SNP (Single Nucleotide Polymorphism) marker of Rh blood group system and application of SNP marker in detecting RhD variation phenotype

Abstract

The invention provides an SNP (Single Nucleotide Polymorphism) marker of an Rh blood group system and application of the SNP marker in detecting RhD variation phenotypes. RhD variation blood groups of red blood cells can be confirmed by detecting an SNP site. The SNP marker is located at the 121st basic group of a nucleotide fragment of SEQ ID NO: 1, that is, the 922nd basic group from an initiation codon in an RHD gene coding region is mutated, and G is mutated into C. The SNP marker of an Rh blood group system is obtained through detection and screening, and whether an individual to be detected has an RhD variation phenotype or not is determined by detecting whether the SNP marker exists or not. The application effect shows that the SNP locus and the detection primer provided by the invention can be effectively used for rapid detection of the RHD gene of clinical patients and blood station blood donors.

Description

Technical Field

[0001] The invention belongs to the technical field of gene molecular diagnosis, and in particular relates to a SNP marker of an Rh blood group system and an application thereof in detecting an RhD variant phenotype. Background Art

[0002] The Rh blood group system (Rhesus monkeys) was first discovered by the famous scientist and Nobel Prize winner Karl Landsteiner from the red blood cells of rhesus monkeys, hence the name. The Rh blood group system is the most complex blood group system among the 47 blood group systems in humans. Its importance is second only to the ABO system, and it plays an important role in the diagnosis and treatment of clinical blood transfusion and neonatal hemolytic disease. The D antigen in the Rh blood group system is the most immunogenic and polymorphic antigen. For the Han Chinese in China, the RhD negative population accounts for only about 0.3% of the population. Because it is very rare, it is also called panda blood. Due to the strong antigenicity of RhD, RhD negative people cannot accept RhD positive blood, because the RhD antigen will stimulate the RhD negative human body to produce anti-RhD antibodies. If RhD positive blood is transfused again, it can lead to hemolytic transfusion reaction. Similarly, if RhD negative women produce anti-RhD antibodies in their bodies due to pregnancy or blood transfusion stimulation, another pregnancy will lead to the occurrence of neonatal hemolytic disease.

[0003] In addition to the normal RhD positive and negative, the RhD blood type system also has many variants, including weak D, partial D and DEL (radiated type). These variant red blood cells have incomplete or mutated RhD antigens on their surface. If transfused to negative individuals, they may also stimulate the production of anti-RhD antibodies. Therefore, these variant individuals have two main characteristics: First, they are treated differently as blood recipients and blood donors. As blood recipients, they can only receive RhD negative blood; and as blood donors, their blood can only be used as RhD positive blood. Second, it is easy to miss detection. Due to the variation of RhD antigens, anti-D antibody reagents cannot react with mutated D antigens during routine serological testing, so it is easy to misjudge as RhD negative. Since there are currently no particularly effective measures to remove irregular antibodies, this is very harmful to patients who need multiple blood transfusions and pregnant women. Therefore, accurate typing is the prerequisite for ensuring correct transfusion.

[0004] Currently, the conventional method for detecting blood type is serological experiment, but this experiment is subject to many limitations, such as sample quality, interference from autoantibodies or irregular antibodies, the impact of disease, etc. At the same time, it is even more difficult to judge the DEL type, which can only be detected by absorption and emission test. This requires the use of molecular biology methods to diagnose at the genetic level. Summary of the invention

[0005] The purpose of the present invention is to provide a SNP marker of the Rh blood group system and its application in detecting the RhD variant phenotype. By detecting the SNP site, the RhD variant blood type of red blood cells can be confirmed, thereby making up for the shortcomings of the prior art.

[0006] The present invention first provides a SNP marker that can cause RhD variant blood type. The SNP marker is located at the 922nd position from the start codon in the RHD gene coding region, that is, the 300th position of the nucleic acid fragment with the sequence of SEQ ID NO: 1, and its base mutates from G to C.

[0007] CCCATCATGTCCACTGATGAAGGACACGTAGCCCCAACAGGGGAGAAGTGGTTTCAGGATCAGCAAAGCAGGGAGGATGTTACAGGGTTTGCCTTGTTCCCAGCGTGCTGGTCACTTGCAGCAAGATGGTGTTCTCTCCTACCTTGCTTCCTTTACCCACACGCTATTTCTTTTGCAGACTTATGTGCACAGTGCGGTGTTGGCAGGAGGCGTGGCT

[0008] GTGGGTACCTCGTGTCACCTGATCCCTTTCTCCGTGGCTTGCCAT

[0009] GGTGCTGGGTCTTGTGGCTGGGCTGATCTCCGTCGGGGGAGCC

[0010] AAGTACCTGCCGGTAAGAAACTAGACAACTAACCTCCTCTGCTTTGGCT (SEQ ID NO: 1).

[0011] Another aspect of the present invention provides an application of the reagent for detecting the above-mentioned SNP marker in the preparation of a product for detecting the RhD variant blood type of red blood cells;

[0012] The reagent is a PCR amplification sequencing primer pair;

[0013] As a specific record of the embodiment, the specific sequence information of the primer pair is as follows:

[0014] RHD-6F:5′-CCCATCATGTCCACTGATGAA-3′(SEQ ID NO:2)

[0015] RHD-6R: 5'-AGCCAAAGCAGAGGAGGTTAGTT-3' (SEQ ID NO: 3).

[0016] In another aspect, the present invention also provides a kit for detecting RhD variant phenotypes, which comprises the PCR amplification sequencing primer pair for detecting the above-mentioned SNP markers;

[0017] In another aspect, the present invention provides a method for detecting RhD variant phenotypes, wherein the method comprises performing PCR amplification on the blood sample DNA to be detected using primers that can amplify the above-mentioned SNP markers, sequencing the amplified products and then performing genotype analysis to determine whether the sample to be detected contains the above-mentioned SNP markers.

[0018] The present invention obtains a SNP marker of the Rh blood group system through detection and screening, and determines whether the individual to be detected has a RhD variant phenotype by detecting the presence or absence of the SNP marker. The application effect shows that the SNP site and detection primer provided by the present invention can be effectively used for rapid detection of RHD genes in clinical patients and blood donors in blood stations. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 : RHD reference sequence RHD*01, the reference sequence comes from BGMUT (International Blood Group Gene Mutation Database);

[0020] Figure 2 : Direct sequencing map of the proband. The proband had RhD variant phenotype. The RHD gene coding region had a mutation at the 922nd base from the start codon, from G to C. DETAILED DESCRIPTION

[0021] The applicant performed RHD gene sequencing on 191 individuals who tested RhD negative or variant by serological testing and discovered a new SNP site that would lead to RhD variant.

[0022] The RH gene is located in the chromosome 1p34.3-1p36.1 region and can be transcribed into 2837bp mRNA (NCBI accession number is NM_016124.4), which is finally translated into a protein composed of 417 amino acids. The RH gene is composed of the RHD gene (encoding the RhD antigen) and the RHCE gene (encoding the RHC, c, E and e antigens) arranged in close series. The RHD gene and the RHCE gene are highly homologous in structure, both consisting of 10 exons and 9 introns, of which the 8th exon of the two is exactly the same, and the major differences are exons 3, 4, 5, 7, 9 and intron 4. Therefore, the RHD gene detection system is established by molecular biology means and applied in clinical and blood collection and supply work, which is helpful for the accurate detection of RhD negative individuals, helps to reduce the production of irregular antibodies in blood recipients, helps to prevent and monitor irregular antibodies before delivery, and helps to reduce the occurrence of neonatal hemolytic disease.

[0023] The present invention is described in detail below in conjunction with embodiments and drawings.

[0024] Example 1: Screening of SNP markers

[0025] 1. Extraction of peripheral blood genomic DNA:

[0026] In accordance with relevant national policies and regulations and based on the consent of the sampling subjects, 2-5 mL of peripheral venous blood was drawn from RhD negative or variant clinical patients or blood donors, placed in EDTA anticoagulant tubes, and frozen at -80°C for later use; after the frozen EDTA anticoagulant blood was thawed at room temperature, 500 μL was taken out and placed in a centrifuge tube, an equal volume of TE (pH 8.0) was added, mixed, centrifuged at 4°C, 10,000 rpm for 10 minutes, and the supernatant was discarded.

[0027] Add 180 μL TE, 20 μL SDS (10%), 8 μL proteinase K (10 mg / ml), mix well, and place in a 37°C water bath overnight. Remove the sample from the water bath and centrifuge to precipitate the sample. Add an equal volume of Tris-saturated phenol (about 300 μL) to the reaction tube, mix well, centrifuge at 10,000 rpm for 10 minutes at room temperature, and aspirate the supernatant (about 300 μL) into a new centrifuge tube. Repeat the phenol extraction once and aspirate the supernatant into a new centrifuge tube.

[0028] Add an equal volume of Tris-saturated phenol:chloroform mixture (150 μL each of phenol and chloroform), mix well, centrifuge at 10,000 rpm for 10 minutes at room temperature, and transfer the supernatant to a new centrifuge tube.

[0029] Add an equal volume of Tris-saturated phenol:chloroform:isoamyl alcohol mixture (100 μL each of phenol, chloroform, and isoamyl alcohol), mix well, centrifuge at 10,000 rpm for 10 minutes at room temperature, and transfer the supernatant to a new centrifuge tube.

[0030] Add 1 / 10 volume of 3 mol / L, pH 5.2 sodium acetate (about 30 μL) and 2 volumes of pre-cooled 100% ethanol, mix gently, and white flocculent precipitate will be visible. Centrifuge at 10000 rpm for 10 minutes at room temperature to precipitate the DNA at the bottom of the tube, and discard the supernatant.

[0031] Add 70% ethanol to the DNA precipitate, rinse once, centrifuge at 7000 rpm for 5 minutes at room temperature, discard the supernatant, let it stand at room temperature to evaporate the remaining ethanol, and finally add 50 μL TE (pH 8.0) and dissolve the DNA at 4°C overnight.

[0032] The extracted DNA was subjected to agarose gel electrophoresis, and the purity and concentration of the DNA were detected by ultraviolet spectrophotometer at 260nm and 280nm.

[0033] 2. Direct sequencing to find mutations in the RHD gene

[0034] PCR amplification of target fragments: reaction conditions and reaction system:

[0035] (1) PCR reaction conditions: 95°C for 5 m; 95°C for 30 s, 58°C for 30 s, 72°C for 60 s, 35 cycles; 72°C for 5 m.

[0036] (2) Reaction system: (Onelambda Fast start Taq polymerase)

[0037]

[0038] The reaction system is used to perform amplification reaction between the genomic DNA template of each RhD negative or D variant sample and the RhD primer.

[0039] PCR product sequencing: The PCR product was sequenced using the conventional Sanger sequencing method, with the sequencing primer: RHD-6F: 5'-CCCATCATGTCCACTGATGAA-3' (SEQ ID NO: 1). A mutation was found in the sixth exon of the RHD gene of the RhD variant blood donor, where the 922nd base G was mutated to C. Figure 1 ), which caused nt922-924 to mutate from GGA to CGA, and the amino acid codon changed from glycine (Gly) to arginine (Arg), causing the RhD protein conformation to change, and serology showed the RhD variant phenotype. Multiple sequencing results showed that this mutation site was not introduced due to amplification or sequencing errors. Through the search of the database, it was determined that the mutation had not been reported. The mutation caused the RhD protein conformation to change, resulting in the RhD variant.

[0040] However, the mutation screening of this site in the peripheral blood genomic DNA samples of 200 RhD-positive samples did not find this mutation; however, by testing the SNP site in the proband's family members, it was determined that the above-mentioned SNP site also existed in individuals with the RhD variant phenotype.

[0041] The above experimental results show that the SNP mutation site can accurately determine the RhD blood type of the subject, which is of great significance for formulating blood transfusion policies for patients.

Claims

1. A SNP marker that causes RhD variant blood type, characterized in that: The SNP marker is located at the 300th position of the nucleic acid fragment with the sequence of SEQ ID NO: 1, and its base mutates from G to C.

2. Use of the reagent for detecting the SNP marker according to claim 1 in the preparation of a product for detecting the RhD variant blood type of red blood cells.

3. The use according to claim 2, characterized in that The product is a PCR amplification sequencing kit.

4. The use according to claim 3, characterized in that The reagent is a PCR amplification sequencing primer pair.

5. The use according to claim 4, characterized in that The sequences of the primer pair are SEQ ID NO:2 and SEQ ID NO:

3.

6. A kit for detecting RhD variant phenotype, characterized in that: The kit comprises the PCR amplification sequencing primer pair for detecting the SNP marker according to claim 1.

7. The kit according to claim 6, characterized in that The sequences of the PCR amplification sequencing primer pair are SEQ ID NO: 2 and SEQ ID NO:

3.

8. A method for detecting RhD variant phenotype, characterized in that: The method is to perform PCR amplification on the blood sample DNA to be tested using primers that can amplify the SNP marker described in claim 1, and then perform genotype analysis after sequencing the amplified product to determine whether the SNP marker described in claim 1 exists in the sample to be tested.

Images