Pentapeptide, engineering bacterium and application of pentapeptide to improvement of chemotaxis and nonyl phenol degradation capability of microorganisms

Abstract

The invention belongs to the technical field of biology, and relates to a bacterial positive chemotactic substance. The invention provides a pentapeptide, an engineering bacterium and application of the pentapeptide to improvement of chemotaxis and nonyl phenol degradation capacity of microorganisms. The application proves that the nonyl phenol (4-NP) can be used as a positive chemotactic substance of the bacteria, in particular to the Pseudoxantha mexicana bacteria, and the nonyl phenol (4-NP) can be used as a positive chemotactic substance of the bacteria. The application also explores a chemotactic receptor and a chemotactic pentapeptide of the Pseudoxanthomonas mexicana bacterium, proves that the Mcp24 protein with the ID number of WP187572790.1 is the chemotactic receptor of the nonyl phenol (4-NP), and further determines that the L38-A320 of the protein is the binding domain of the chemotactic receptor of the nonyl phenol (4-NP); the engineering bacterium with enhanced chemotactic property is obtained by grafting the pentapeptide DWQEF to the tail end of a 4-NP chemotactic receptor of P.mesicana.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to bacterial positive chemotactic substances. Background Art

[0002] The movement behavior of bacteria that are attracted to certain chemical substances and tend to move toward (positive chemotaxis) or avoid (negative chemotaxis) is called bacterial chemotaxis. Substances that cause bacteria to produce positive chemotaxis are called positive chemotactic substances, and conversely, substances that cause bacteria to produce negative chemotaxis are called negative chemotactic substances. Bacterial chemotaxis can make bacteria migrate toward pollutants, increase their contact and adsorption rates, and thus improve degradation efficiency, which plays an important role in the degradation of pollutants. The bacterial chemotaxis mechanism involves chemotactic receptors receiving external chemoattractant signals and initiating intracellular signal transduction. The bacterial chemotaxis signaling pathway is composed of two types of proteins: transmembrane methyl-accepting chemotaxis receptor proteins (MCPs) and intracellular free chemotactic proteins (Che proteins), including histidine kinase CheA and methyltransferase CheR. MCP is a bacterial chemotactic receptor with a typical structure including a ligand-binding domain (LBD), a transmembrane helix (TM) and an intracytoplasmic signaling domain. Receptors with a transmembrane structure mainly sense extracellular signals.

[0003] Nonylphenol (NP) is a typical endocrine disrupting chemical (EDC) and is listed as one of the 27 priority persistent toxic substances (PTS) by the United Nations Environment Programme (UNEP). The main source of NP in the environment is related to the decomposition or degradation of nonylphenol ethoxylates (NPE), a non-ionic surfactant used in detergents, emulsifiers, solubilizers, cosmetics, textiles, paper and pharmaceutical industries. During the wastewater treatment process in sewage treatment plants, NPE is biodegraded to produce NP, of which about 90% is the 4-NP isomer. NP is known for its stability, lipophilicity and bioaccumulation tendency. The current wastewater treatment process of sewage treatment plants cannot effectively degrade nanoparticles. Once nanoparticles enter the environment, they penetrate the food chain and bioaccumulate in plants and animals. This poses a significant risk to aquatic organisms and humans, and may disrupt the endocrine, immune, nervous and reproductive systems with serious consequences.

[0004] Wastewater treatment plants are the main source of NP release into the environment. Reducing the NP concentration in sludge generated by sewage treatment plants can effectively prevent NP from polluting surrounding rivers, soil and other ecosystems. Various physical and chemical methods have been proposed to remove nanoparticles from the environment and water sources, including membrane filtration, photocatalysis, and chemical or electrochemical advanced oxidation. However, the high cost of these methods limits their widespread application. In contrast, biodegradation provides a cost-effective and environmentally friendly solution to enhance the degradation of organic pollutants in sewage sludge.

[0005] The microbial degradation of NP is mainly achieved by adding NP-degrading bacterial solution. The main NP-degrading bacteria belong to the genera Sphingomonas, Pseudomonas, Mycobacterium and Bacillus, etc. For example, the application with publication number CN116574626A provides a microbial agent for wastewater treatment containing nonylphenol polyoxyethylene ether, which contains Pseudomonas monteri. However, the bacterial degradation of NP in the environment is affected by many factors, such as oxygen content, temperature, organic matter content, etc., resulting in inconsistent degradation efficiency. Under laboratory conditions, in the absence of aeration, the biodegradation rate only reached 65%. These factors lead to insufficient biodegradation to meet the needs of environmental remediation, highlighting the urgent need to improve the stability and efficiency of bacterial NP degradation, which involves the revelation of the mechanism of NP degradation.

[0006] The bacterial degradation process of organic pollutants in the environment usually relies on chemotaxis sensing, which enables bacteria to move toward nutrients, thereby achieving cellular uptake or extracellular enzyme secretion for degradation. However, there is currently no research on the chemotaxis of bacteria to NPs, and how to use this chemotaxis to construct engineered bacteria that can efficiently degrade NPs. Summary of the invention

[0007] In order to solve the above technical problems, the present invention proposes a pentapeptide, an engineered bacterium and the use thereof in improving the chemotaxis of microorganisms and the ability to degrade nonylphenol.

[0008] The technical solution of the present invention is achieved in this way: The present application provides the use of nonylphenol (4-NP) as a bacterial positive chemotactic substance.

[0009] Nonylphenol as Pseudoxanthomonas mexicana (P. mexicana) bacteria positive chemotactic substances.

[0010] The present invention has discovered a new use of nonylphenol through experiments: nonylphenol has positive chemotaxis and degradation effects on bacteria, especially Pseudoxanthomonas mexicana Bacteria, so it can be used as a substance for bacterial chemotaxis and degradation.

[0011] Nonylphenol can be used at various concentrations Pseudoxanthomonas mexicanaThe strain produced a positive chemotactic effect, the optimal concentration of nonylphenol was about 0.05μM, and the chemotactic threshold concentration was 0.0045μM.

[0012] The present application also provides a pentapeptide and a P. mexicana engineered bacterium grafted with the pentapeptide, wherein the amino acid sequence of the pentapeptide is DWQEF.

[0013] The above-mentioned engineered bacteria grafted with pentapeptide are obtained by grafting the pentapeptide onto the end of the nonylphenol chemotactic receptor of the P. mexicana strain.

[0014] The nonylphenol chemotactic receptor is Mcp24 protein, and its ID number is WP_187572790.1.

[0015] The above-mentioned method for constructing the engineered bacteria comprises the following steps: designing and synthesizing the homologous fragment DNA2, constructing a homologous recombination transformation system, and obtaining the engineered bacteria through protoplast transformation.

[0016] The nucleotide sequence of the homologous fragment DNA2 is shown in SEQ ID No.2.

[0017] The steps for constructing the homologous recombination transformation system are: (1) Mixing the sgRNA2 solution and the Cas9 solution and incubating them to obtain an RNP2 complex; the nucleotide sequence of the sgRNA2 is shown in SEQ ID No. 4; (2) Incubate the RNP2 complex with SSB solution to obtain the RNP2+SSB complex; (3) Mixing the RNP2+SSB complex with liposomes and standing at room temperature to obtain the RNP2+SSB non-homologous recombination transformation system; (4) Add the homologous fragment DNA2 to the RNP2+SSB non-homologous recombination transformation system, then add Lipofectamine 3000 and mix, and let stand at room temperature to form the CH-2 homologous recombination transformation system.

[0018] The present invention has the following beneficial effects: 1. This application proves that nonylphenol can be used as a positive chemotactic substance for bacteria, especially Pseudoxanthomonas Mexican The optimal concentration of the bacteria for chemotaxis to nonylphenol is about 0.05μM, and the chemotaxis threshold concentration is 0.0045μM. So far, NP has not been reported as a chemotactic substance for bacteria. This study, based on the determination that NP can be used as a chemotactic substance for bacteria, enhances the chemotaxis of bacteria to NP and thus enhances their degradation rate of NP. This provides a new method to enhance the efficiency of bacteria in degrading pollutants.

[0019] 2. This application also Pseudoxanthomonas mexicanaThe chemotactic receptors and chemotactic pentapeptides of P. mexicana were explored, and it was proved that the Mcp24 protein with ID number WP_187572790.1 is the chemotactic receptor of nonylphenol (NP). The L38-A320 of the protein was further determined to be the binding domain of the nonylphenol (NP) chemotactic receptor; by grafting the pentapeptide DWQEF onto the end of the NP chemotactic receptor of P. mexicana, an engineered bacterium with enhanced chemotaxis was obtained.

[0020] 3. Compared with the original strain, the engineered bacteria grafted with pentapeptides constructed in this application have stronger NP degradation ability, the time required for NP degradation is halved, and the NP degradation rate in 30 days is increased by about 23.5% compared with the CH strain. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0022] Figure 1 Spot-drip chemotaxis assay Pseudoxanthomonas mexicana Plate diagram of the chemotactic response of strains to bacterial chemotactic buffer and nonylphenol (NP).

[0023] Figure 2 Assay for capillary chemotaxis Pseudoxanthomonas mexicana Chemotactic response of strains to different concentrations of nonylphenol (NP).

[0024] Figure 3 Determined for capillary chemotaxis Pseudoxanthomonas mexicana Chemotaxis threshold concentration of strains to nonylphenol (NP).

[0025] Figure 4 The molecular docking results of the chemotactic receptor Mcp24 and 4-NP are shown in Figure 2; (A) is the three-dimensional structure diagram of the molecular docking of Mcp24 and 4-NP, (B) is the hydrophobic force diagram of the docking results, (C) is the two-dimensional structure diagram of the molecular docking of Mcp24 and 4-NP, and (D) is the molecular docking binding free energy diagram of Mcp24 with three NP isomers.

[0026] Figure 5 The diagram shows the results of the DWQEF molecular docking of CheR protein and pentapeptide; (A) is the three-dimensional structure diagram of the docking of CheR protein and pentapeptide molecule, (B) is the hydrophobic force diagram of the docking of CheR protein and pentapeptide molecule, and (C) is the two-dimensional structure diagram of the docking of CheR protein and pentapeptide molecule.

[0027] Figure 6The graphs show the results of the chemotaxis experiment of the three strains to NP; (A) shows the plate chemotaxis results of the three strains, (B) shows the relative proportion of the diameters of the chemotaxis zones formed by the three strains by plate chemotaxis, and (C) shows the results of the capillary chemotaxis calculation of the strongest chemotactic concentrations of the three strains.

[0028] Figure 7 The figure shows the degradation results of NP by three strains. DETAILED DESCRIPTION

[0029] The technical solution of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0030] Unless otherwise specified, the experimental methods used in the following experimental examples are all conventional methods; the materials and reagents used are reagents and materials that can be obtained from commercial channels unless otherwise specified.

[0031] Implementation strain: strain Pseudoxanthomonas mexicana ,belong Pseudoxanthomonas The colony of this strain is round, sticky and moist on the surface, Gram-negative bacteria, short rods, multi-arranged, non-spore, heterotrophic, aerobic, and does not require light. China Center for Type Culture Collection (strain number: CCTCC AB 2021290).

[0032] Culture medium: (1) LB liquid medium: 5 g yeast extract, 10 g tryptone, 10 g NaCl, and 1000 mL deionized water.

[0033] (2) LB solid medium: 5 g yeast extract, 10 g tryptone, 10 g NaCl, 20 g agar, and 1000 mL deionized water.

[0034] (3) Mineral salt medium (MSM): MgSO4·7H2O 0.2 g, CaCl2·2H2O 0.01 g, FeSO4·7H2O0.001 g, Na2HPO4·12H2O 1.5 g, KH2PO41.5 g, ultrapure water 1000 mL, pH 7.0. Sterilize at 121°C for 30 min.

[0035] (4) Glycerol liquid medium: 5 g glycerol (sterilized separately), 11.2 g K2HPO4, 4.8 g KH2PO4, (NH4)2SO4 2.0 g, MgSO4·7H2O 0.25 g, Fe2(SO4) 3 0.5 g, ultrapure water 1000 mL, sterilized at 121℃ for 30 min.

[0036] (5) Bacterial chemotaxis buffer (CMB): K2HPO4 14.03 g, KH2PO4 5.24 g, EDTA 0.0372 g, ultrapure water 1000 mL, pH 7.0. Sterilize at 121°C for 30 min.

[0037] (6) Bacterial chemotaxis medium: K2HPO4 14.03 g, KH2PO4 5.24 g, EDTA 0.0372 g, agarose 2 g, super 1000 mL of pure water, pH 7.0. Sterilize at 121℃ for 30 min.

[0038] (7) 4-Nonylphenol (4-NP), molecular weight 220.35, analytical standard, purchased from Sigma.

[0039] (8) NP stock solution: NP / ether stock solution 250 mg / 50 mL; NP / ethanol stock solution 250 mg / 50 mL.

[0040] (9) NP culture medium: Take a certain amount of NP / ether stock solution and add it to a sterile test tube. After volatilization, inorganic salt culture medium was added to adjust the NP concentration to 50 mg·L -1 , ultrasonically vibrate for 10 to 20 minutes before use.

[0041] (10) NP inorganic salt solid culture: Add 2-4% agar to the inorganic salt medium and sterilize at 121°C for 20 min. When it cools to about 50°C, add a certain amount of NP under sterile conditions to adjust the concentration to 50 mg·L -1 , shake well, pour into the culture dish, pour about 10 mL of culture medium into each dish, wait for it to cool and solidify for later use.

[0042] (11) Cas9 protein, SSB protein, and lysozyme were purchased from New England Biolabs (Ipswich, MA, USA).

[0043] Example 1: Validation of nonylphenol (NP) as a bacterial chemotactic substance 1. Preparation of bacterial cells Stored on LB solid medium at 4°C Pseudoxanthomonas mexicanaThe strain was transferred to LB solid medium plate, cultured at 28℃ for 2 days, single colony was picked and inoculated into 10 ml LB medium, cultured overnight (12h) at 28℃ and 150 rpm, 1 ml bacterial solution was centrifuged at 8000 rpm and 4℃ for 5min, the supernatant was discarded, and the supernatant was washed twice with 1ml sterile ultrapure water, and finally suspended in 1ml ultrapure water. 200 μl was inoculated into 250 ml glycerol salt liquid medium, and cultured at 28℃ and 150rpm until OD 600 About 1.2, 4℃ for plate chemotaxis assay and capillary chemotaxis assay. Before all chemotaxis assays, it is necessary to wash the bacteria with precooled 4℃ bacterial chemotaxis buffer and check under a microscope that the motile cells are more than 90%.

[0044] 2. Spot-drip plate chemotaxis assay (1) Take 500 ml (2 bottles of 250 ml) of the above cultured bacterial suspension and centrifuge at 8000 rpm and 4°C for 5 min. If the bacterial suspension is large, centrifuge it several times and discard the supernatant after centrifugation. (2) Rinse the cells twice with approximately 20 mL of chemotaxis buffer precooled at 4°C. Centrifuge at 8000 rpm and 4°C for 5 min after each rinse and discard the supernatant. (3) Finally, resuspend the cells in 200 mL of bacterial chemotaxis medium containing 0.2% agarose. When resuspending, be careful not to set the temperature too high and adjust the OD 600 About 1.0, pour the plates, add about 15mL of culture medium to each plate, and let it stand for 20min; (4) After the culture medium in the plate solidifies, take out 10 μL of 50 mg·L -1 N was added dropwise in the center of the plate, and bacterial chemotaxis buffer was used as a control. Incubate at 30°C for 4-8 hours; (5) Observe the bacterial chemotactic response, take photos, measure the diameter of the chemotactic zone generated by the chemotactic response, and record it.

[0045] Results Figure 1 Meanwhile, bacterial chemotaxis buffer was used as a control.

[0046] Depend on Figure 1 It can be seen that bacterial chemotaxis buffer cannot cause Pseudoxanthomonas mexicana The chemotactic response of the strains. Nonylphenol solution can Pseudoxanthomonas mexicana strains induce chemotaxis.

[0047] 3. Capillary Chemotaxis Assay (1) Take 20 mL of the cultured bacterial suspension and centrifuge at 8000 rpm for 5 min to collect the bacteria. Wash twice with chemotaxis buffer precooled at 4°C and resuspend to 15 mL. Pipette 300 μl of the bacterial suspension into each well of a 96-well microplate.

[0048] (2) Prepare chemoattractant solutions at concentrations of 0.0001, 0.0005, 0.001, 0.005, 0.01, 0.05, 0.1, 0.5, 1, and 5 μM, respectively, and pipette 100 μl of the solutions into the wells of another 96-well microplate; (3) Use a 3 cm long sterile capillary tube with an inner diameter of about 0.2 mm and a volume of 1 μl to absorb the chemoattractant solution. Absorb the chemoattractant solution into the 1 / 3 position of the capillary tube. Then seal the other end of the capillary tube with a capillary wax plate and use a pipette tip to absorb the chemoattractant buffer solution to rinse the outer wall. (4) Insert the sealed end of the capillary into a 96-well microplate containing 3% agar, then flip the plate over and insert it into the microwells containing the bacterial solution for chemotaxis at room temperature for 2 h. (5) Remove the chemotaxis capillary from the upper plate, rinse the outer wall, remove the sealed end with forming forceps, and pour the contents into a 2 mL centrifuge tube (the rubber tip of the capillary can be used to assist in squeezing out the contents of the capillary); (6) The contents were quenched with chemotaxis buffer for 10 -1 -10 -5 After the dilution gradient, the solid LB plate was coated and the colonies were counted after incubation at 30°C for 36 h; (7) Draw a double logarithmic curve of colony count and chemoattractant concentration. The concentration value corresponding to the intersection of the curve where the colony count suddenly increases and the colony count line in the chemotaxis buffer is the chemotactic threshold concentration value.

[0049] After the chemotactic fluid plate is counted, if the number of bacteria coming out of the capillary in the chemotactic test fluid on the plate is higher than that in the control group, it means that the chemotactic substance has a positive chemotactic effect on the bacteria; otherwise, it has a negative chemotactic effect.

[0050] The above-mentioned spot plate chemotaxis assay can only qualitatively analyze the effect of chemotactic substances on Pseudoxanthomonas Mexican The capillary rule can directly show the chemotactic ability and optimal chemotactic concentration of chemotactic substances, and can calculate the chemotactic threshold concentration. After the chemotactic reaction is completed, the chemotactic curve is drawn by analyzing the bacterial count in the chemotactic test solution on the plate. The results are shown in Figure 2 , calculate the chemotactic threshold concentration, the results are shown in Figure 3 .

[0051] Depend on Figure 2 It can be seen that: Pseudoxanthomonas mexicana can induce chemotaxis for nonylphenol and can also induce chemotaxis for Pseudoxanthomonas mexicana The strain has obvious positive chemotaxis. Different concentrations of DNA solution with positive chemotaxis have Pseudoxanthomonas mexicana The magnitude of chemotaxis varies among strains, and there is an optimal concentration for chemotaxis.

[0052] Nonylphenol can be used at various concentrations Pseudoxanthomonas mexicana The strain produced a positive chemotactic effect, the optimal concentration of nonylphenol was about 0.05μM, and the chemotactic threshold concentration was 0.0045μM.

[0053] Example 2: NP chemotactic receptor terminal pentapeptide grafting and engineering bacteria I. Identification of chemotactic receptors of P. mexicana Through 16SrRNA comparison, the strain P. mexicana is most closely related to Pseudoxanthomonas mexicana AMX 26BT strain. There are 9 chemotactic receptors (MCPs) and 1 CheR annotated in the genome of P. mexicana AMX 26BT, of which 6 chemotactic receptors contain extracellular ligand binding domains (LBDs), targeting 6 chemotactic receptors with ligand binding domains. The LBDs of these 6 receptors were predicted using the Phyre2 server (https: / / www.sbg.bio.ic.ac.uk / phyre2 / html / page.cgi? / id=index). The 3D molecular model of LBD was constructed using the online modeling analysis tool SWISS-MODEL (https: / / swissmodel.expasy.org / ), and they were named LBD853, LBD791, LBD583, LBD789, LBD7890 and LBD338 (Table 1): Table 1. Prediction and modeling of the ligand binding domains (LBDs) of the six chemotactic receptors of P. Mexicana The six models in Table 1 were docked with NP molecules respectively ( Figure 4 A, B, C), among which LBD790 has the lowest binding free energy with the three structures of NP molecules, which is -9.17kacl / mol ( Figure 4 D) The corresponding Mcp24 was identified as the chemotactic receptor of NP.

[0054] 2. Determination of the pentapeptide sequence involved in chemotaxis of P. mexicana The smart online analysis tool (http: / / smart.embl-heidelberg.de / index2.cgi) was used to analyze and align the C-termini of 9 chemokine receptors, and 5 of them were predicted to contain C-terminal pentapeptides (Table 2): Table 2. Comparison of the C-termini of 9 chemokine receptors of P. Mexicana a a The pentapeptide region is underlined There are two pentapeptides with sequences DWQEF and TVELF. The sequence form of DWEQF conforms to the characteristics of the pentapeptide sequence at the end of the bacterial chemotaxis receptor that is involved in mediating the binding with the CheR protein, that is, the XHXXH form (where the X residue usually has a polar or charged side chain, and the H residue has a hydrophobic side chain). It is preliminarily determined that the pentapeptide DWQEF is the pentapeptide that mediates CheR binding during chemotaxis.

[0055] 3. Construction of the engineering strain of P. mexicana with pentapeptide grafted at the terminal of NP chemotactic receptor For the convenience of description, the P. mexicana strain was named CH strain. In order to obtain a strain with enhanced chemotactic response to NP, a mutant strain CH-1 with the Mcp24 chemotactic receptor gene (CHΔMcp24) knocked out and a mutant strain CH-2 with a Mcp24 pentapeptide (DWQEF) grafted to the C-terminus were constructed. The construction method is to synthesize two homologous recombination fragments DNA1 (sequence: last) and DNA2 (sequence: last) by BGI, which contain 100 bp homologous arms upstream and downstream of the target region, and synthesize two sgRNA sequences to guide the Cas9 protein to bind to the target region for DNA cutting, namely sgRNA1 (sequence: CAGGUCAGUGUUCCGCUGGC) and sgRNA2 (sequence: GGGUUUCUUUAGGGUCAGUA). The construction of CH-1 and CH-2 was completed by transforming the protoplasts of the CH strain through the homologous recombination transformation system.

[0056] IV. Construction of homologous recombination transformation system Construction of CH-1 homologous recombination transformation system: Take 4 μL of 1000 ng / μL sgRNA1, incubate with 6 μL Cas9 solution (10 mg / ml) at 37°C for 20 min to obtain RNP1 complex. Add RNP1 complex to 5 μL SSB solution (10 mg / ml), incubate at 37°C for 30 min to obtain 15 μL RNP1+SSB complex. Mix 15 μL of RNP1 complex and RNP1+SSB complex with 20 μL Lipofectamine 3000 respectively, let stand at room temperature for 20 min to form RNP1 transformation system and RNP1+SSB non-homologous recombination transformation system, in which RNP1 transformation system is used as control. Add 110 μL of homologous fragment DNA at 400 ng / μL to 15 μL RNP1+SSB non-homologous recombination transformation system, add 20 μL Lipofectamine 3000 to mix, let stand at room temperature for 20 min to form CH-1 homologous recombination transformation system.

[0057] Construction of CH-2 homologous recombination transformation system: Take 4 μL of 1000 ng / μL sgRNA2, and incubate with 6 μL Cas9 solution (10 mg / ml) at 37°C for 20 min to obtain RNP2 complex. Add 5 μL SSB solution (10 mg / ml) to the RNP2 complex and incubate at 37°C for 30 min to obtain 15 μL RNP2+SSB complex. Mix 15 μL of RNP2 complex and RNP2+SSB complex with 20 μL Liposome 3000 respectively, and let stand at room temperature for 20 min to form RNP2 transformation system and RNP2+SSB non-homologous recombination transformation system, in which RNP2 transformation system is used as control. Add 400 ng / μL homologous fragment DNA 210 μL to 15 μL RNP2+SSB non-homologous recombination transformation system, and then add 20 μL Liposome 3000 to mix, and let stand at room temperature for 20 min to form CH-2 homologous recombination transformation system.

[0058] 5. Protoplast Construction Get a single colony of P. mexicana from LB solid medium, inoculate the single colony into LB liquid medium, and culture at 37℃, 220r / min shaking. Stop the culture when OD600 reaches 1.000. Take the above bacterial solution in a 10mL centrifuge tube, centrifuge at 4℃, 4000rpm for 10min to collect the bacteria, and wash them three times with 5mL SMM buffer. Add 4mL SMM buffer to the collected bacteria and gently shake the suspended bacteria, then add 4mL SMM solution containing 10mg / mL lysozyme, incubate at 37℃ for 0.5-1h, and shake the centrifuge tube gently every 15min. Filter the bacterial solution treated with lysozyme through a homemade cotton sieve (the cotton sieve is made by plugging a needle with sterile cotton), and gently press the cotton in the needle to collect the bacterial solution to the greatest extent. Place the filtered bacterial solution in a 10mL centrifuge tube and centrifuge at 4000 rpm for 10min. Discard the supernatant, add 5-10 mL SMM buffer to wash twice, add an appropriate amount of SMM buffer to suspend the cells, and adjust the protoplast concentration to 1×10 7 to 1×10 8 pcs / mL and used immediately for transformation.

[0059] 6. Protoplast Transformation The CH-1 homologous recombination transformation system and the CH-2 homologous recombination transformation system in the fourth part were mixed with 50 μL of protoplasts prepared in the fifth part at 4°C for 20 minutes, and 500 μL of hypertonic regeneration medium was added and mixed evenly. The culture was shaken at 37°C and 100 r / min for 30 minutes to obtain mutant strains CH-1 and CH-2, respectively. 100-200 μL of bacterial culture fluid of mutant strains CH-1 and CH-2 were spread on the surface of hypertonic regeneration medium, and incubated at 37°C for 12 hours. The obtained strains were subjected to plate chemotaxis and capillary chemotaxis experiments. The CH-1 strain had a significantly reduced chemotaxis ability to NP, while the CH-2 strain had a stronger chemotaxis ability to NP and produced a larger chemotaxis zone ( Figure 6 ), indicating that the chemotaxis of the strain to NP can be enhanced after grafting of pentapeptide.

[0060] VII. Experiment on degradation of P. Mexicana NP by engineering bacteria grafted with pentapeptide at the end of chemotactic receptor The biodegradation of 4-nonylphenol (4-NP) solution was carried out by inoculating CH, CH-1 and CH-2 strains, and the experiment was repeated three times. The biodegradation of 4-NP solution was carried out in glass centrifuge tubes, in which 300 μl of 100 mg / l 4-NP solution prepared in methanol was added and evaporated in a fume hood for 24 h, and then 10 ml of mineral salt solution (MSM) was added and mixed with 10 ml of CH, CH-1 and CH-2 strains at a strain concentration of 10 8 CFU / mL.

[0061] The glass centrifuge tubes were incubated on a temperature-controlled rotary shaker at 150 rpm and 30 degrees C. The glass tubes were opened periodically to ensure adequate oxygen supply, and an uninoculated sterile control group was set up.

[0062] The concentration of 4-NP was determined by a high-performance liquid chromatography (HPLC) analyzer coupled to a fluorescence detector (Shimadzu RF-10APXL) using a C-18 column (4 mm diameter, 150 mm length) and acetonitrile:water (90:10) as the mobile phase with excitation and emission wavelengths of 222 nm and 305 nm, respectively, with a limit of quantification of 10 μg / L.

[0063] The CH-1 strain, which lost the Mcp24 chemotactic receptor, had a significantly lower ability to degrade 4-NP than the CH strain. The degradation rate of 4-NP in 30 days was about 30.6% lower than that of the CH strain on average. The CH-2 strain, which had added the Mcp24 C-terminal pentapeptide, had a stronger ability to degrade 4-NP than the CH strain. The time required to degrade 4-NP was halved, and the degradation rate of 4-NP in 30 days was about 23.5% higher than that of the CH strain ( Figure 7 ). This indicates that the efficiency of 4-NP degradation can be increased by enhancing chemotaxis after grafting pentapeptide.

[0064] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. Application of nonylphenol as a positive chemotactic substance for bacteria.

2. The use of nonylphenol as a bacterial positive chemotactic substance according to claim 1, characterized in that: The bacteria is of the genus P. mexicana.

3. Application of pentapeptide and engineered bacteria grafted with pentapeptide in improving microbial chemotaxis and nonylphenol degradation ability, characterized by: The amino acid sequence of the pentapeptide is DWQEF.

4. The use of the pentapeptide and the engineered bacteria grafted with the pentapeptide according to claim 3 in improving the chemotaxis of microorganisms and the ability to degrade nonylphenol, characterized in that: The microorganism is of the genus P. mexicana.

5. A P. mexicana engineered bacterium grafted with a pentapeptide, characterized in that: The amino acid sequence of the pentapeptide is DWQEF.

6. The pentapeptide-grafted engineered bacteria according to claim 5, characterized in that: It was obtained by grafting a pentapeptide onto the end of the nonylphenol chemotactic receptor of the P. mexicana strain.

7. The engineered bacteria grafted with pentapeptides according to claim 6, characterized in that: The nonylphenol chemotactic receptor is Mcp24 protein, and its ID number is WP_187572790.

1.

8. The method for constructing an engineered bacterium according to any one of claims 5 to 7, characterized in that: The steps are: designing and synthesizing homologous fragment DNA2, constructing a homologous recombination transformation system, and obtaining an engineered bacterium through protoplast transformation.

9. The method for constructing an engineering bacterium according to claim 8, characterized in that: The nucleotide sequence of the homologous fragment DNA2 is shown as SEQ ID No.

2.

10. The method for constructing an engineering bacterium according to claim 8, characterized in that: The steps for constructing the homologous recombination transformation system are: (1) Mixing the sgRNA2 solution and the Cas9 solution and incubating them to obtain an RNP2 complex; the nucleotide sequence of the sgRNA2 is shown in SEQ ID No. 4; (2) Incubate the RNP2 complex with SSB solution to obtain the RNP2+SSB complex; (3) Mixing the RNP2+SSB complex with liposomes and standing at room temperature to obtain the RNP2+SSB non-homologous recombination transformation system; (4) Add the homologous fragment DNA2 to the RNP2+SSB non-homologous recombination transformation system, then add Lipofectamine 3000 and mix, and let stand at room temperature to form the CH-2 homologous recombination transformation system.

Images