DsRNA targeting BcPfy1 gene, beauveria bassiana engineering strain Bb-dsPfy1 and application of beauveria bassiana engineering strain Bb-dsPfy1

Abstract

The invention provides dsRNA (double-stranded ribonucleic acid) of a targeted BcPfy1 gene, a beauveria bassiana engineering strain Bb-dsPfy1 and application of the beauveria bassiana engineering strain Bb-dsPfy1. According to the Beauveria bassiana engineering strain Bb-dsPfy1, a Beauveria bassiana QSE-F1 strain is used as a chassis bacterium, and the strain can be colonized at tomato leaves. The dsRNA is a double-stranded RNA fragment which is designed by taking a botrytis cinerea BcPfy1 gene as a target and has the functions of interfering BcPfy1 gene expression and inhibiting botrytis cinerea infection, and the fragment is obtained through in-vitro synthesis or is synthesized in a QSE-F1 strain through two target gene sequences which are the same in sequence and opposite in direction. The engineering strain Bb-dsPfy1 is a dsRNA engineering strain capable of synthesizing targeted BcPfy1, which is obtained by transferring a carrier containing a target gene sequence into a beauveria bassiana QSE-F1 strain by utilizing an ATMT technology. Experiments prove that the engineering strain can effectively interfere the expression of a target gene BcPfy1, has a remarkable prevention and treatment effect on tomato gray mold, can be used for preparing biological agents for preventing and treating gray mold, and has a good market application prospect.

Description

Technical Field

[0001] The invention belongs to the technical field of crop disease prevention and control genes, and specifically relates to a dsRNA targeting a BcPfy1 gene and an engineered Beauveria bassiana strain Bb-dsPfy1 and applications thereof. Background Art

[0002] RNA interference (RNAi) technology is a cutting-edge gene regulation technology that can silence the expression of target genes through double-stranded RNA (dsRNA), and has potential application value in the fields of medicine and plant protection. RNA pesticides developed using RNAi technology use dsRNA that specifically targets key genes of pests as their active ingredient. They have the advantages of strong targeting, excellent efficacy, high environmental and ecological safety, and low resistance to pesticides. They are considered to be the "third revolution" in the history of pesticide development. At present, there are two main ways to apply dsRNA in the agricultural field. One is to obtain transgenic plants expressing dsRNA through plant genetic transformation technology, and use the dsRNA expressed by the host to interfere with the expression of target genes of pests, namely the host-induced gene silencing (HIGS) technology; the other is to silence target genes by directly spraying dsRNA in vitro, namely the exogenous spray-induced gene silencing (SIGS) technology. However, the lack of mature genetic transformation systems and long transformation cycles for some crops have greatly limited the promotion and application of HIGS technology; SIGS technology also has problems such as poor stability of dsRNA in the environment, low efficiency of delivery to target organisms, and high cost of dsRNA synthesis and purification, which limit the commercialization of SIGS technology in the agricultural field. Therefore, in order to achieve the effective use of dsRNA in plant disease and insect pest control, it is necessary to find more effective dsRNA application methods.

[0003] Using endophytes that colonize dominantly in plant tissues as chassis microorganisms, constructing engineered strains that efficiently express dsRNA of target genes of pests, and using microorganisms to efficiently synthesize dsRNA and deliver it to plant pests can effectively solve the problems of high cost of dsRNA synthesis, poor stability of dsRNA, and short interval between application periods. It has great research and application value in the development and field application of RNA pesticides. Beauveria bassiana is a tricholoma insect pathogenic fungus widely used in biological control of agricultural and forestry pests. It can parasitize in hundreds of insects. At the same time, Beauveria bassiana can not only parasitize in pests, but also colonize in a variety of plants such as corn and tomatoes. It is a non-pathogenic plant endophytic fungus. In recent years, studies have found that the colonization of Beauveria bassiana in plants can not only effectively control pests, but also improve plant disease resistance, promote plant growth, and improve plant tolerance to abiotic stress. The biological characteristics of Beauveria bassiana have a good research foundation, and have good safety for non-target organisms such as plants and the environment. It is a suitable chassis microorganism for the construction of engineering strains. At the same time, Beauveria bassiana has the advantages of easy cultivation, easy large-scale production, and low production cost, which gives it a broad application prospect in the biological control of plant diseases and insect pests. Summary of the invention

[0004] The present invention aims to solve the above problems and provides a dsRNA targeting the BcPfy1 gene and an engineered strain of Beauveria bassiana Bb-dsPfy1 and its application. The engineered strain Bb-dsPfy1 uses the Beauveria bassiana QSE-F1 strain to express the dsRNA of the target gene BcPfy1 of gray mold. The engineered strain can effectively interfere with the expression of the target gene BcPfy1 and has a significant control effect on tomato gray mold.

[0005] To achieve the above invention objectives, the present invention is implemented through the following scheme:

[0006] The present invention provides an application of a BcPfy1 gene in regulating the pathogenicity of gray mold. The coding sequence of the BcPfy1 gene is shown in SEQ ID No. 1. The BcPfy1 gene can inhibit the occurrence of gray mold and reduce the pathogenicity of gray mold.

[0007] The present invention uses the coding gene as the target gene for controlling gray mold to design and synthesize dsRNA, and verifies the effect of dsRNA in controlling gray mold. The target gene is a gene encoding profilin, a conserved small molecule inhibitor protein in the actin assembly process, referred to as BcPfy1, and the sequence is shown in SEQ ID No. 1.

[0008] The present invention also provides a dsRNA targeting the BcPfy1 gene. The dsRNA is synthesized in vitro using the target gene BcPfy1 as a synthesis template. The sequence of the dsRNA is shown in SEQ ID No.4.

[0009] Furthermore, the sequence of the synthetic template of the dsRNA is shown as SEQ ID No.2.

[0010] The present invention also provides an engineered strain of Beauveria bassiana Bb-dsPfy1 expressing dsRNA. The engineered strain Bb-dsPfy1 is obtained by transferring a dsRNA expression framework capable of interfering with the expression of a target gene BcPfy1 into Beauveria bassiana. The sequence of the dsRNA expression framework of BcPfy1 is shown in SEQ ID No.7.

[0011] Furthermore, the Beauveria bassiana is a QSE-F1 strain, which is deposited in the China Center for Type Culture Collection with a deposit number of CCTCC NO: M 20241661.

[0012] Furthermore, the construction method of the engineered strain Bb-dsPfy1 comprises the following steps:

[0013] (1) The dsRNA expression framework is composed of arm sequences with the same sequence at both ends and opposite directions and a central sequence in the middle that acts as a connector to construct an expression framework containing dsRNA;

[0014] (2) Connecting the expression frame containing dsRNA to the multiple cloning site of the pDHt-Bar vector containing the constitutive promoter oliC suitable for Beauveria bassiana to construct a plasmid containing the expression frame containing dsRNA;

[0015] (3) The successfully constructed plasmid containing the dsRNA expression framework is transferred into the Agrobacterium tumefaciens strain, and then the dsRNA expression framework is transferred into Beauveria bassiana. Positive transformants are screened using a resistance plate containing herbicide to obtain the engineered bacteria Bb-dsPfy1 strain. The Beauveria bassiana is a QSE-F1 strain, which is deposited in the China Center for Type Culture Collection with a deposit number of CCTCC NO: M 20241661.

[0016] Furthermore, the engineered strain is a strain in which the dsRNA expression framework of the target gene BcPfy1 is transferred into the QSE-F1 strain using Agrobacterium tumefaciens-mediated transformation (ATMT) technology to obtain the Beauveria bassiana engineered strain Bb-dsPfy1.

[0017] Furthermore, the arm sequence is the coding sequence of the target gene BcPfy1, and the sequence is shown in SEQ ID No.1; the central sequence is the first intron sequence of the endogenous gene BcTubulin of Botrytis cinerea, and the sequence is shown in SEQ ID No.6.

[0018] The present invention also provides the use of the dsRNA targeting the BcPfy1 gene in preventing and controlling gray mold.

[0019] Furthermore, the dsRNA for controlling gray mold is to add 200 μg / ml of the target gene dsRNA to the conidia of gray mold, which can significantly inhibit the infection of gray mold on tomato leaves.

[0020] Furthermore, the dsRNA prevents and controls gray mold, which is reflected in that the lesions produced by gray mold infection are significantly reduced, and the biomass of gray mold on the lesions is significantly reduced.

[0021] The invention also provides application of the engineering strain Bb-dsPfy1 in preventing and treating gray mold.

[0022] Furthermore, during application, the spore suspension of the engineered strain Bb-dsPfy1 is evenly sprayed on the entire tomato plant.

[0023] Furthermore, the spore suspension of the engineered strain Bb-dsPfy1 is prepared by inoculating the engineered strain Bb-dsPfy1 into a YEPD liquid culture medium, shaking and culturing at 25°C and 180 rpm for 4 days, filtering the culture solution through three layers of clean paper to remove mycelium, counting the spores in the filtrate, and diluting the spore suspension with clean water to a spore concentration of 10 6 -10 7 cfu / ml before use.

[0024] Furthermore, the engineered strain Bb-dsPfy1 can effectively inhibit the expression of the target gene BcPfy1 of Botrytis cinerea, thereby inhibiting the infection of Botrytis cinerea.

[0025] Furthermore, the engineered strain Bb-dsPfy1 controls gray mold, which is reflected in that the lesions produced by gray mold infection are significantly reduced, and the biomass of gray mold on the lesions is significantly reduced.

[0026] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0027] 1. The dsRNA provided by the present invention can effectively inhibit the expression of the target gene BcPfy1 of Botrytis cinerea, thereby effectively inhibiting the occurrence of tomato gray mold.

[0028] 2. The present invention provides a method for expressing dsRNA of key target genes of plant pathogens using the plant endophyte Beauveria bassiana, which is an effective solution to the problems of high cost of synthesizing dsRNA in vitro, poor stability in the environment, and low delivery efficiency.

[0029] 3. The present invention uses the QSE-F1 strain of Beauveria bassiana as the base strain to construct an engineered strain of Beauveria bassiana Bb-dsPfy1 capable of expressing dsRNA. The engineered strain can effectively inhibit the expression of the target gene of Botrytis cinerea, thereby inhibiting the occurrence of tomato gray mold.

[0030] 4. The biocontrol engineering strain Bb-dsPfy1 provided by the present invention is made into a strain fermentation liquid for use. The preparation method and the use method are simple and convenient, and the effect is significant. It can be used alone or prepared with other materials into a biological agent for preventing and controlling tomato gray mold, and has good market application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 It is the detection of the control effect of dsRNA of the target gene BcPfy1 on tomato gray mold and the silencing effect of the target gene BcPfy1.

[0032] Figure 2 This is a schematic diagram of constructing an expression framework for expressing dsRNA using engineered bacteria.

[0033] Figure 3 is a map of the pDHt-Bar vector.

[0034] Figure 4 It is the PCR test result of the positive transformant of the engineering strain, in which ITS is used as the internal reference gene of the strain.

[0035] Figure 5 The dsRNA expressed by the engineered strain was detected by dot blot experiment.

[0036] Figure 6 The dsRNA expressed by the engineered strain is detected by fluorescence quantitative PCR experiment, wherein BcActin is used as an internal reference gene.

[0037] Figure 7 It is a test of the in vitro control effect of the biocontrol engineering strain Bb-dsPfy1 on tomato gray mold and the silencing effect on the target gene BcPfy1.

[0038] Figure 8 This is a schematic diagram of the detection of the living control effect of the biocontrol engineering strain Bb-dsPfy1 on tomato gray mold and the classification of gray mold incidence levels. DETAILED DESCRIPTION

[0039] The technical scheme of the present invention is further described in detail below in conjunction with the accompanying drawings and specific embodiments. The experimental methods in the following embodiments are conventional methods unless otherwise specified and are not described in detail; for non-conventional experimental operations, the specific steps are described in detail as follows. The experimental materials, drugs, instruments, etc. used in the following embodiments are all commercially available products unless otherwise specified. The quantitative statistics in the following embodiments are all repeated experiments three times and the average value is taken.

[0040] Example 1

[0041] 1. Isolation and screening of QSE-F1 strain

[0042] On October 2, 2022, 5 tomato samples were collected in a greenhouse in Qingdao. A stem of about 1 cm was cut from the main stem of the plant, disinfected with 0.1% sodium hypochlorite for 3 minutes, 70% ethanol for 1 minute, and washed three times with sterile water; then placed in a sterile mortar to grind out the juice, and the juice was diluted with sterile water; 100 μl of the 100-fold and 1000-fold diluted tissue suspensions were taken respectively, and evenly spread on the PDA plate with a spreader (200 g of potato was cut into pieces and boiled in boiling water for 15 minutes, filtered through three layers of gauze, the supernatant was taken, 20 g of glucose, 15 g of agar powder, water was added to 1 L, and autoclaved at 121°C for 20 minutes), and placed in a 28°C incubator for 24-48 hours. Pick a single colony grown on the PDA plate and inoculate it on a new PDA plate to obtain a single colony.

[0043] The purified strain was inoculated into YEPD liquid medium (10g yeast powder, 20g peptone, 20g glucose, add water to 1L, and sterilize at 121℃ for 20min), and cultured at 25℃, 180rpm for 4 days. The culture solution was centrifuged at 12000rpm, and the supernatant was filtered through a 0.45μm sterile filter to obtain a fermentation solution without bacteria. The fermentation solution was mixed with PDA medium and poured onto a plate, and then inoculated with Botrytis cinerea cake, and continued to be cultured in a 25℃ incubator for 2-3 days. The inhibition of Botrytis cinerea hyphae growth was observed, and a strain with a strong inhibitory effect of the fermentation solution on the growth of Botrytis cinerea hyphae was obtained, named QSE-F1.

[0044] 2. Classification and Identification of QSE-F1 Strain

[0045] 1. Morphological identification of strains: The QSE-F1 strain was inoculated on PDA medium and cultured at 28°C. The colonies formed were flat, villi-like, thick in the middle and thin at the edges. The surface of the colonies was milky white at first, and gradually turned light yellow with the increase of culture time. Spores began to be produced after 5-7 days, and the surface of the colonies was milky white powder. QSE-F1 aerial hyphae were picked and observed under a microscope. The hyphae were colorless, transparent and had septa, with a diameter of about 1.73±0.27 μm. Conidia were mostly spherical and oval, with a size of about 1.52±0.17μm - 3.52±0.23 μm.

[0046] 2. Molecular identification: The genomic DNA of QSE-F1 strain was extracted and used as a template for PCR amplification; the PCR reaction system was as follows: 5×TransStart R FastPfu Buffer 10 μl; 10 mM dNTP mix 1 μl; template 2 μl; primer-F (10 μM) 1 μl; primer-R (10 μM) 1 μl; TransStart R FastPfu DNA polymerase 1 μl; ddH2 O 34 μl; Total 50 μl. The PCR reaction procedure was as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s; 58℃ annealing for 30 s; 72℃ extension for 40 s; 72℃ extension for 5 min; 34 cycles; 4℃ hold.

[0047] After the PCR product was run on the gel, the gel was cut and recovered, and the recovered product was sent to a sequencing company for sequencing. The sequences obtained by sequencing were compared with the sequences in the NCBI database. The sequence of the strain to be tested had the highest homology with that of Beauveria bassiana. Based on the sequence alignment of the gene fragments, a phylogenetic tree was constructed. Through comprehensive analysis, strain QSE-F1 was determined to be Beauveria bassiana.

[0048] The Beauveria bassiana QSE-F1 screened by the present invention is deposited in China Center for Type Culture Collection; address: Wuhan University, Wuhan, China; deposit date: July 22, 2024; the deposit number of Beauveria bassiana QSE-F1 is CCTCC NO: M 20241661.

[0049] Example 2: Design, synthesis and effect verification of target gene dsRNA

[0050] 1. Design and synthesis of dsRNA fragments of target gene BcPfy

[0051] The protein coding (CDS) sequence (Bcin01g00370.1) of the gene BcPfy1 was downloaded from the database EnsemblFungi (http: / / fungi.ensembl.org / index.html). The full length of the sequence is 393 bp, and the coding sequence is shown in SEQ ID No. 1. The full length of the sequence is less than 500 bp, so the upstream and downstream amplification primers for synthesizing dsRNA were designed using the full length as a template, and the T7 promoter sequence (TAATACGACTCACTATAGGGAGA) was added to the 5' end of the upstream and downstream primers. The amplification primers are shown in Table 1.

[0052] Total RNA of Botrytis cinerea was extracted and reverse transcribed to obtain cDNA. Using cDNA as a template, a synthetic template of dsRNA was obtained by PCR amplification, agarose gel electrophoresis, and gel recovery. The sequence is shown in SEQ ID No. 2. Using a plasmid containing a gene encoding green fluorescent protein (GFP) as a template, upstream and downstream primers with a T7 promoter sequence added were used to amplify a synthetic template of GFP dsRNA. The sequence is shown in SEQ ID No. 3. The primers used are shown in Table 1. Using a dsRNA in vitro synthesis kit, dsRNAs of BcPfy1 and GFP were synthesized, respectively, and named BcPfy1-dsRNA and GFP-dsRNA, respectively. According to the instructions in the kit, the T7 promoter starts transcription from the first guanine (G) after the core recognition sequence, that is, the sequence of BcPfy1-dsRNA obtained by in vitro transcription is shown in SEQ ID No. 4, and the sequence of GFP-dsRNA is shown in SEQ ID No. 5. The concentration of dsRNA was measured by spectrophotometer, and the purity of dsRNA was detected by agarose gel electrophoresis.

[0053] Table 1 Primers for dsRNA template amplification

[0054]

[0055] BcPfy1 gene (SEQ ID No.1):

[0056] ATGTCGTGGCAGGCTTATATCGACACAAGTCTTTGCGGAAGCGGACATGTTGAGAAGGGAGCTATTTACAATTTGGAGGGAACCTCTTGCTGGGCCACCAGTCCTGATTTTGCGATCACCCCTGAAGAAATGGCTGAGGTCAAAAACGGACTTGATGGTAAAACAGACAGTCTATACGCAAATGGTTTACATATTGCAAAGGATAGATATGTTCTTACAAAGGTGGAGGATGATAATAAGATGCTCTATGCTAGAAAGGGCAAAGATGGTCTCGTCATCGGTAAAACTGTCCAAGCAATCATCGTAGCCCGATACGTCGACCCAATGATCGCCGGAAACACCGCCGAGACTGTTCAAAAATTGGTCGATTATCTCGTTAAAGTTGGCTACTAA

[0057] BcPfy1-dsRNA synthesis template (SEQ ID No.2):

[0058] TAATACGACTCACTATAGGGAGAATGTCGTGGCAGGCTTATATCGACACAAGTCTTTGCGGAAGCGGACATGTTGAGAAGGGAGCTATTTACAATTTGGAGGGAACCTCTTGCTGGGCCACCAGTCCTGATTTTGCGATCACCCCTGAAGAAATGGCTGAGGTCAAAAACGGACTTGATGGTAAAACAGACAGTCTATACGCAAATGGTTTACATATTGCAAAGGATAGATATGTTCTTACAAAGGTGGAGGATGATAATAAGATGCTCTATGCTAGAAAGGGCAAAGATGGTCTCGTCATCGGTAAAACTGTCCAAGCAATCATCGTAGCCCGATACGTCGACCCAATGATCGCCGGAAACACCGCCGAGACTGTTCAAAAATTGGTCGATTATCTCGTTAAAGTTGGCTACTCTCCCTATAGTGAGTCGTATTA

[0059] GFP-dsRNA synthesis template (SEQ ID No.3):

[0060] TAATACGACTCACTATAGGGAGATCGAACTCGATGGTGACGTCAATGGCCATAAGTTCTCAGTCAGCGGAGAGGGTGAGGGAGACGCTACATATGGTAAATTGACTCTTAAGTTCATCTGCACCACAGGTAAATTGCCTGTACCTTGGCCTACACTCGTCACCACCCTCACCTACGGAGTTCAATGCTTTTCCCGTTACCCAGATCACATGAAACAACATGACTTTTTCAAGTCTGCAATGCCAGAGGGATATGTCCAAGAGAGAACAATCTTCTTTAAGGATGACGGAAATTATAAGACTCGTGCCGAGGTTAAGTTCGAGGGTGATACTCTCGTCAACCGTATTGAGTTGAAGGGCATCGATTTCAAGGAAGACGGAAATATCCTCGGCCATAAGCTTGAATACAACTACAACAGTCACAACGTTTATATCATGGCCGACAAGCAAAAAAATGGAATCAAGGTCAACTTCAAAATCAGACACAACATTGAGGATGGCTCTGTTCAATTGGCAGATCACTACCAACAGAATACTCTCCCTATAGTGAGTCGTATTA。

[0061] BcPfy1-dsRNA sequence (SEQ ID No. 4)

[0062] GAGAAUGUCGUGGCAGGCUUAUAUCGACACAAGUCUUUGCGGAAGCGGACAUGUUGAGAAGGGAGCUAUUUACAAUUUGGAGGGAACCUCUUGCUGGGCCACCAGUCCUGAUUUUGCGAUCACCCCUGAAGAAAUGGCUGAGGUCAAAAACGGACUUGAUGGUAAAACAGACAGUCUAUACGCAAAUGGUUUACAUAUUGCAAAGGAUAGAUAUGUUCUUACAAAGGUGGAGGAUGAUAAUAAGAUGCUCUAUGCUAGAAAGGGCAAAGAUGGUCUCGUCAUCGGUAAAACUGUCCAAGCAAUCAUCGUAGCCCGAUACGUCGACCCAAUGAUCGCCGGAAACACCGCCGAGACUGUUCAAAAAUUGGUCGAUUAUCUCGUUAAAGUUGGCUACUCUC

[0063] GFP-dsRNA sequence (SEQ ID No.5)

[0064] GAGAUCGAACUCGAUGGUGACGUCAAUGGCCAUAAGUUCUCAGUCAGCGGAGAGGGUGAGGGAGACGCUACAUAUGGUAAAUUGACUCUUAAGUUCAUCUGCACCACAGGUAAAUUGCCUGUACCUUGGCCUACACUCGUCACCACCCUCACCUACGGAGUUCAAUGCUUUUCCCGUUACCCAGAUCACAUGAAACAACAUGACUUUUUCAAGUCUGCAAUGCCAGAGGGAUAUGUCCAAGAGAGAACAAUCUUCUUUAAGGAUGACGGAAAUUAUAAGACUCGUGCCGAGGUUAAGUUCGAGGGUGAUACUCUCGUCAACCGUAUUGAGUUGAAGGGCAUCGAUUUCAAGGAAGACGGAAAUAUCCUCGGCCAUAAGCUUGAAUACAACUACAACAGUCACAACGUUUAUAUCAUGGCCGACAAGCAAAAAAAUGGAAUCAAGGUCAACUUCAAAAUCAGACACAACAUUGAGGAUGGCUCUGUUCAAUUGGCAGAUCACUACCAACAGAAUACUCUC。

[0065] 2. Verification of the effectiveness of dsRNA in controlling gray mold

[0066] Preparation of conidia suspension of Botrytis cinerea (10 6 cfu), divided into 2 parts, and added BcPfy1-dsRNA and GFP-dsRNA with a final concentration of 200ug / ml respectively. Select 4-week-old tomato seedlings with consistent growth, take 20 leaves and randomly divide them into 2 groups, 10 tomato leaves in each group, and place them on moist filter paper. Pipette spore suspensions containing BcPfy1-dsRNA and GFP-dsRNA respectively, inoculate them on tomato leaves, and add 6ul conidia suspension to each leaf. Keep moist for 60-96h, observe the infection of Botrytis cinerea, measure the diameter of lesions by cross method, and perform statistical analysis on the lesion area on the two groups of leaves. Take leaves of the same size containing lesions, extract total DNA, and detect the biomass of Botrytis cinerea in leaves by fluorescent quantitative PCR. Extract total RNA of Botrytis cinerea on lesions, reverse transcribe to obtain cDNA, and detect the mRNA level of target gene BcPfy1 by fluorescent quantitative PCR.

[0067] The results are as follows Figure 1 As shown, the leaf lesions in the group with added BcPfy1-dsRNA were significantly smaller than those in the group with added GFP-dsRNA; the biomass of Botrytis cinerea on the leaf lesions in the group with added BcPfy1-dsRNA was significantly lower than that in the group with added GFP-dsRNA, indicating that BcPfy1-dsRNA has a significant control effect on gray mold; the addition of BcPfy1-dsRNA resulted in a significant decrease in the mRNA level of the Botrytis cinerea target gene BcPfy1, indicating that BcPfy1-dsRNA can effectively interfere with the expression of the target gene.

[0068] Example 3: Preparation of the engineered strain of Beauveria bassiana Bb-dsPfy1 expressing dsRNA

[0069] 1. Construction of plasmid containing dsRNA expression framework

[0070] The dsRNA coding gene of GFP or BcPfy1 was used as the arm sequence, and the first intron of the endogenous gene BcTubulin (Bcin01g08040) of Botrytis cinerea was used as the central sequence. The central sequence is shown in SEQ ID No. 6. The arm sequence was connected to the two segments of the central sequence in the forward and reverse directions to construct the expression framework of the target gene dsRNA. The specific structure is shown in Figure 2 The dsRNA expression framework sequence of BcPfy1 is shown in SEQ ID No.7, and the dsRNA expression framework sequence of GFP is shown in SEQ ID No.8.

[0071] The BcPfy1-dsRNA expression frame and the GFP-dsRNA expression frame were respectively connected to the multiple cloning site (MCS) of the pDHt-Bar vector containing the constitutive promoter oliC suitable for Beauveria bassiana. The map of the pDHt-Bar vector is shown in Figure 3 The sequence is shown in SEQ ID No. 9. The pDHt-Bar vector contains a herbicide resistance gene (Bar) and can be used as a selection marker to select transformants.

[0072] Central sequence (SEQ ID No.6):

[0073] GTATGTATTCCTCTCTCTTCATTTACGATTTCTACGCCTTCTTGCAAGACGCGTCGACTTTACCCCTGAAAAGCACCCCACTATATATTTTTTAAAAGTAACATATCGCTGACCAAGTAACTTTTCAATCTACAG

[0074] BcPfy1-dsRNA expression framework (SEQ ID No.7):

[0075] ATGTCGTGGCAGGCTTATATCGACACAAGTCTTTGCGGAAGCGGACATGTTGAGAAGGGAGCTATTTACAATTTGGAGGGAACCTCTTGCTGGGCCACCAGTCCTGATTTTGCGATCACCCCTGAAGAAATGGCTGAGGTCAAAAACGGACTTGATGGTAAAACAGACAGTCTATACGCAAATGGTTTACATATTGCAAAGGATAGATATGTTCTTACAAAGGTGGAGGATGATAATAAGATGCTCTATGCTAGAAAGGGCAAAGATGGTCTCGTCATCGGTAAAACTGTCCAAGCAATCATCGTAGCCCGATACGTCGACCCAATGATCGCCGGAAACACCGCCGAGACTGTTCAAAAATTGGTCGATTATCTCGTTAAAGTTGGCTACTAAAAGCTTGTATGTATTCCTCTCTCTTCATTTACGATTTCTACGCCTTCTTGCAAGACGCGTCGACTTTACCCCTGAAAAGCACCCCACTATATATTTTTTAAAAGTAACATATCGCTGACCAAGTAACTTTTCAATCTACAGCTCGAGTTAGTAGCCAACTTTAACGAGATAATCGACCAATTTTTGAACAGTCTCGGCGGTGTTTCCGGCGATCATTGGGTCGACGTATCGGGCTACGATGATTGCTTGGACAGTTTTACCGATGACGAGACCATCTTTGCCCTTTCTAGCATAGAGCATCTTATTATCATCCTCCACCTTTGTAAGAACATATCTATCCTTTGCAATATGTAAACCATTTGCGTATAGACTGTCTGTTTTACCATCAAGTCCGTTTTTGACCTCAGCCATTTCTTCAGGGGTGATCGCAAAATCAGGACTGGTGGCCCAGCAAGAGGTTCCCTCCAAATTGTAAATAGCTCCCTTCTCAACATGTCCGCTTCCGCAAAGACTTGTGTCGATATAAGCCTGCCACGACAT

[0076] GFP-dsRNA expression framework (SEQ ID No.8):

[0077]

[0078] 2. Transformation of Beauveria bassiana QSE-F1 strain with plasmid containing dsRNA expression framework

[0079] The plasmids containing GFP-dsRNA and BcPfy1-dsRNA expression frameworks were respectively transferred into the AGL1 strain of Agrobacterium tumefaciens, and then the dsRNA expression framework was transferred into the QSE-F1 strain of Beauveria bassiana using the ATMT technique. Positive transformants were screened using resistance plates containing the herbicide (Basta). The target gene in the transformant was verified by PCR, and the results were as follows: Figure 4 As shown, bands of the same size as those on the plasmid were detected in different transformants, but no bands were detected in the wild-type QSE-F1 strain, indicating that the dsRNA expression frame was successfully transferred into the chassis strain. The chassis strains containing GFP-dsRNA and BcPfy1-dsRNA expression frames were named engineered bacteria Bb-dsGFP and Bb-dsPfy1 strains, respectively.

[0080] 3. Detection of dsRNA expressed by engineered strain Bb-dsPfy1

[0081] Total RNA of wild-type QSE-F1 strain, Bb-dsGFP strain and Bb-dsPfy1 strain of Beauveria bassiana was extracted respectively, and dsRNA in total RNA was detected by dot blot experiment using dsRNA antibody (J2). The results are shown in Figure 5 As shown in Figure 2, dsRNA can be detected in Bb-dsGFP and Bb-dsPfy1 strains, but not in QSE-F1 strain, indicating that both strains can successfully express dsRNA. Total RNA was reverse transcribed to obtain cDNA, and the target genes GFP and BcPfy1 were detected by fluorescence quantitative PCR. The results are shown in Figure 2. Figure 6 As shown, the Cq values ​​for amplifying GFP in the Bb-dsGFP strain and BcPfy1 in the Bb-dsPfy1 strain were significantly reduced compared with those in the QSE-F1 strain, indicating that the total RNA of the two engineered strains contained RNA of the target gene.

[0082] Example 4: Application of the biocontrol engineering strain Bb-dsPfy1 in controlling gray mold

[0083] 1. In vitro experiment on the control of tomato gray mold by the engineered strain Bb-dsPfy1

[0084] The engineered strains Bb-dsGFP and Bb-dsPfy1 were inoculated into YEPD liquid medium and cultured at 25°C and 180 rpm for 4 days. The culture solution was filtered through 3 layers of clean paper to remove mycelium, and the spores in the filtrate were counted and diluted with clean water to a spore concentration of 106 -10 7 cfu / ml, and a spore suspension of the engineered strain was prepared. The fermentation stock solution needed to be diluted about 2-4 times, that is, the fermentation solution concentration was about 25-50%. 6 cfu) were mixed with equal volumes of spore suspensions of the two engineered strains. Four-week-old tomato seedlings with consistent growth were selected, and 20 leaves were randomly divided into two groups, with 10 tomato leaves in each group, and placed on moist filter paper. According to the method in Example 1, tomato leaves were inoculated, the lesion area was statistically analyzed, the biomass of Botrytis cinerea in the leaves was detected, and the mRNA level of the target gene of Botrytis cinerea was detected. The results are as follows Figure 7 Compared with the addition of Bb-dsGFP spore suspension, the addition of the engineered strain Bb-dsPfy1 spore suspension significantly inhibited the occurrence of gray mold, significantly reduced the biomass of gray mold on the lesions, and significantly reduced the mRNA level of the gray mold target gene BcPfy1.

[0085] 2. Potted experiment of engineering strain Bb-dsPfy1 to control tomato gray mold

[0086] Select 6-8 week old tomato potted plants with consistent growth, spray the engineered strain spore suspension prepared by the above method evenly on the whole plant, and treat 9 plants with each engineered strain spore suspension. Dry naturally for 12 hours, take 6 ul of Botrytis cinerea conidia suspension (10 6 cfu) were dripped onto tomato leaves and placed in a light incubator with a humidity of more than 85% for further cultivation. After 4 days of cultivation, the disease conditions of the two groups of plants were observed and graded according to the severity of the disease on the leaves. The mildest disease was graded as grade I and the most severe disease was graded as grade VI. The grading standards are as follows: Figure 8 shown.

[0087] The classification of diseased leaves of two groups of tomato plants was statistically analyzed. The results are as follows Figure 8 As shown. For plants treated with the spore suspension of the engineered strain Bb-dsPfy1, the leaf disease level was mostly level III (35%), followed by level IV (31%), and level VI diseased leaves accounted for 0, with the top three levels accounting for more than 62%; while for plants treated with the spore suspension of the engineered strain Bb-dsGFP, the leaf disease level was mostly level VI (30%), with the top three levels accounting for only 43%. The results show that the treatment of tomato plants with the engineered strain Bb-dsPfy1 has a significant inhibitory effect on the occurrence of gray mold.

[0088] Based on all the above results, the dsRNA designed with BcPfy1, a key gene of Botrytis cinerea, as the target can effectively inhibit the expression of the target gene, thereby inhibiting the occurrence of gray mold; the prepared engineered strain Bb-dsPfy1 can express the dsRNA of the target gene, and has a significant preventive and control effect on the occurrence of tomato gray mold, and can be used as a biocontrol engineering strain to develop it into a biological agent for the effective prevention and control of tomato gray mold.

[0089] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, it is still possible for a person skilled in the art to modify the technical solutions described in the aforementioned embodiments, or to replace some of the technical features therein by equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions claimed to be protected by the present invention.

Claims

1. Application of the BcPfy1 gene in regulating the pathogenicity of Botrytis cinerea, characterized in that: The coding sequence of the BcPfy1 gene is shown in SEQ ID No.

1. The BcPfy1 gene can inhibit the occurrence of gray mold and reduce the pathogenicity of gray mold.

2. A dsRNA targeting the BcPfy1 gene, characterized in that: The nucleotide sequence of the dsRNA synthetic template is shown as SEQ ID No.2, and the sequence of the dsRNA is shown as SEQ ID No.

4.

3. An engineered strain of Beauveria bassiana Bb-dsPfy1 expressing dsRNA, characterized in that: The engineered strain Bb-dsPfy1 is obtained by transferring a dsRNA expression framework capable of interfering with the expression of the target gene BcPfy1 into Beauveria bassiana. The coding sequence of the target gene BcPfy1 is shown in SEQ ID No.1, and the dsRNA expression framework sequence is shown in SEQ ID No.

7.

4. The engineered strain of Beauveria bassiana Bb-dsPfy1 according to claim 3, characterized in that: The Beauveria bassiana is a QSE-F1 strain, which is deposited in the China Center for Type Culture Collection with a deposit number of CCTCC NO: M 20241661.

5. The engineered strain of Beauveria bassiana Bb-dsPfy1 according to claim 3, characterized in that: The construction method of the engineering strain Bb-dsPfy1 comprises the following steps: (1) Constructing a dsRNA expression framework consisting of arm sequences with the same sequence at both ends and opposite directions and a central sequence in the middle that serves as a connector; (2) connecting the dsRNA expression framework to a plasmid suitable for transfer into Beauveria bassiana to construct a plasmid containing the dsRNA expression framework; (3) The successfully constructed plasmid containing the dsRNA expression framework is transferred into the Agrobacterium tumefaciens strain, and then the dsRNA expression framework is transferred into Beauveria bassiana. Positive transformants are screened using a resistance plate containing herbicide to obtain the engineered bacteria Bb-dsPfy1 strain; the Beauveria bassiana is a QSE-F1 strain, which is deposited in the China Center for Type Culture Collection with a deposit number of CCTCC NO: M 20241661.

6. The engineered strain of Beauveria bassiana Bb-dsPfy1 according to claim 5, characterized in that: The arm sequence is the coding sequence of the target gene BcPfy1, and the sequence is shown in SEQ ID No.1; the central sequence is shown in SEQ ID No.6, and the sequence of the dsRNA expression framework targeting the BcPfy1 gene is shown in SEQ ID No.

7.

7. Use of the dsRNA targeting the BcPfy1 gene according to claim 2 in preventing and controlling gray mold.

8. Use of the engineered strain Bb-dsPfy1 according to claim 3 in preventing and controlling gray mold.

9. The use according to claim 8, characterized in that: The application is to evenly spray the spore suspension of the engineering strain Bb-dsPfy1 on the entire plant.

10. The use according to claim 9, characterized in that: The preparation method of the spore suspension of the engineered strain Bb-dsPfy1 is as follows: the engineered strain is inoculated into a YEPD liquid culture medium and shaken for culture, the culture medium is filtered through filter paper to remove the mycelium, and the spore concentration of the engineered strain Bb-dsPfy1 is obtained to be 10 6 -10 7 cfu / ml of spore suspension.

Images