A SNP molecular marker related to the testicle size trait of Hu sheep and its screening method and application
By screening SNP molecular markers in the intron region of the LRRIQ1 gene on chromosome 3 of the Hu sheep, the problems of lack of molecular markers and low breeding efficiency in Hu sheep breeding were solved, and an efficient and accurate breeding process and genetic protection were achieved.
Patent Information
- Application Number
- CN202411851122.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-16
- Publication Date
- 2025-09-19
- Estimated Expiration
- 2044-12-16
AI Technical Summary
In the existing technology, Hu sheep breeding lacks effective molecular markers, traditional breeding methods are time-consuming and inefficient, and semen quality evaluation is complicated, which affects the improvement of Hu sheep's reproductive capacity and the protection of genetic characteristics.
SNP molecular markers located in the intron region of the LRRIQ1 gene at 121444334 bp on chromosome 3 of Hu sheep were screened out. Through genome-wide association analysis and univariate linear mixed model, SNP sites associated with testis size traits were screened out and applied to molecular marker-assisted selection and breeding.
It has improved the accuracy and efficiency of Hu sheep breeding, shortened the breeding cycle, reduced costs, improved the accuracy of semen quality evaluation, promoted the protection and utilization of genetic diversity, and promoted the advancement of breeding technology.
Smart Images

Figure CN119410794B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of molecular biology, and in particular to a SNP molecular marker related to the testicle size trait of Hu sheep, a screening method thereof, and an application thereof. Background Art
[0002] As the sheep breed with the highest market share in China's meat sheep market, the development and protection of its high-quality traits are crucial to the sustainable development of the meat sheep industry. However, some unplanned crossbreeding practices are gradually altering the genetic characteristics of Hu sheep, posing a threat to their long-term development. In this context, improving the reproductive capacity of Hu sheep, especially male reproductive capacity, has become a key research and practice priority.
[0003] Male fertility is a complex, polygenic trait influenced by multiple loci and environmental factors. In large-scale sheep farms, ram fertility is directly related to the overall production and economic benefits of the flock. Therefore, improving the utilization and coverage of high-quality breeding rams is crucial for improving overall production. Semen quality is a key indicator of ram fertility, but its assessment is complex and susceptible to multiple factors, such as age, nutritional status, and season. This makes objective and accurate evaluation of semen quality quite difficult. In contrast, testicle size, a simple, easily measured indicator with high heritability, shows significant positive correlations with reproductive performance parameters such as ejaculate volume, sperm density, and sperm motility, and a significant negative correlation with sperm abnormality rate. It is also closely related to growth performance and conception rate of inseminated dams. Therefore, testicle size has become an important selection target for genetically improving the fertility of both males and their offspring.
[0004] In breeding practice, traditional breeding methods are often time-consuming and inefficient. Molecular marker-assisted selection, as an advanced breeding method, can significantly improve the accuracy of trait selection, reduce breeding costs, and increase breeding efficiency. However, candidate genes and molecular markers associated with testicular size in livestock are currently very limited. Therefore, screening single nucleotide polymorphisms (SNPs) and candidate genes associated with testicular size traits, and developing molecular markers for assisted selection and breeding planning, are of great significance for accelerating the breeding process of high-breeding Hu sheep and improving breeding precision. Summary of the Invention
[0005] Given the current technical challenges faced in Hu sheep breeding, such as a lack of candidate genes and molecular markers, inadequate traditional breeding methods, and complex semen quality evaluation, there is an urgent need to develop efficient and accurate molecular markers to assist in the selection of high-breeding Hu sheep lines, significantly improving the breeding process and accuracy, ensuring the inheritance of high-quality Hu sheep traits, and promoting the sustainable development of the mutton industry. This invention aims to provide a SNP molecular marker associated with Hu sheep testicle size, as well as a screening method and application thereof.
[0006] In order to achieve the above object, the present invention adopts the following technical solutions:
[0007] The present invention provides a SNP molecular marker related to the testicle size trait of Hu sheep. The SNP molecular marker is located at 121444334 bp on Hu sheep chromosome 3, comes from the intron region of the LRRIQ1 gene, and the base is A or G.
[0008] The SNP molecular marker is located in a gene segment whose nucleotide sequence is shown in SEQ ID NO.1.
[0009] The testicular size traits of Hu sheep are total testicular weight TTW, testicular index TI and total epididymal weight TEW.
[0010] The present invention provides a method for screening the above-mentioned SNP molecular marker related to the testicle size trait of Hu sheep, comprising:
[0011] (1) Collect molecular samples from the testicles and epididymis of Hu sheep, and measure and record traits related to testicular size;
[0012] (2) Blood was collected from the jugular vein to extract genomic DNA;
[0013] (3) Based on the extracted blood genomic DNA, library construction, library quality testing and sequencing;
[0014] (4) Mutation detection and SNP site screening;
[0015] (5) Based on genome-wide association analysis, significant association loci were screened to obtain SNP molecular markers related to the testis size trait of Hu sheep.
[0016] The Hu sheep are 180 days old.
[0017] The testis size-related traits include left testis weight, right testis weight, left testis length, right testis length, left testis width, right testis width, left epididymis weight and right epididymis weight.
[0018] The method screens significant association sites based on genome-wide association analysis and uses a univariate linear mixed model to perform correlation analysis between SNP sites and phenotypes.
[0019] The univariate linear mixed model formula is: y = Wα + xβ + μ + ε, where y is the individual phenotypic value, W is the fixed effect matrix, α is the fixed effect vector; x is the SNP genotype, β is the effect value of the SNP additive effect, μ is the random effect, and ε is the random residual.
[0020] The application of the above-mentioned SNP molecular markers related to the testicle size trait of Hu sheep in molecular marker-assisted breeding of Hu sheep.
[0021] The application of the above-mentioned SNP molecular markers related to the testicle size trait of Hu sheep in assisted selection breeding of Hu sheep testicle size trait.
[0022] Application of the above-mentioned SNP molecular markers related to the testicle size trait of Hu sheep in the preparation of a detection kit.
[0023] A kit for detecting the genotype of Hu sheep is prepared by using SNP molecular markers related to the testicle size trait of Hu sheep.
[0024] A method for detecting the genotype of Hu sheep comprises designing primers based on the nucleotide sequences on both sides of the SNP molecular marker site related to the testis size trait of Hu sheep, collecting blood from the male Hu sheep to be tested after birth and extracting genomic DNA, using the primers to perform genotyping on the Hu sheep material to be tested, and determining the genotype of the Hu sheep to be tested at the SNP site.
[0025] Compared with the prior art, the present invention achieves the following technical effects:
[0026] The SNP molecular marker related to the testicle size trait of Hu sheep provided by the present invention is located on chromosome 3 of Hu sheep and comes from the intron region of the LRRIQ1 gene. The SNP molecular marker is closely related to the testicle size trait of Hu sheep. Therefore, high-breeding Hu sheep can be accurately bred by screening individuals with specific genotypes, which can accelerate the pace of Hu sheep breed improvement and improve the reproductive capacity of the flock, thereby promoting the sustainable development of the mutton industry. The SNP molecular marker not only improves the efficiency and accuracy of breeding and accelerates the breeding process, but also promotes the protection and utilization of genetic diversity, improves the accuracy of semen quality evaluation, and promotes the progress and development of breeding technology.
[0027] The method of the present invention for obtaining SNP molecular markers related to the testicle size trait of Hu sheep involves a series of scientific and rigorous steps, including sample collection and trait recording, DNA extraction, library construction and sequencing, variation detection, genome-wide association analysis, and significant SNP site screening. Through genome-wide association analysis, SNP sites significantly associated with the testicle size trait of Hu sheep are directly screened out, ensuring the accuracy and reliability of SNP molecular markers and avoiding the blindness and uncertainty of phenotypic selection in traditional breeding methods. This not only provides a powerful tool for Hu sheep breeding, but also provides important basic data for studying the genetic mechanisms of testicular development and function.
[0028] The application provided by the present invention can quickly screen out individuals with a close relationship with testicle size traits in a large number of Hu sheep populations through SNP molecular marker technology. Compared with traditional breeding methods, it is more efficient and directly screens for genetic variations, reducing the blindness and uncertainty in the breeding process. The SNP molecular marker is located in the intron region of the specific LRRIQ1 gene, which can more accurately locate the genetic variation that affects the testicle size trait, and help to accurately assess the genetic potential of individuals, thereby improving the accuracy of breeding. The use of SNP molecular markers for breeding can directly select individuals at the genomic level in the early stages of individual development, without relying on phenotypic information, and can significantly This method significantly improves selection efficiency, avoids the disadvantage of traditional breeding methods that require waiting for individuals to mature before evaluating traits, greatly shortens the breeding cycle, and accelerates the cultivation process of new varieties. Through early selection and breeding, individuals that do not meet the requirements can be eliminated as early as possible, which helps to reduce breeding costs and improve economic benefits. For individuals with semen quality problems, SNP molecular markers can be used as auxiliary diagnostic tools to help identify potential genetic defects or disease risks. Therefore, the present invention not only improves breeding efficiency and accuracy, accelerates the breeding process, but also promotes the protection and utilization of genetic diversity, improves the accuracy of semen quality evaluation, and promotes the progress and development of breeding technology. BRIEF DESCRIPTION OF THE DRAWINGS
[0029] Figure 1 This is a diagram of the genotyping results of the present invention. DETAILED DESCRIPTION
[0030] In order to enable those skilled in the art to better understand the solutions of the present invention, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts should fall within the scope of protection of the present invention.
[0031] The present invention is described in further detail below with reference to the accompanying drawings:
[0032] Example 1
[0033] The present invention provides a SNP molecular marker related to the testicle size trait of Hu sheep, comprising the following steps:
[0034] 1. Selection and feeding management of experimental animals
[0035] This study selected a total of 3,028 Hu sheep lambs as experimental animals in 9 batches from 8 large-scale Hu sheep farms between 2018 and 2022.
[0036] The experimental animals were weaned at 56 ± 8.4 days of age and received standardized disease prevention. They were then transported to Minqin Defu Agricultural Technology Co., Ltd. (Lanzhou University Sheep Performance Testing Center) and housed individually in fattening pens (0.8 m × 1.0 m). All batches of lambs were housed and cared for under the same nutritional and feeding conditions. The nutrient ratios used in the diet were based on the NRC (National Research Council, 2007) standard for fattening sheep, and the diet was prepared as a TMR (total mixed ration) pelleted diet.
[0037] 2. Trait determination and sample collection
[0038] At 180 days of age, the maximum scrotal circumference (SC) of the sheep's scrotum was measured using a soft ruler placed against the scrotal surface. Slaughtered sheep were performed according to the Agricultural Industry Standard of the People's Republic of China (NY / T3469-2019, Sheep Slaughter Procedures). Molecular samples of the testicles and epididymis were immediately collected and placed in liquid nitrogen. The samples were then transported to the laboratory and stored at -80°C. Testicular size-related traits were measured and recorded, including left testicular weight (LTW), right testicular weight (RTW), left testicular length (LTL), right testicular length (RTL), left testicular width (LTWI), right testicular width (RTWI), left epididymis weight (LEW), and right epididymis weight (REW). Testicular and epididymis weights were weighed using a single balance with a thousandth scale, and testicular length and width were measured using a digital vernier caliper. Indicators such as total testicular weight (TTW), total epididymis weight (TEW), coefficient of variation of left and right testicular weights (VCTW), testicular index (TI), and total testicular volume (TV) were calculated using the following formulas:
[0039] Formula 1
[0040] Formula 2
[0041] Formula 3
[0042] SPSS Statistics 25.0 software was used to summarize and analyze all phenotypic data. Outliers were eliminated using the 3-times standard deviation method. The descriptive statistics of testis size-related traits of Hu sheep at 180 days of age are shown in Table 1:
[0043] Table 1: Descriptive statistics of testicular size-related traits
[0044]
[0045] 3. Genomic DNA Extraction and Sequencing
[0046] (1) Sample collection and DNA extraction
[0047] At 180 days of age, 5 mL of blood samples were collected from all sheep through the jugular vein using anticoagulant blood collection tubes containing sodium heparin to ensure that the blood samples did not coagulate during the collection process.
[0048] Blood genomic DNA was extracted using the EasyPure® Blood Genomic DNA Kit (TransGen Biotech, Beijing, China).
[0049] (2) DNA quality testing
[0050] The integrity and concentration of the extracted DNA were detected using 1% agarose gel and NanoDrop 2000 spectrophotometer (Thermo Scientific, USA), respectively.
[0051] (3) Library construction
[0052] Library construction is divided into three parts: DNA fragmentation / end repair / addition of A tails, adapter ligation, and PCR enrichment. The DNA fragments with added adapters are amplified by polymerase chain reaction (PCR);
[0053] (4) Library quality testing
[0054] The concentration and insert size of the constructed library were detected using Qubit2.0 and Agilent 2100, respectively.
[0055] Quantitative polymerase chain reaction (Q-PCR) was used to accurately quantify the effective concentration of the library.
[0056] (5) Sequencing and data processing
[0057] The qualified libraries were sequenced on the Illumina NovaSeq 6000 platform to obtain 150 bp paired-end reads. The raw reads obtained by sequencing were quality controlled using fastp (v 0.20.0) to obtain high-quality clean reads. The quality control mainly included (1) deleting the adapter sequence in the Illumina library construction; (2) reads containing more than 10% unknown bases; and (3) reads containing more than 40% low-quality bases (base quality value <15).
[0058] 4. Mutation Detection and SNP Site Screening
[0059] (1) Clean reads are aligned to the reference genome
[0060] The Burrows-Wheeler Alignment-Maximal Exact Match (BWA-MEM) algorithm was used to align the high-quality clean reads after quality control to the sheep reference genome (ARS-UI Ramb v2.0, GCF016772045.1).
[0061] (2) Sorting and deduplication of bam files
[0062] SAMtools (v 1.10) and Picard (v 2.20.1) software were used to sort and remove duplicates from the bam files.
[0063] (3) Mutation detection
[0064] GATK (v 4.1.8) was used for variant detection. The HaplotypeCaller module was used to analyze the bam file of each sample and generate the corresponding gVCF file. The gVCF file contains the genomic variation information of the sample, including SNPs, indels, etc. The CombineGVCFs module was used to merge the GVCF files of multiple samples into a large GVCF file. The GenotypeGVCFs module was used to perform joint genotype analysis on the merged GVCF files and output the final VCF file.
[0065] (4) Mutation hard filtering
[0066] bcftools (v 1.18) was used to perform hard filtering on the identified variant set to remove low-quality variant sites. The filtering conditions were: INFO / DP <10311 | INFO / DP>92802 | QD<2.0 | QUAL<30.0 | MQ<40.0 | FS>60.0 | ReadPosRankSum<-8.0 | MQRankSum<-12.5 | SOR>3.0, 51,750,417 SNPs were found.
[0067] (5) Further filtering of SNP sites
[0068] PLINK (v 1.9) software was used to filter out SNP sites with SNP missing rates >5%, individuals with sample missing rates >20%, and SNP sites with minimum allele frequency (MAF) < 0.01. Finally, 19,142,158 autosomal SNP sites were obtained for subsequent genome-wide association analysis.
[0069] 5. Genome-wide Association Analysis
[0070] (1) Trim the autosomal SNPs obtained by quality control to obtain independent SNP sites
[0071] The autosomal SNPs obtained by quality control were trimmed using the --indep-pairwise 50 5 0.2 setting in PLINK software to obtain 891,673 independent SNP sites, and principal component analysis (PCA) was performed using PLINK software.
[0072] (2) Use GEMMA software to perform univariate linear mixed model analysis and screen significantly associated SNP sites
[0073] The association between SNPs and phenotypes was analyzed using a univariate linear mixed model (LMM) in GEMMA (v 0.98) software. The model formula was: y = Wα + xβ + μ + ε, where y represents the individual phenotypic value, W represents the fixed effect matrix, and α represents the fixed effect vector; x represents the SNP genotype, β represents the effect size of the SNP additive effect, μ represents the random effect, and ε represents the random residual. The centralized kinship matrix (kinship) calculated from the SNP locus information was used as the independent variable, and the first three principal components of the PCA were added as covariates in the genome-wide association analysis model to minimize the influence of population stratification. The field-year-season effect of the experimental animals was incorporated into the batch fixed effect (a total of 9 batches). To eliminate bias caused by pre-slaughter live weight in the GWAS of testis size traits other than TI, pre-slaughter live weight was added as a numerical covariate in the model. P < 1 × 10 -6 It is used as a significant threshold at the genome level to screen significant association sites.
[0074] (3) Use ANNOVAR to perform functional annotation on the significant SNPs sites obtained from GWAS
[0075] The sheep reference genome version used was ARS-UI Ramb v2.0, GCF 016772045.1. A single nucleotide polymorphism (SNP) molecular marker significantly associated with TTW, TI, and TEW was identified from the GWAS results. This SNP is located at 121,444,334 bp on chromosome 3 of Hu sheep. Gene annotation indicates that this SNP is located in an intron of LRRIQ1. Details are shown in Table 2.
[0076] Table 2: Detailed information of SNP molecular markers
[0077]
[0078] The 150 bp sequence before and after the SNP marker is shown in SEQ: NC_056056.1|:121444184-121444484 Ovis aries strain OAR_USU_Benz2616 breed Rambouillet chromosome 3, ARS-UI_Ramb_v3.0, whole genome shotgun sequence
[0079] CTGAGTGTTCCTATTGATGCATAATTCATAACAAGATATTTTCAGGACTATAACCAAATGTTGCATAACTCACAGCTTACCATCTATATTAACCAGATGAAAGAGGTCTTCTTTAGCGATTTAAAAGCATCTGTACAGATAATGTGAAAA[A / G ]TACAAACAAAACATTTCAGGATGTATTTTTAAGATACTTAAACATTTAACAACCTCAGTTACTCTTTAATTAGTTATATTTAAACATATAATGCAACAGGCAATTATTGATAGATTTCTCCTTTGAAAATAATAATAATATAAAGGAATATA (SEQ ID NO.1)
[0080] (4) Verification of the association between SNP sites and phenotypes
[0081] The genotyping results of all sequenced individuals at 121444344 bp on chromosome 3 were extracted using Plink software. The association between different genotypes of this SNP and TTW, TEW, and TI was further analyzed using the paired sample T test in SPSS software. The results are shown in the Appendix. Figure 1 and shown in Table 3.
[0082] Table 3: Association between different SNP genotypes and TTW, TEW and TI
[0083]
[0084] The above results show that the SNP molecular marker significantly affects TTW, TEW and TI, among which the TTW, TEW and TI of the AA genotype are extremely significantly higher than those of the AG and GG genotypes (P<0.01), indicating that there is a significant association between the SNP site (rs422564674) and the three traits of TTW, TEW and TI, and G is a deleterious allele.
[0085] Therefore, when breeding Hu sheep, the above-mentioned SNP molecular markers can be used to design primers on the nucleotide sequences on both sides of the markers. Blood can be collected after the birth of the Hu sheep lambs and genomic DNA can be extracted. The primers can be used to perform genotyping on the Hu sheep lambs to determine whether the individuals carry the G allele. Eliminating individuals with the G allele can speed up the breeding process.
[0086] The above content is only for explaining the technical idea of the present invention and cannot be used to limit the protection scope of the present invention. Any changes made on the basis of the technical solution in accordance with the technical idea proposed by the present invention shall fall within the protection scope of the claims of the present invention.
Claims
1. Application of a reagent for detecting SNP molecular markers in assisted selection breeding of Hu sheep for testicle size traits, characterized in that: The testicular size traits are total testicular weight, testicular index and total epididymal weight; the nucleotide sequence of the SNP molecular marker is as follows: CTGAGTGTTCCTATTGATGCATAATTCATAACAAGATATTTTCAGGACTATAACCAAATGTTGCATAACTCACAGCTTACCATCTATATTAACCAGATGAAAGAGGTCTTCTTTAGCGATTTAAAAGCATCTGTACAGATAATGTGAAAAATACAAACAAAACATTTCAGGATGTATTTTTAAGATACTTAAACATTTAACAACCTCAGTTACTCTTTAATTAGTTATATTTAAACATATAATGCAACAGGCAATTATTGATAGATTTCTCCTTTGAAAATATAATATATAAAGGAATATA, wherein the 151st base is A or G, and the total testicular weight, testicular index and total epididymal weight of the AA genotype are extremely significantly higher than those of the AG and GG genotypes.
2. Use of a primer for detecting the SNP molecular marker according to claim 1 in preparing a kit for detecting the testis size trait of Hu sheep, characterized in that: The testicular size traits are total testicular weight, testicular index and total epididymal weight.
3. A method for breeding Hu sheep, characterized in that: Primers are designed based on the nucleotide sequences on both sides of the polymorphic site of the SNP molecular marker according to claim 1, blood is collected from the male Hu sheep to be tested after birth, and genomic DNA is extracted. The primers are used to perform genotyping on the Hu sheep material to be tested, and the genotype of the Hu sheep to be tested at the SNP site is determined, and individuals with the G allele are eliminated. The breeding traits are total testicular weight, testicular index and total epididymal weight.
Citation Information
Patent Citations
Method for detecting single nucleotide polymorphism of SPATA6 gene of sheep and application
CN110241227A
ADPGK gene molecular marker related to Hu sheep testis traits and application thereof
CN113416788A