Application of OspPLAⅤ gene in regulating rice tolerance to waterlogging stress
By knocking out the OspPLAⅤ gene using CRISPR/Cas9 technology, the root system of rice seedlings was developed and the seedlings grew longer, which solved the problems of slow germination and low seedling rate of rice seeds under flooded conditions, and achieved the improvement of direct seeding technology for rice.
Patent Information
- Application Number
- CN202411656671.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-19
- Publication Date
- 2026-03-24
- Estimated Expiration
- 2044-11-19
AI Technical Summary
Existing technologies are insufficient to effectively address the problems of slow germination, inhibited radicle development, and low seedling survival rate of rice seeds under flooded conditions, thus limiting the promotion and application of direct seeding technology for rice.
By knocking out the OspPLAⅤ gene using CRISPR/Cas9 technology, OspPLAⅤ gene knockout lines were constructed, promoting well-developed root systems, rapid aboveground growth, fast emergence of the first leaf, and high seedling survival rate in rice seedlings.
Under flooded conditions, the OspPLAⅤ gene knockout line exhibited a phenotype characterized by well-developed seedling roots, rapid seedling growth, fast emergence of the first leaf, and high seedling establishment rate. This solved the problems of slow growth and low seedling establishment rate in direct seeding of rice and provided genetic resources for breeding new rice varieties.
Smart Images

Figure CN119372239B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering technology, specifically relating to the application of the OspPLAⅤ gene in regulating rice waterlogging stress tolerance. Background Technology
[0002] Rice is one of my country's main food crops, and more than half of the world's population relies on it for sustenance. Its yield directly impacts basic livelihoods. With rapid economic development and urbanization, direct seeding technology for rice, which reduces labor, lowers costs, and facilitates mechanized operation, is gaining increasing attention. A key challenge for promoting this technology is seed germination under flooded conditions. Therefore, developing and applying flood-tolerant genes is crucial for developing flood-resistant rice varieties. Summary of the Invention
[0003] To overcome the aforementioned defects and deficiencies of the prior art, this invention provides the application of the OspPLAⅤ gene in regulating root growth, aboveground seedling length, first leaf growth rate, and seedling establishment rate in rice under flooded conditions. Specifically, by knocking out the OspPLAⅤ gene, OspPLAⅤ gene knockout lines are constructed. Seedlings from OspPLAⅤ gene knockout plants exhibit phenotypes of well-developed root systems, faster aboveground seedling length, faster first leaf emergence, and higher seedling establishment rate.
[0004] The first objective of this invention is to provide the application of the OspPLAⅤ gene in regulating rice waterlogging stress tolerance, wherein the OspPLAⅤ gene is a gene encoding a protein with the amino acid sequence shown in SEQ ID NO.2.
[0005] Preferably, the application is based on the nucleotide sequence of the OspPLAⅤ gene as shown in SEQ ID NO.1.
[0006] Preferably, the application is the use of knocking out the OspPLAⅤ gene to promote root growth in rice seedlings under flooded conditions.
[0007] Preferably, the application is the use of knocking out the OspPLAⅤ gene to promote the aboveground growth of rice seedlings under flooded conditions.
[0008] Preferably, the application is the use of knocking out the OspPLAⅤ gene to accelerate the emergence of the first leaf in rice seedlings under flooded conditions.
[0009] Preferably, the application is the use of knocking out the OspPLAⅤ gene to improve the rice seedling rate under flooded conditions.
[0010] Preferably, the OspPLAⅤ gene knockout is performed using CRISPR / Cas9 technology, and the nucleotide sequence of its specific target site is shown in SEQ ID NO.3 or SEQ ID NO.4.
[0011] The second objective of this invention is to provide a method for obtaining improved rice seedlings with well-developed root systems, rapid aboveground growth, rapid emergence of the first leaf, and high seedling establishment rate under flooded conditions, comprising the step of knocking out the OspPLAⅤ gene; wherein the OspPLAⅤ gene is a gene encoding a protein with an amino acid sequence as shown in SEQ ID NO.2.
[0012] Preferably, its nucleotide sequence is shown in SEQ ID NO.1.
[0013] Preferably, the OspPLAⅤ gene knockout is performed using CRISPR / Cas9 technology, and the nucleotide sequence of its specific target site is shown in SEQ ID NO.3 or SEQ ID NO.4.
[0014] Compared with the prior art, the present invention has the following beneficial effects:
[0015] The OspPLAⅤ gene and its encoded protein of this invention can be used to regulate root development, aboveground seedling growth, first leaf development, and seedling survival rate in rice seed germination under flooded conditions. OspPLAⅤ gene knockout lines exhibit a phenotype of well-developed seedling roots, faster aboveground seedling growth, faster first leaf emergence, and higher seedling survival rate under flooded conditions. Therefore, this invention can provide gene resources for solving problems such as slow seedling growth, inhibited radicle development, and low seedling survival rate in direct-seeded rice, as well as for breeding new rice varieties. This invention is of great significance for solving problems such as slow seedling growth, inhibited radicle development, and low seedling survival rate in direct-seeded rice and has broad application prospects in plant breeding. Attached Figure Description
[0016] Figure 1 This is a mutation type and sequencing peak diagram of OspPLAⅤ gene knockout plants.
[0017] Figure 2 This is the result of WT, ospplav-4, and ospplav-7 germinating for 4 days under 2cm deep water conditions.
[0018] Figure 3 This is the result of WT, ospplav-4, and ospplav-7 germinating for 6 days under 2cm deep water conditions.
[0019] Figure 4This is a statistical chart showing the aboveground seedling length and root length of WT, ospplav-4, and ospplav-7 after 6 days of germination under 2cm deep water conditions.
[0020] Figure 5 These are actual images of WT, ospplav-7, and ospplav-4 rice seeds after 10 days of germination under 7cm deep water conditions. Among them, A shows the state of representative WT, ospplav-7, and ospplav-4 rice seeds after 10 days of germination under 7cm deep water conditions, and B shows the overall state of WT, ospplav-7, and ospplav-4 rice seeds after 10 days of germination under 7cm deep water conditions.
[0021] Figure 6 These are actual images of WT, ospplav-4, and ospplav-7 rice seeds after 10 days of germination under flooded conditions. * indicates a significant difference in seedling emergence rate between the gene knockout lines and WT at the p<0.05 level, and *** indicates a significant difference in seedling emergence rate between the gene knockout lines and WT at the p<0.001 level. Detailed Implementation
[0022] The following embodiments are further illustrations of the present invention, but not limitations thereof.
[0023] OspPLAⅤ belongs to the phospholipase A family and is homologous to human PNPLA3 protein. Although OspPLAⅤ belongs to the phospholipase A family, it has low homology with PLA1, PLA2, and the pPLA subfamily, but high homology with Arabidopsis thaliana ATGL protein. Its function remains unclear and has not been reported in the literature. This invention obtained homozygous OspPLAⅤ gene knockout lines through gene knockout. Compared to the wild type, seeds from the OspPLAⅤ gene knockout lines germinated under waterlogged conditions, exhibiting phenotypes such as well-developed root systems, faster aboveground seedling growth, faster first leaf emergence, and higher seedling survival rate.
[0024] Example 1: Construction of OspPLAⅤ gene knockout vector and obtaining rice gene knockout plants
[0025] 1. Construction of OspPLAⅤ gene knockout vector
[0026] Gene knockout plants were obtained by editing the OspPLAⅤ gene in wild-type rice (Zhonghua 11) using the CRISPR / Cas9 genome editing system. The specific method is as follows.
[0027] The exon sequences of the target gene OspPLAⅤ (whose CDS sequence is shown in SEQ ID NO.1, 1158 bp in length, encoding a protein with an amino acid sequence of 385 amino acids as shown in SEQ ID NO.2) were analyzed using the CRISPR P v2.0 website (http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR / CRISPR). Two specific target sequences were selected: target 1: GCGTGCACACGTGTCGTCGTCGG (SEQ ID NO.3) and target 2: TGCGCGACGCCGATGTGGTAGGG (SEQ ID NO.4). Two expression cassettes, U6a-target 1-sgRNA and U3-target 2-sgRNA, linked to sgRNAs, were obtained by overlap PCR. Taking advantage of the non-overlapping cleavage and recognition sites of the BsaI enzyme, these two expression cassettes were ligated into the pYLCRISPR / Cas9Pubi-H vector to generate the pCRISPR-OspPLAⅤ vector containing the OspPLAⅤ specific target, which was then transformed into Agrobacterium EHA105 competent cells. After extracting plasmids from positive clones, they were sent to a company for sequencing. PCRISPR-OspPLAⅤ plasmids with correct results were selected, and tissues successfully knocked out the OspPLAⅤ gene were screened by infecting rice callus tissue with Agrobacterium, resulting in the regeneration of gene knockout plants.
[0028] 2. Identification of OspPLAⅤ gene knockout homozygous plants
[0029] Total genomic DNA was extracted from single T0 generation transgenic plants and used as a template. Primers located flanking the specific target sites of the OspPLAⅤ gene were used to amplify nucleotide sequences containing target sites 1 and 2, respectively. Specifically, T1-F / T1-R (T1-F: CCACGCACCTAAACGAATTAAC, SEQ ID NO. 5; T1-R: CGAGCATGAAGCGACGGAAG, SEQ ID NO. 6) were used for PCR amplification of nucleotide sequences containing target site 1; T2-F / T2-R (T2-F: GGGGTGGTGTGGGAGCAG, SEQ ID NO. 7; T2-R: GTTCGCGTAGAAGAGGTAAGAG, SEQ ID NO. 8) were used for PCR amplification of nucleotide sequences containing target site 2. The amplified products with single and clear target bands were recovered and sent to the company for sequencing. After sequencing, the sequencing results were decoded and analyzed using the DSDecodeM website (http: / / skl.scau.edu.cn / dsdecode / ). Two homozygous OspPLAⅤ gene knockout lines, ospplav-7 and ospplav-4, with independent editing sites, were selected for subsequent experiments. The sequencing results of the knockout lines are as follows: Figure 1 As shown.
[0030] Example 2: Germination analysis of OspPLAⅤ gene knockout rice seeds in water at a depth of 2 cm
[0031] Seeds from wild-type rice plants WT, OspPLAⅤ gene knockout lines ospplav-7 and ospplav-4 were placed in transparent square germination boxes, with 200 mL of distilled water added to a depth of 2 cm. The boxes were then incubated in a 28℃ incubator with 12h light / 12h dark cycles. Three biological replicates were set up, with 30 rice seeds per replicate, to observe seed germination under waterlogging treatment. Under waterlogging conditions, after 4 days of germination, the root length of ospplav-4 and ospplav-7 was comparable to the seed length, while the radicle of the wild-type plant was only just beginning to emerge. Figure 2 Six days after germination under flooded conditions, the first leaves of ospplav-4 and ospplav-7 had emerged, with average above-ground seedling lengths of 8.8 cm and 7.7 cm, respectively. Root length continued to elongate, averaging 6.6 cm and 4.9 cm, respectively. The first leaf of the wild type had not yet emerged, and the root length was only comparable to the seed length, averaging 0.8 cm. Figure 3 ). Statistical data on root length and aboveground seedling length of ospplav-4, ospplav-7, and wild-type WT 6 days after germination under flooded conditions are as follows: Figure 4 As shown.
[0032] Example 3: Germination analysis of OspPLAⅤ gene knockout rice seeds in water at a depth of 7cm
[0033] Seeds from wild-type rice plants WT, and the OspPLAⅤ gene knockout lines ospplav-7 and ospplav-4 were placed in transparent culture bottles, with 280 mL of distilled water added to a depth of 7 cm. The bottles were incubated at 28°C with a light / dark cycle of 12 h / 12 h, and the distilled water was changed every two days. Each culture bottle contained 20 rice seeds, and the experiment was repeated three times. Seed germination and growth were observed after 10 days of deep water submersion. The seedling survival rate was calculated using the formula: Seedling survival rate = Number of seeds that germinated and successfully formed seedlings / Total number of seeds. The results showed that after 10 days of germination under 7 cm deep water submersion, the seedling survival rates of ospplav-7 and ospplav-4 were 92% and 93%, respectively, while the wild-type was only 48%. Knocking out the OspPLAⅤ gene significantly improved the seedling survival rate after submersion. Figure 6 Furthermore, the leaf and root development of ospplav-7 and ospplav-4 were superior to that of the wild-type strain WT, while WT mostly consisted of deformed seedlings with abnormal root development. Figure 5 ).
Claims
1. Knockout OspPLAⅤ The application of genes in improving rice's tolerance to waterlogging stress is characterized by, The aforementioned OspPLA Ⅴ The gene is a gene that encodes a protein with an amino acid sequence as shown in SEQ ID NO.
2.
2. The application according to claim 1, characterized in that, The aforementioned OspPLAⅤ The nucleotide sequence of the gene is shown in SEQ ID NO.
1.
3. The application according to claim 1, characterized in that, To knock out OspPLAⅤ Application of genes in promoting root growth of rice seedlings under flooded conditions.
4. The application according to claim 1, characterized in that, To knock out OspPLAⅤ Application of genes in promoting aboveground growth of rice seedlings under flooded conditions.
5. The application according to claim 1, characterized in that, To knock out OspPLAⅤ Application of genes to accelerate the growth of the first leaf in rice seedlings under flooded conditions.
6. The application according to claim 1, characterized in that, To knock out OspPLAⅤ Application of genes in improving rice seedling survival rate under flooded conditions.
7. The application according to claim 3, characterized in that, The aforementioned knockout OspPLAⅤ Genes are knocked out using CRISPR / Cas9 technology. OspPLAⅤ The gene, whose specific target nucleotide sequence is shown in SEQ ID NO.3 or SEQ ID NO.
4.
8. A method for obtaining improved rice seedlings with well-developed root systems, rapid above-ground growth, fast emergence of the first leaf, and high seedling survival rate under flooded conditions, characterized in that, Includes knockout OspPLAⅤ The steps of gene generation; the described OspPLAⅤ The gene is a gene that encodes a protein with an amino acid sequence as shown in SEQ ID NO.
2.
9. The method according to claim 8, characterized in that, Its nucleotide sequence is shown in SEQ ID NO.
1.
10. The method according to claim 8, characterized in that, The aforementioned knockout OspPLAⅤ The gene was knocked out using CRISPR / Cas9 technology. OspPLAⅤ The gene, whose specific target nucleotide sequence is shown in SEQ ID NO.3 or SEQ ID NO.4.
Citation Information
Patent Citations
Application of OsOPR13 gene in regulation and control of rice seed germination
CN116656700A
Application of rice OsMAPK7 gene in improving water logging resistance of rice
CN117625677A