A method for assessing corrected milk yield in Chinese Holstein dairy cows

By detecting the genotype of the rs109669792 locus and performing PCR amplification, the problem of difficulty in evaluating and selecting Chinese Holstein dairy cows with high corrected milk yield in existing technologies has been solved, achieving effective molecular breeding and milk yield improvement.

CN119391866BActive Publication Date: 2026-03-10GUANGDONG OCEAN UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411531636.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-10-30
Publication Date
2026-03-10
Estimated Expiration
2044-10-30

AI Technical Summary

Technical Problem

Existing technologies are insufficient for effectively evaluating and breeding Chinese Holstein dairy cows with high corrected milk yields, and there is a lack of relevant molecular breeding methods and techniques.

Method used

By detecting the genotype at the rs109669792 locus and performing PCR amplification using specific primers, it was found that the corrected milk yield of individuals with the GG genotype was significantly higher than that of individuals with the GA genotype. Combined with molecular breeding techniques, high-corrected milk yield Chinese Holstein dairy cows were selected.

Benefits of technology

This study enabled the effective assessment and molecular breeding of corrected milk yield in Chinese Holstein dairy cows, thereby increasing the corrected milk yield and meeting market demand.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119391866B_ABST
    Figure CN119391866B_ABST
Patent Text Reader

Abstract

This invention discloses a method for evaluating corrected milk yield in Chinese Holstein dairy cows. The method involves detecting the genotype rs109669792, revealing that individuals with the GG genotype have a significantly higher corrected milk yield than those with the GA genotype. This invention identifies a SNP—rs109669792—significantly correlated with corrected milk yield in Chinese Holstein dairy cows, with individuals with the GG genotype showing a significantly higher corrected milk yield than those with the GA genotype. Furthermore, primers for detecting the genotype of this SNP locus are provided. Using these primers to detect the genotype of this SNP locus can assess the corrected milk yield in Chinese Holstein dairy cows, and this method has promising applications in molecular breeding for milk quality traits in Chinese Holstein dairy cows.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of breeding technology for Chinese Holstein dairy cows, and more specifically, to a method for assessing corrected milk yield in Chinese Holstein dairy cows. Background Technology

[0002] The Chinese Holstein dairy cow, an outstanding result of crossbreeding European Holstein cattle with Chinese Yellow cattle, has become a unique dairy breed in my country. It is not only characterized by high milk production, large numbers, and wide distribution, but also by its dual-purpose nature (milk and meat). Furthermore, this breed is large in stature, docile in temperament, and easy to manage. With the improvement of the national economic level and the enhancement of people's health awareness, milk consumption is gradually increasing. Therefore, it is necessary to continuously select superior dairy cow breeds and improve the quality of dairy products to meet market demands.

[0003] Kinesin family binding protein (KIFBP) has 621 amino acids, including two tetrapeptide repeat sequences, and is expressed in the central nervous system and enteric nervous system. It binds to eight kinesins in cells, including members of the kinesin-2 (KIF3A), kinesin-3 (KIF1A, KIF1B, KIF1C, KIF13B, and KIF14), kinesin-8 (KIF18A), and kinesin-12 (KIF15) families, thereby inhibiting motor-microtubule binding in vitro and in cells. Kinesin-binding proteins interact with multiple kinesins, regulating protein activity through binding and blocking the interaction between kinesins and the microtubule backbone; it also participates in axonal structure and growth, microtubule dynamics and cargo transport, and functions by binding to various microtubule-associated proteins. Studies have shown that knockout mice… KIFBP Genetic defects in the central and peripheral nervous systems, as well as developmental delays in the enteric nervous system; knockout zebrafish KIFBP Orthologs can cause disruption of axonal structure and growth, including axonal defects in the enteric nervous system. KIFBP Overexpression inhibits the function of kinesin, thereby hindering the intracellular transport of the virus and inhibiting viral proliferation.

[0004] in addition, KIFBP The gene is also the causative gene for Goldberg-Shprintzen syndrome (GOSHS), an autosomal recessive inherited neurological disorder characterized by neuronal developmental defects, intellectual disability, facial deformities, heart defects, and frequently, congenital megacolon. To date, 16 genes have been identified as contributing factors to GOSHS. KIFBP Mutations; most mutations result in reduced or complete loss of protein expression. Summary of the Invention

[0005] The purpose of this invention is to overcome the above-mentioned shortcomings of the prior art and provide a method for evaluating the corrected milk yield of Chinese Holstein dairy cows.

[0006] The first objective of this invention is to provide a method for assessing corrected milk yield in Chinese Holstein dairy cows.

[0007] A second objective of this invention is to provide a primer for evaluating corrected milk yield in Chinese Holstein dairy cows.

[0008] A third objective of this invention is to provide a reagent for detecting the rs109669792 genotype in the assessment of corrected milk yield in Chinese Holstein dairy cows.

[0009] A fourth objective of this invention is to provide the application of a reagent for detecting the rs109669792 genotype in the preparation of a kit for assessing corrected milk yield in Chinese Holstein dairy cows.

[0010] The fifth objective of this invention is to provide a kit for assessing corrected milk yield in Chinese Holstein dairy cows.

[0011] The sixth objective of this invention is to provide a method for breeding Chinese Holstein dairy cows with high corrected milk yield.

[0012] A seventh objective of this invention is to provide the application of the method, the primer, or the method in molecular breeding of high-corrected milk yield Chinese Holstein dairy cows.

[0013] To achieve the above objectives, the present invention is implemented through the following solution:

[0014] A method for assessing corrected milk yield in Chinese Holstein dairy cows involves detecting the rs109669792 genotype. The rs109669792 locus is located at NC_037355.1:25247823, which is the 25247823rd position on chromosome 28 of the ARS-UCD 1.3 bovine genome. There are three genotypes: AA, AG, and GG. Among them, the corrected milk yield of individuals with the GG genotype is significantly higher than that of individuals with the GA genotype.

[0015] Preferably, the genotype of rs109669792 is detected by PCR amplification of the sample DNA using primers with nucleotide sequences shown in SEQ ID NO:1-2.

[0016] More preferably, the PCR amplification reaction system is as follows: 1 μL template DNA, 12.5 μL Taq PCR Mix, 0.7 μL each of the primers, and 10.1 μL deionized water.

[0017] More preferably, the PCR amplification reaction procedure is as follows: 95 ℃ for 5 min; 95 ℃ for 30 s, 60 ℃ for 30 s, 72 ℃ for 1 min, cycled 40 times; 72 ℃ for 5 min.

[0018] This invention also claims protection for a primer for assessing corrected milk yield in Chinese Holstein dairy cows, characterized in that the nucleotide sequence of the primer is shown in SEQ ID NO:1-2.

[0019] The upstream primer sequence is 5′-TCCACTGATGGGCTGGGTTA-3′ (SEQ ID NO:1);

[0020] The downstream primer sequence is 5′-TGGTCTCGGCAAGAGTTGAG-3′ (SEQ ID NO:2).

[0021] The following applications are also required to be protected:

[0022] Application of reagents for detecting the rs109669792 genotype in assessing corrected milk yield in Chinese Holstein dairy cows.

[0023] Application of reagents for detecting the rs109669792 genotype in the preparation of a kit for assessing corrected milk yield in Chinese Holstein dairy cows.

[0024] This invention also claims a kit for assessing corrected milk yield in Chinese Holstein cows, containing a reagent for detecting the rs109669792 genotype.

[0025] Preferably, the reagent is a primer with the nucleotide sequence SEQ ID NO:1-2.

[0026] This invention also claims a method for selecting high-corrected milk yield Chinese Holstein dairy cows, using the method to select high-corrected milk yield Chinese Holstein dairy cows as parent stock for breeding.

[0027] The method, the primers, or the application of the method in molecular breeding of high-corrected milk yield Chinese Holstein dairy cows are also within the scope of protection of this invention.

[0028] Compared with the prior art, the present invention has the following beneficial effects:

[0029] This invention identifies a SNP—rs109669792—significantly correlated with corrected milk yield in Chinese Holstein dairy cows, with the GG genotype individuals exhibiting significantly higher corrected milk yields than the GA genotype individuals. Furthermore, primers for detecting the genotype at this SNP locus can be used to assess the corrected milk yield of Chinese Holstein dairy cows, demonstrating promising potential for molecular breeding in corrected milk yield analysis. Attached Figure Description

[0030] Figure 1 Electrophoresis diagram of PCR products using mixed pool DNA from Chinese Holstein dairy cows as template; M: DL2000 DNA Marker; 1: KIFBP Gene PCR amplification products.

[0031] Figure 2 for KIFBP Sequencing results of three genotypes at the G>A site of gene rs109669792. Detailed Implementation

[0032] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments. These embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods; the materials and reagents used, unless otherwise specified, are commercially available.

[0033] Example 1: Chinese Holstein dairy cows KIFBP PCR amplification of genes

[0034] I. Experimental Methods

[0035] 1. Sample preparation

[0036] Five mL of blood was collected from the jugular vein of each of 92 Chinese Holstein dairy cows at a cattle farm in Heilongjiang Province, under the same environment and feeding conditions. The blood was treated with sodium citrate as an anticoagulant and stored at 4 ℃.

[0037] DNA was extracted from the above samples using a DNA extraction kit and stored at -20°C. 40 to 50 different DNA samples were randomly selected to ensure that there were no duplicates among them, and a DNA pool sample was prepared.

[0038] 2. Primer design

[0039] Based on cattle data published in the Ensembl database KIFBP The gene sequence (ENSBTAT00000019353.4) was used to design specific primers, with the upstream primer sequence being 5′-TCCACTGATGGGCTGGGTTA-3′ (SEQ ID NO:1) and the downstream primer sequence being 5′-TGGTCTCGGCAAGAGTTGAG-3′ (SEQ ID NO:2).

[0040] 3. PCR amplification and electrophoresis detection

[0041] PCR amplification was performed on the DNA pool samples using the primers shown in SEQ ID NO:1-2.

[0042] The PCR amplification reaction system (25 μL) consisted of: 1 μL template DNA, 12.5 μL Taq PCR Mix, 0.7 μL primers, and 10.1 μL deionized water.

[0043] PCR amplification reaction procedure: 95 ℃ pre-denaturation for 5 min; 95 ℃ denaturation for 30 s, 60 ℃ annealing for 30 s, 72 ℃ extension for 1 min, 40 cycles; extension at 72 ℃ for 5 min, store at 4 ℃ for later use.

[0044] The PCR products were detected by 1.5% agarose gel electrophoresis to confirm the correct target band, and then sent to Qingke Biotechnology (Guangzhou) Co., Ltd. for sequencing.

[0045] II. Experimental Results

[0046] PCR amplification was performed using the primers shown in SEQ ID NO:1-2 as templates for the mixed DNA. Figure 1 As shown, the amplified product is a 903 bp fragment with a clear electrophoretic pattern, showing no primer dimers, blurred bands, or non-specific amplification. It can be directly used for sequencing identification. The product sequence is SEQ ID NO: 3, i.e.:

[0047] TCCACTGATGGGCTGGGTTA TATACTGTCAAAACGTTTCTGCCTTTCAGCTTATAGCAATTAACGAGAGTAGTTACCCAGCTATGTTTGTAAACATTTCCTTGTGATCTGTTGGTCAATCGATATCACCAGTAAGCAAGAGAGACTCCCTGCCGCAGAGGGAG GGACTGGGCTGGAAATGGTAATGCCTTCGGACAGCTTCCTTTCCATGACAACGGTTGCTGTGGTGACGACTACGCCTTCCCATTGGTCACTGCAAAGCTTACTGCTGTTCCCCGGCAGTACGTCATTGGCTGGCGTTCCGCACTGCGCAGGCGCAGGGCTGTAGCGGCCGTAAGTGAAGC GTCGCAAAAGAGAAGGAAGGCGGGAGTCCCAATTGAAACCGAGGCTGACCAGGCCGCTATGGCGGATTCTCCGTGGGACGAGATTCGTGAGAAATTCCAGACTGCACTGGCCTTATCACGGGTGGAACTGCATAAAAACCCGGAGAAGGAACCGTACAAGTCGAAATACAGCGCCCGGGC GCTGCTGGAAGAGGTTAAAGCGCTATTGGGACCCGCTCCTGAGGACGAGGATGAGCGACCGCAGGCCGATGATAGCTTGGGCGGGGGAACACGCTTTGGGGCTGCCGGCTGAATTGGTGGAGGCCGAGGGGCCCGTCGCCCAGGGAGCAGTGAGGCGAGCGGTTATTGAGTTCCATCT CGGGGTGAACCACATTGACACCGAGGAGTTGTCGGCGGGGGAGGAGCATCTGGTAAAATGTCTGCGGCTACTGCGCAAGTACCGACTGTCGCACGACTGCGTCTCCCTCTACATCCAGGCGCAGGTGAGAAAGATGCGGGCCCGCTGCTGTTGGCCGGAGGCCAATGGGTGGAGAGGGGC CTCAACTCTTGCCGAGACCA (The underlined primers are shown in SEQ ID NO:1-2, and the gray markings are the rs109669792 site).

[0048] Sequencing revealed a distinct overlapping peak, indicating the presence of a single SNP mutation site in the PCR product: rs109669792, located at NC_037355.1:25247823, which corresponds to position 25247823 on chromosome 28 of the bovine genome in ARS-UCD version 1.3. This site contains three genotypes: AA, AG, and GG. The relevant genotype peak diagrams are shown below. Figure 2 .

[0049] Example 2 KIFBP Population genetic characteristics of the rs109669792 G>A locus

[0050] I. Experimental Methods

[0051] Following the method in Example 1, DNA samples from 92 Chinese Holstein dairy cows in Example 1 were subjected to PCR amplification and sequencing. SeqMan was used to observe overlapping peaks, identify individual genotypes, and count SNP loci. Popgene software was used to calculate a series of genetic parameters for alleles, and further, χ² values ​​were calculated.

[0052] II. Experimental Results

[0053] The results are shown in Table 1. The dominant allele at the rs109669792 G>A locus is G, with a gene frequency of 0.8913. The homozygous wild-type GG is the dominant genotype, with a genotype frequency of 0.7935. The heterozygosity (H) of the rs109669792 G>A locus falls between 0.25 and 0.50, while the polymorphism information content (PIC) is less than 0.25, indicating that... KIFBP In the gene, this locus exhibits low polymorphism. The χ² test results indicate that this locus is in Hardy-Weinberg equilibrium in the 92 Chinese Holstein dairy cows used in the study. P >0.05).

[0054] Table 1. Population genetic characteristics of the KIFBP gene rs109669792 G>A locus in Chinese Holstein dairy cattle.

[0055]

[0056] Note: χ 2 The value indicates that the significance level has not been reached. P >0.05), χ 2 0.05 (df=2)>5.99( P <0.05), χ 2 0.01 (df=2)>9.21( P <0.01).

[0057] Example 3 KIFBP Correlation between the gene rs109669792 G>A site and milk quality traits in Chinese Holstein dairy cows

[0058] I. Experimental Methods

[0059] The milk quality traits of 92 Chinese Holstein dairy cows in Example 1 were tested, including: milk yield (kg), milk fat content (%), milk protein content (%), lactose content (%), dry matter content (%), and corrected milk yield (kg), a total of 6 indicators. The relationship between milk quality traits and genotypes of Chinese Holstein dairy cows was tested for significance. The results are presented as mean ± standard deviation.

[0060] The specific testing method was as follows: the milk quality traits of 92 dairy cows that were growing in the same environment and were in the lactation period were tested using a milk composition analyzer, including: milk fat content (%), milk protein content (%), lactose content (%), and dry matter content (%).

[0061] Meanwhile, individual milk production, i.e., the milk production of each dairy cow in each lactation period, is the basis for milk production statistics. Individual milk production and corrected milk production are often expressed as milk production over 305 days and corrected milk production over 305 days.

[0062] Milk production over 305 days: Milk production was collected and statistically analyzed from the first day after calving to the 305th day. The average daily milk production per calf was calculated.

[0063] Corrected milk production over 305 days: For lactation periods less than 305 days, or exceeding 305 days without daily milk production records, the actual milk production from these records is multiplied by a relative coefficient to correct for an approximate daily production over 305 days. The average value is then calculated as the individual's corrected daily milk production.

[0064] II. Experimental Results

[0065] The results are shown in Table 2. The rs109669792 G>A locus was significantly associated with the corrected milk yield trait in Chinese Holstein dairy cows (P<0.05). The corrected milk yield of individuals with the GG genotype was significantly higher than that of individuals with the GA genotype. No significant correlation was found with other milk quality indicators (P>0.05). There was only one individual with the AA genotype, which did not meet the statistical requirements and was therefore not statistically significant.

[0066] Table 2 KIFBP Correlation between the gene rs109669792 G>A site and milk quality traits in Chinese Holstein dairy cows

[0067]

[0068] Note: For the same indicator in the same category, those with completely different letters indicate significant differences (P<0.05); those without letters indicate no significant differences (P>0.05).

[0069] Example 4: A method for assessing corrected milk yield in Chinese Holstein dairy cows

[0070] 1. Method

[0071] PCR amplification of sample DNA was performed using primers shown in SEQ ID NO:1-2.

[0072] PCR amplification reaction system: (25 μL) 1 μL template DNA, 12.5 μL Taq PCR Mix, 0.7 μL each primer, and 10.1 μL deionized water.

[0073] PCR amplification reaction procedure: 95 ℃ pre-denaturation for 5 min; 95 ℃ denaturation for 30 s, 60 ℃ annealing for 30 s, 72 ℃ extension for 1 min, 40 cycles; extension at 72 ℃ for 5 min, store at 4 ℃ for later use.

[0074] The PCR products were detected by 1.5% agarose gel electrophoresis and then sequenced.

[0075] 2. Result Interpretation

[0076] Sequencing results showed that the rs109669792 site was located at 164 bp of the amplified product (SEQ ID NO:3), at NC_037355.1:25247823, which is nucleotide 25247823 on chromosome 28 of the bovine genome in ARS-UCD version 1.3. There were three genotypes: AA, AG, and GG. Among them, the corrected milk yield of individuals with the GG genotype was significantly higher than that of individuals with the GA genotype.

[0077] Example 5: A kit for assessing corrected milk yield in Chinese Holstein dairy cows

[0078] I. Composition

[0079] Primers shown in SEQ ID NO:1-2, Taq PCR Mix, and deionized water.

[0080] II. Instructions for Use

[0081] Same as Example 4.

[0082] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. For those skilled in the art, other variations or modifications can be made based on the above description and ideas, and it is neither necessary nor possible to exhaustively describe all implementation methods here. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the claims of the present invention.

Claims

1. A method for evaluating the corrected milk yield of a Chinese Holstein cow, characterized in that, The genotype of SNP site rs109669792 is detected; the corrected milk yield of individuals with GG genotype of the SNP site is significantly higher than that of individuals with GA genotype.

2. The method of claim 1, wherein, The genotype of rs109669792 is detected by PCR amplification of sample DNA using primers with nucleotide sequences shown in SEQ ID NO: 1-2.

3. The method of claim 2, wherein, The reaction system of the PCR amplification is as follows: 1 μL of template DNA, 12.5 μL of Taq PCR Mix, 0.7 μL of each primer and 10.1 μL of deionized water.

4. The method of claim 2, wherein, The reaction procedure of the PCR amplification is as follows: 95 ℃ for 5 min; 95 ℃ for 30 s, 60 ℃ for 30 s, 72 ℃ for 1 min, cycle 40 times; 72 ℃ for 5 min.

5. The primer for evaluating the corrected milk yield of Chinese Holstein cows is applied in the molecular breeding of Chinese Holstein cows with corrected milk yield, characterized in that, The primers are used for detecting the genotype of SNP site rs109669792, and the nucleotide sequences of the primers are shown in SEQ ID NO: 1-2; the corrected milk yield of individuals with GG genotype of the SNP site is significantly higher than that of individuals with GA genotype.

6. The use of a reagent for detecting the genotype of SNP site rs109669792 in the evaluation of the corrected milk yield of Chinese Holstein cows, characterized in that, The corrected milk yield of individuals with GG genotype of the SNP site is significantly higher than that of individuals with GA genotype.

7. Use of a reagent for detecting the genotype of SNP site rs109669792 in the preparation of a kit for evaluating the corrected milk yield of Chinese Holstein cows, characterized in that, The corrected milk yield of individuals with GG genotype of the SNP site is significantly higher than that of individuals with GA genotype.

8. The use of a kit for evaluating the corrected milk yield of Chinese Holstein cows in the molecular breeding of Chinese Holstein cows with corrected milk yield, characterized in that, The kit contains reagents for detecting the genotype of SNP site rs109669792, and the corrected milk yield of individuals with GG genotype of the SNP site is significantly higher than that of individuals with GA genotype.

9. A method for selecting Chinese Holstein dairy cows with high yield of normal milk, characterized in that, High-corrected milk yield Chinese Holstein cows are selected as parents for breeding by the method of claim 1.

10. Application of the method of claim 1 in the molecular breeding of high-corrected milk yield Chinese Holstein cows.