 gene was knocked into the H11 site of chromosome 11 of a mouse fertilized egg using gene editing technology to construct a recombinant fertilized egg; the sequence of the human COL3A1 gene is shown in SEQ ID NO.1.

[0009] The recombinant fertilized eggs are introduced into surrogate mice for gestation, and positive mice are selected from the born mice to obtain F0 generation mice.

[0010] The F0 generation mice were mated with wild-type mice, and positive heterozygous F1 generation mice were screened from the newborn mice to serve as a humanized COL3A1 gene mouse model.

[0011] In some embodiments, the gene editing technology includes one or more of BE3, CRISPR / Cas9, TALEN and ZFN.

[0012] In some embodiments, constructing a recombinant zygote comprises:

[0013] The DNA sequence of the gRNA shown in SEQ ID NO.2 was cloned into the vector to construct a recombinant plasmid.

[0014] The recombinant plasmid is used as a template for PCR amplification to obtain a template, and the template is transcribed to obtain gRNA.

[0015] The gRNA, Cas9 protein and / or Cas9 protein mRNA and a homologous recombination vector containing the human COL3A1 gene are co-injected into mouse fertilized eggs to construct recombinant fertilized eggs.

[0016] In some embodiments, the homologous recombination vector of the human COL3A1 gene is Col3a1-hCOL3A1-WPRE-PolyA.

[0017] In some embodiments, the screening step includes: performing PCR amplification on the genomic DNA of the newborn pups, detecting the obtained amplification products, and screening out the humanized COL3A1 gene mouse model based on the obtained detection results.

[0018] The sequences of the primers for PCR amplification are shown in SEQ ID NO.3 to SEQ ID NO.8.

[0019] On the other hand, the present application provides the tissues or organs of the humanized COL3A1 gene mouse model constructed by the method for constructing the humanized COL3A1 gene mouse model.

[0020] On the one hand, the present application provides an application of a humanized COL3A1 gene mouse model in the screening and safety evaluation of drugs, medical devices or cosmetics.

[0021] In some embodiments, the medicine includes one or more of collagen drugs and anti-fibrosis drugs; the medical device or cosmetic includes one or more of collagen fillers, injections, and topical preparations.

[0022] On the other hand, the present application provides a gRNA targeting the H11 site of mice, and the gRNA targeting the H11 site of mice is shown as SEQ ID NO.2.

[0023] On the other hand, the present application provides a humanized COL3A1 gene editing system, which includes: a gRNA targeting the H11 site of mice, a homologous recombination vector, and a Cas9 protein and / or Cas9 protein mRNA.

[0024] The homologous recombination vector is Col3a1-hCOL3A1-WPRE-PolyA.

[0025] This application uses gene editing to perform site-specific insertion of the human COL3A1 gene. Fertilized eggs with this mutation can develop into hCOL3A1 gene mouse models, providing a favorable model for studying the structure and biological effects of type III collagen, as well as tissue fibrosis, skin, heart diseases, and related drug and device screening and safety evaluation.

[0026] The details of one or more embodiments of the present application are set forth in the description below, and other features, objects, and advantages of the application will become apparent from the description and from the claims thereof. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] In order to more clearly illustrate the technical solutions in the embodiments of the present application and to more fully understand the present application and its beneficial effects, the following is a brief introduction to the drawings required for describing the embodiments. Obviously, the drawings described below are only some embodiments of the present application. Those skilled in the art can also derive other drawings based on these drawings without inventive effort.

[0028] Figure 1 Construct a design strategy diagram for the specific model of this application;

[0029] Figure 2A plasmid vector map provided in one embodiment of the present application;

[0030] Figure 3 Constructing genotyping strategies for the models of this application;

[0031] Figure 4 The genotype identification results of the F0 generation of mice of the hCOL3A1 mouse model of this application;

[0032] Figure 5 The genotype identification results of the F1 generation of mice of the hCOL3A1 mouse model of this application;

[0033] Figure 6 The results of human COL3A1 gene detection in hCOL3A1 mice in this application;

[0034] Figure 7 This is a picture of neck ulcers in WT mice and hCOL3A1 mice two weeks after subcutaneous injection of recombinant human collagen;

[0035] Figure 8 These are the test results of the hCOL3A1 mouse sample in this application. DETAILED DESCRIPTION

[0036] Below in conjunction with embodiment and example, the application is described in further detail.Should be understood that these embodiment and example are only used to illustrate the application and are not used to limit the scope of the application, and the purpose of providing these embodiment and example is to make the understanding of the disclosure of the application more thorough and comprehensive.It should also be understood that the application can be implemented in many different forms, is not limited to the embodiment and example described herein, and those skilled in the art can make various changes or modifications without violating the connotation of the application, and the equivalent form obtained also falls within the protection scope of the application.In addition, in the description hereinafter, a large amount of specific details are given in order to provide a more complete understanding of the application, and it should be understood that the application can be implemented without one or more of these details.

[0037] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.

[0038] the term

[0039] Unless otherwise specified or incompatible herewith, the terms and phrases used herein shall have the following meanings:

[0040] The terms "and / or", "or / and", and "and / or" used herein include any one of two or more related listed items, and also include any and all combinations of the related listed items, wherein the arbitrary and all combinations include any combination of two related listed items, any more related listed items, or all related listed items. It should be noted that when at least three items are connected by at least two conjunctions selected from "and / or", "or / and", and "and / or", it should be understood that in this application, the technical solution undoubtedly includes technical solutions connected by "logical and" and also undoubtedly includes technical solutions connected by "logical or". For example, "A and / or B" includes three parallel solutions of A, B and A+B. For example, the technical solution of "A, and / or, B, and / or, C, and / or, D" includes any one of A, B, C, and D (that is, the technical solution of all being connected by "logical OR"), and also includes any and all combinations of A, B, C, and D, that is, the combination of any two or any three of A, B, C, and D, and also includes the four-item combination of A, B, C, and D (that is, the technical solution of all being connected by "logical AND").

[0041] In this application, "plurality", "multiple", "multiple times", "multiples", etc., unless otherwise specified, refer to a quantity greater than or equal to 2. For example, "one or more" means one or more than or equal to two.

[0042] As used herein, "combination thereof", "any combination thereof", "any combination thereof" and the like include all suitable combinations of any two or more of the listed items.

[0043] Herein, the “suitable” mentioned in “suitable combination”, “suitable method”, “any suitable method”, etc. shall be based on the ability to implement the technical solution of this application, solve the technical problems of this application, and achieve the expected technical effects of this application.

[0044] In this application, "further", "further", "particularly" and the like are used for descriptive purposes to indicate differences in content, but should not be understood as limiting the scope of protection of this application.

[0045] In this application, the terms "optionally," "optional," and "optional" mean optional or dispensable, i.e., they refer to either option being selected from two parallel options: "with" or "without." If a technical solution contains multiple "optional" clauses, each "optional" clause is independent unless otherwise specified and there are no contradictions or constraints.

[0046] In this application, the technical features described in an open manner include closed technical solutions composed of the listed features, and also include open technical solutions containing the listed features.

[0047] In this application, when referring to a numerical interval (i.e., a numerical range), unless otherwise specified, the distribution of the optional values ​​within the numerical interval is considered continuous and includes the two numerical endpoints of the numerical range (i.e., the minimum and maximum values), as well as every numerical value between these two numerical endpoints. Unless otherwise specified, when a numerical interval refers only to integers within the numerical interval, it includes the two numerical endpoints of the numerical range, as well as every integer between the two numerical endpoints. In this document, this is equivalent to directly listing each integer. For example, "t is an integer selected from 1 to 10" means that t is any integer selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10. In addition, when multiple ranges are provided to describe a feature or characteristic, these ranges may be combined. In other words, unless otherwise specified, ranges disclosed herein should be understood to include any and all subranges subsumed therein.

[0048] Unless otherwise specified, the temperature parameters in this application allow for both constant temperature treatment and temperature fluctuations within a certain temperature range. It should be understood that the constant temperature treatment allows for temperature fluctuations within the accuracy range of instrument control. Fluctuations within ranges such as ±5°C, ±4°C, ±3°C, ±2°C, and ±1°C are permitted.

[0049] In this application, % (w / w) and wt% both refer to weight percentage, % (v / v) refers to volume percentage, and % (w / v) refers to mass volume percentage.

[0050] All documents mentioned in this application are cited as references in this application, just as each document is cited as a reference individually. Unless they conflict with the invention purpose and / or technical solution of this application, the cited documents involved in this application are cited in their entirety and for all purposes. When cited documents are involved in this application, the definitions of relevant technical features, terms, nouns, phrases, etc. in the cited documents are also cited. When cited documents are involved in this application, the examples and preferred embodiments of the cited relevant technical features may also be incorporated into this application as references, but are limited to the ability to implement this application. It should be understood that when the cited content conflicts with the description in this application, the present application shall prevail or be adaptively amended according to the description in this application.

[0051] The term "hCOL3A1 / Human COL3A1" refers to the human COL3A1 gene, which encodes the type III collagen alpha 1 chain in humans. Its full name is collagen type III alpha 1 chain. This gene is located on the long arm of chromosome 2 (2q32.2) with genomic coordinates of Chr2:188974373-189012746. The hCOL3A1 gene is approximately 38 kb long and contains 51 exons. The protein encoded by this gene is an important structural protein in the extracellular matrix, primarily found in elastic tissues such as the skin, lungs, uterus, intestines, and vascular system, where it typically coexists with type I collagen.

[0052] The term "gRNA" stands for guide RNA, a key component of the CRISPR-Cas9 system. In the CRISPR-Cas9 system, the gRNA consists of two parts: crRNA (CRISPR RNA) and tracrRNA (trans-activating crRNA). Together, the crRNA and tracrRNA form the gRNA. These two components, through a 20-nt guide RNA, bind to the DNA of the human EMX1 gene, guiding the Cas9 endonuclease to create a double-stranded break in the target DNA fragment. To simplify experimental design and improve gRNA stability, the crRNA and tracrRNA can be genetically engineered to form a single guide RNA (sgRNA). gRNA design is crucial to the success of the CRISPR-Cas9 system. To design a gRNA, the target gene sequence must be determined and then designed using online tools or customized based on the target gene's CDS sequence. The designed gRNA must be complementary to the target DNA sequence to specifically guide the Cas9 enzyme to a specific location in the genome. The 5' end of the gRNA contains an anchor region that complements the pre-mRNA editing sequence using a unique GU pairing pattern. This anchor sequence facilitates gRNA binding to the target DNA.

[0053] Previous literature reports indicate that the vast majority of homozygous type III collagen knockout mice die within a few days of birth. A very small number of homozygous mice exhibit severe brain abnormalities and developmental delays, as well as vascular Ehlers-Danlos syndrome (vEDS), and die from aortic or intestinal rupture at approximately six months of age. Heterozygous mice, however, survive normally. This application first humanized the mouse COL3A1 gene and constructed an in situ COL3A1 replacement mouse model, aiming to generate a mouse model that expresses the human COL3A1 gene but not the mouse COL3A1 gene. However, after in situ replacement of the mouse COL3A1 gene, stable mouse offspring were not obtained.

[0054] Based on this, the present application provides a gene-edited cell on one hand, the genome of the gene-edited cell comprising a site-specifically inserted human COL3A1 gene, and the human COL3A1 gene has a fragment as shown in SEQ ID NO.1.

[0055] In one specific example, the gene-edited cells contain a vector for the human COL3A1 gene.

[0056] Optionally, the gene-edited cells contain a gRNA targeting the mouse H11 locus as shown in SEQ ID NO. 2. H11 is located on mouse chromosome 11 and is a safe site for exogenous gene insertion. Exogenous genes integrated into this site can be stably and efficiently expressed without disrupting the function of endogenous genes.

[0057] gRNA: CTGAGCCAACAGTGGTAGTA (SEQ ID NO.2)

[0058] In a specific example, the gene-edited cells contain a vector for the human COL3A1 gene and a gene editing system of gRNA targeting the mouse H11 site.

[0059] Among them, gene-edited cells include mouse fertilized eggs and embryos.

[0060] On the other hand, the present application provides a gRNA targeting the H11 site of mice, and the gRNA targeting the H11 site of mice is shown in SEQ ID NO.2.

[0061] On the other hand, the present application provides a vector comprising a mouse COL3A1 promoter, a kozak sequence, a human COL3A1 gene, a WPRE sequence, and a PolyA sequence.

[0062] The murine COL3A1 promoter refers to the promoter region of the gene encoding type III collagen α1 chain (Col3a1) in mice (Mus musculus). The promoter is the portion of a gene located upstream of the transcription start site. It contains sequences recognized and bound by RNA polymerase, as well as binding sites for transcription factors, which can activate or repress gene transcription.

[0063] The Kozak sequence is a specific sequence flanking the start codon AUG in eukaryotic mRNA and plays a crucial role in translation initiation. It is generally considered to be ACCACCAUGG, where the first base G after AUG and the third base A or G before AUG are crucial for translation initiation. Furthermore, the 15 bases upstream of AUG typically do not contain a T. The Kozak sequence is not a ribosome binding site (RBS), but rather binds to translation initiation factors, mediating translation initiation of mRNAs containing a 5' cap structure. The Kozak sequence ensures accurate and efficient gene translation.

[0064] The WPRE sequence's mechanism of action includes improvements in RNA polyadenylation, nuclear export, and / or translation. It is a powerful tool for enhancing transgene expression. The WPRE sequence can also increase the expression of mRNA, siRNA, shRNA, and miRNA.

[0065] In a specific example, the vector is Col3a1-hCOL3A1-WPRE-PolyA.

[0066] On the other hand, the present application provides a humanized COL3A1 gene editing system, which includes: gRNA targeting the H11 site of mice, a vector, a Cas9 protein, and mRNA of the Cas9 protein.

[0067] The CRISPR / Cas9 system, comprised of the recognition component CRISPR and the cleavage component Cas, enables RNA-guided DNA recognition and editing. The CRISPR / Cas9 system uses a sequence-specific guide RNA (sgRNA) to guide the endonuclease to the target site, thereby completing genome editing. To knock out or infect different genes, sgRNAs must be designed that are specific to the gene or site to achieve precise gene editing.

[0068] On the other hand, the present application provides a method for constructing the gene-edited cells, wherein the H11 site in the target cells is gene-edited, and the human COL3A1 gene editing system is introduced into the target cells so that their genome contains the inserted human COL3A1 gene to prepare gene-edited cells, wherein the target cells include mouse fertilized eggs.

[0069] Another aspect of the present application provides a method for constructing an hCOL3A1 gene mouse model, comprising:

[0070] Using gene editing technology, the human COL3A1 gene was knocked into the H11 locus on chromosome 11 of C57BL / 6 mouse fertilized eggs to construct recombinant fertilized eggs. The sequence of the human COL3A1 gene is shown in SEQ ID NO. 1.

[0071] The recombinant fertilized eggs are introduced into surrogate mice for gestation, and positive mice are selected from the born mice to obtain F0 generation mice.

[0072] F0 mice are mated with C57BL / 6 mice, and positive heterozygous F1 mice are selected from the pups to serve as the humanized COL3A1 gene mouse model. It is understood that transplantation includes but is not limited to microinjection.

[0073] In a specific example, the gene editing technology includes one or more of BE3, CRISPR / Cas9, TALEN and ZFN.

[0074] In a specific example, constructing a recombinant zygote includes: cloning the DNA sequence of the gRNA as shown in SEQ ID NO. 2 into a vector to construct a recombinant plasmid;

[0075] Performing PCR amplification using the recombinant plasmid as a template to obtain a template, and transcribing the template to obtain gRNA;

[0076] The gRNA, Cas9 protein and / or Cas9 protein mRNA and a homologous recombination vector containing the humanized COL3A1 gene are co-injected into mouse fertilized eggs to construct recombinant fertilized eggs.

[0077] In a specific example, the screening step includes: performing PCR amplification on the genomic DNA of the newborn pups, detecting the obtained amplification products, and screening out the humanized COL3A1 gene mouse model based on the obtained detection results.

[0078] In a specific example, the sequences of the PCR primers are shown as SEQ ID NO.3 to SEQ ID NO.6.

[0079] On the other hand, the present application provides tissues or organs containing gene-edited cells or tissues or organs of humanized COL3A1 gene mouse models constructed by the method for constructing humanized COL3A1 gene mouse models.

[0080] On the other hand, the present application provides the gene-edited cells, the vectors, the humanized COL3A1 gene editing system, the hCOL3A1 gene mouse model constructed by the method for constructing the hCOL3A1 gene mouse model, and the use of the tissues or organs in the screening and safety evaluation of drugs, medical devices or cosmetics.

[0081] Comprehensive clinical drug evaluation encompasses multiple dimensions, including safety, efficacy, cost-effectiveness, innovation, and suitability. Safety evaluation primarily focuses on pre- and post-market safety information, including package inserts, adverse events and reactions, and drug quality and efficacy stability.

[0082] In a specific example, the medicine includes one or more of collagen drugs and anti-fibrosis drugs; the medical device or cosmetic includes one or more of collagen fillers, injections, and topical preparations.

[0083] This application uses gene editing to perform site-specific insertion of the human COL3A1 gene. Fertilized eggs with this mutation can develop into hCOL3A1 gene mouse models, providing a favorable model for studying the structure and biological effects of type III collagen, as well as tissue fibrosis, skin, heart diseases, and related drug and device screening and safety evaluation.

[0084] The embodiments of the present application will be described in detail below with reference to the examples. It should be understood that these examples are intended to illustrate the present application only and are not intended to limit the scope of the present application. The experimental methods for which specific conditions are not specified in the following examples are preferably referred to the guidance provided in the present application, and can also be based on the experimental manuals or conventional conditions in this area, or according to the conditions recommended by the manufacturer, or with reference to experimental methods known in the art.

[0085] In the following specific examples, the measured parameters of raw material components may have slight deviations within the range of weighing accuracy unless otherwise specified. For temperature and time parameters, acceptable deviations caused by instrument testing accuracy or operational accuracy are allowed.

[0086] It should be understood that in the various embodiments of the present application, the size of the serial numbers of the above-mentioned processes does not mean the order of execution. The execution order of each process should be determined by its function and internal logic, and should not constitute any limitation on the implementation process of the embodiments of the present application.

[0087] Example 1

[0088] This example provides a method for constructing a COL3A1 gene-modified humanized mouse model, which specifically includes the following steps:

[0089] 1. Specific construction design strategy diagram as follows Figure 1 shown.

[0090] Combine Figure 1 , Figure 1 The target fragment was inserted into the H11 locus of wild-type mice.

[0091] 2. Determine the sequence of human fragment insertion

[0092] In this example, the mCol3a1-hCOL3A1-WPRE-PolyA gene fragment was inserted into the H11 locus of mice. The length of the inserted fragment was about 8.2 kb. According to the structure and function of human COL3A1, the sequence information after recombinant was as follows: Figure 2 The inserted hCOL3A1 sequence is shown in SEQ ID NO.1.

[0093] 3. Using CRISPR Cas9, the mCol3a1-hCOL3A1-WPRE-PolyA gene fragment was site-specifically inserted into the mouse H11 locus. The CDS is 4401 nt long and encodes 1466 aa. H11, located on mouse chromosome 11, is a safe site for exogenous gene insertion. Exogenous genes integrated into this site are stably and efficiently expressed without disrupting the function of endogenous genes.

[0094] 4. Vector Construction

[0095] According to the design plan, gRNA was designed, constructed and in vitro transcribed, and a homologous recombination vector (Donor vector) was constructed. The correctness of the vector sequence was verified by sequencing. The gRNA sequence information is shown in Table 1: Table 1: gRNA information

[0096] 5. Microinjection

[0097] The CRISPR / Cas9 system and Donor vector sample were microinjected into fertilized eggs of mice with a C57BL / 6 background; the surviving fertilized eggs after injection were transplanted into pseudopregnant female mice and waited for them to become pregnant and give birth.

[0098] 6. Identification of F0 generation mice

[0099] The F0 generation mice born from the recipient mice were tail-clipped and toe-clipped at 5-7 days of age, and numbered. Genomic DNA was extracted and two pairs of primers were used to perform PCR on the tail genomic DNA of the F0 mice after they were targeted. The primers GJS022022076642-01-mCol3a1-5tR1 / H11-tF2 were located outside the 5' homology arm and within the donor's human fragment, respectively. If this pair of primers amplified a PCR product, it indicated that the target donor had been effectively inserted into the 5' end of the mouse genome; BGH-pA-tF1 / H11-tR2 were located within the donor's human fragment and outside the 3' homology arm, respectively. If this pair of primers amplified a PCR product, it indicated that the target donor had been effectively inserted into the 3' end of the mouse genome. The results were verified as follows:

[0100] Wild type: ①② No Target band was obtained in the PCR reaction; ③ A single WT band was obtained in the PCR reaction.

[0101] Heterozygote: ①②PCR reaction can obtain Target bands; ③PCR reaction can obtain a single WT band.

[0102] Homozygote: ①② PCR reaction can obtain the target band; ③ PCR reaction does not obtain a single WT band.

[0103] Specific identification strategies such as Figure 3 The identification methods are shown in Tables 2 to 5. The electrophoresis patterns of the 5' and 3' ends of COL3A1-KI-target F0 mice are shown in Figure 4 shown.

[0104] The identification results of COL3A1-KI-target F0 mice showed that the 5' and 3' ends of the human COL3A1 gene of mice No. 19, No. 21, No. 25, No. 43, No. 49, No. 51, No. 53, No. 55, No. 65, No. 77, and No. 80 were all positive, and sequencing showed no mutations, indicating that the obtained mice were positive mice with correct gene recombination.

[0105] Table 2

[0106] The specific PCR reaction system is shown in Table 3:

[0107] Table 3

[0108] The sequencing primer sequences are shown in Table 4:

[0109] Table 4

[0110] PCR reaction conditions are shown in Table 5:

[0111] Table 5

[0112] 7. Breeding of positive F0 generation mice

[0113] After the positive F0 generation mice reach sexual maturity, they are mated with wild-type background mice; the F1 generation mice born are tail-cut and toe-cut at 5-7 days old and numbered, and genomic DNA is extracted for PCR and sequencing identification to confirm the genotype.

[0114] 8. Identification results of F1 generation mice

[0115] The electrophoresis images of the 5' and 3' ends of COL3A1-KI-target F1 mice are shown in the figure. Figure 5 As shown. The identification results showed that both the 5' and 3' ends of the human COL3A1 gene in mice numbered 51 and 53 were positive, and sequencing revealed no mutations, indicating that the obtained mice had undergone correct genetic recombination. WT is C57BL / 6, a negative control; N is a negative blank control, a control without template; P is a positive control; the numbers represent the mouse tail number; and M represents the DNA marker: TRANS 2K PLUS II bands: 8000bp, 5000bp, 3000bp, 2000bp, 1000bp, 750bp, 500bp, 250bp, and 100bp.

[0116] Example 2: Testing and verification of the hCOL3A1 gene mouse model constructed in this application:

[0117] 1. Detection of the human COL3A1 gene in humanized COL3A1 mice

[0118] Heart, liver, spleen, lung, kidney, bladder, stomach, fat and skin tissues of WT mice and hCOL3A1 mice were collected and the expression of human COL3A1 gene was detected by real-time fluorescence quantitative PCR. Real-time fluorescence quantitative PCR was performed on WT mice and hCOL3A1 mice using Human COL3A1 primers. The results are as follows Figure 6 shown.

[0119] The results showed that the expression of hCOL3A1 gene was not detected in WT mice, but was detected in hCOL3A1 mice, indicating that humanized COL3A1 mice were successfully established.

[0120] 2. COL3A1 Humanized Mouse Test Article Testing

[0121] This application conducted efficacy tests on human hCOL3A1 mice and WT mice, subcutaneously injecting recombinant human collagen, human placental matrix protein and solvent. After 30 days, peripheral blood of the mice was collected for routine blood tests, flow cytometry was used to detect the proportion of immune cells in the mouse spleen, and the immune response of the mice to human collagen was analyzed.

[0122] Depend on Figure 7 As shown, two weeks after subcutaneous injection of recombinant human collagen, WT mice developed ulcers and scabs on the skin at the injection site on the back of the neck, while hCOL3A1 mice did not show obvious adverse reactions.

[0123] Routine blood data showed Figure 8As shown, compared with corresponding mice injected with vehicle, 30 days after subcutaneous injection of recombinant human collagen, WT mice showed a significant decrease in NEU% and a significant increase in LYM%, while WBC and MON% did not change significantly. In hCOL3A1 mice, there were no significant changes in peripheral blood WBC, NEU%, LYM%, or MON%. Thirty days after subcutaneous injection of human placental matrix protein, there were no significant changes in peripheral blood WBC, NEU, LYM, or MON% in either WT or hCOL3A1 mice.

[0124] Further flow cytometric analysis of spleen cells revealed that compared with the corresponding vehicle-injected mice, 30 days after subcutaneous injection of recombinant human collagen, the proportions of M1 macrophages, M2 macrophages, CD4+ T cells, and CD8+ T cells in the spleens of WT mice did not change significantly. However, the proportion of M1 macrophages in hCOL3A1 mice increased significantly, while the proportions of M2 macrophages, CD4+ T cells, and CD8+ T cells did not change significantly. 30 days after subcutaneous injection of human placental matrix protein, the proportion of M1 macrophages in the spleens of WT mice decreased significantly, while the proportions of M2 macrophages, CD4+ T cells, and CD8+ T cells did not change significantly. However, the proportion of M2 macrophages in the spleens of hCOL3A1 mice decreased significantly, while the proportions of M1 macrophages, CD4+ T cells, and CD8+ T cells did not change significantly.

[0125] The above data show that the immune responses of hCOL3A1 mice and WT mice to human collagen are not consistent, and there are also differences in the immune responses to human collagen from different sources.

[0126] In summary, the hCOL3A1 mice provided in this application can express the human COL3A1 gene, which can more scientifically evaluate the safety of such products.

[0127] The embodiments described above only express several implementation methods of the present application, which are convenient for understanding the technical solutions of the present application in a specific and detailed manner, but they cannot be understood as limiting the scope of protection of the patent application. It should be pointed out that for ordinary technicians in this field, without departing from the concept of the present application, several variations and improvements can be made, which all fall within the scope of protection of the present application. In addition, it should be understood that after reading the above-mentioned teaching content of the present application, those skilled in the art can make various changes or modifications to the present application, and the equivalent forms obtained also fall within the scope of protection of the present application. It should also be understood that the technical solutions obtained by those skilled in the art through logical analysis, reasoning or limited experiments on the basis of the technical solutions provided in the present application are all within the scope of protection of the claims attached to the present application. Therefore, the scope of protection of the patent application of this application shall be based on the content of the attached claims, and the description can be used to interpret the content of the claims.

Claims

1. A method for constructing a humanized COL3A1 gene mouse model, characterized in that: include: The human COL3A1 gene was knocked into the H11 site of chromosome 11 of the mouse fertilized egg using gene editing technology to construct a recombinant fertilized egg; the sequence of the human COL3A1 gene is shown in SEQ ID NO.1; The recombinant fertilized eggs are introduced into surrogate mice for gestation, and positive mice are selected from the born mice to obtain F0 generation mice; The F0 generation mice were mated with wild-type mice, and positive heterozygous F1 generation mice were screened out from the newborn mice as humanized COL3A1 gene mouse models.

2. The method for constructing a humanized COL3A1 gene mouse model according to claim 1, characterized in that: Gene editing technologies include one or more of BE3, CRISPR / Cas9, TALEN and ZFN.

3. The method for constructing a humanized COL3A1 gene mouse model according to claim 1, characterized in that: The construction of recombinant zygotes includes: The DNA sequence of the gRNA shown in SEQ ID NO.2 was cloned into the vector to construct a recombinant plasmid; Performing PCR amplification using the recombinant plasmid as a template to obtain a template, and transcribing the template to obtain gRNA; The gRNA, Cas9 protein and / or mRNA of Cas9 protein and a homologous recombination vector containing the human COL3A1 gene are co-injected into mouse fertilized eggs to construct recombinant fertilized eggs.

4. The method for constructing a humanized COL3A1 gene mouse model according to claim 3, characterized in that: The homologous recombination vector of the human COL3A1 gene is Col3a1-hCOL3A1-WPRE-PolyA.

5. The method for constructing a humanized COL3A1 gene mouse model according to any one of claims 1 to 4, characterized in that: The screening step includes: performing PCR amplification on the genomic DNA of the newborn mice, detecting the obtained amplification products and screening out the humanized COL3A1 gene mouse model according to the obtained detection results; The sequences of the primers for PCR amplification are shown in SEQ ID NO.3 to SEQ ID NO.

8. 6 . The tissue or organ of the humanized COL3A1 gene mouse model constructed by the method for constructing a humanized COL3A1 gene mouse model according to any one of claims 1 to 5 .

7. The method for constructing a humanized COL3A1 gene mouse model according to any one of claims 1 to 5, and use of the constructed humanized COL3A1 gene mouse model in the screening and safety evaluation of drugs, medical devices or cosmetics.

8. The use according to claim 7, characterized in that: The medicines include one or more of collagen drugs and anti-fibrosis drugs; the medical devices or cosmetics include one or more of collagen fillers, injections and smear preparations.

9. A gRNA targeting the H11 site of mice, characterized in that The gRNA targeting the H11 site of mice is shown as SEQ ID NO.

2.

10. A humanized COL3A1 gene editing system, characterized in that: The humanized COL3A1 gene editing system comprises: the gRNA targeting the H11 site of mice according to claim 9, a homologous recombination vector, and a Cas9 protein and / or mRNA of the Cas9 protein; The homologous recombination vector is Col3a1-hCOL3A1-WPRE-PolyA.

Images