Application of cucumber CsNPF1 gene in regulating parthenocarpy and fruit bitterness

By knocking out or editing the cucumber CsNPF1 gene, parthenocarpy and fruit bitterness can be regulated, auxin synthesis can be promoted, and bitterness synthesis can be inhibited, thus solving the problems of parthenocarpy and fruit bitterness and achieving the breeding goal of high-yield, low-bitter cucumbers.

CN119506305BActive Publication Date: 2026-03-24CHINA AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411772087.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-04
Publication Date
2026-03-24
Estimated Expiration
2044-12-04

AI Technical Summary

Technical Problem

Existing technologies have limited means of controlling parthenocarpy and fruit bitterness, which limits crop yield and fruit quality. In particular, under conditions of climate change and reduced insect populations, it is difficult to improve the yield and fruit quality of crops such as cucumbers.

Method used

By knocking out or editing the CsNPF1 gene in cucumbers, its function in cucumbers can be lost, promoting parthenocarpy and inhibiting bitterness in the fruit. The protein encoded by the CsNPF1 gene can directly bind to the CsYUC4 promoter sequence to regulate auxin synthesis, promote parthenocarpy fruit formation, and bind to the Bt promoter sequence to inhibit bitterness synthesis.

Benefits of technology

This study significantly improves the parthenocarpy rate and fruit quality of cucumbers, reduces the bitter content of fruits, promotes the development of new cucumber varieties with high yield and low bitterness, and provides a theoretical basis for breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119506305B_ABST
    Figure CN119506305B_ABST
Patent Text Reader

Abstract

The application provides application of a cucumber CsNPF1 gene in regulation of parthenocarpy and fruit bitterness, research finds that the content of auxin in the fruit of a CsNPF1 gene knockout mutant cucumber is significantly lower than that of a wild type, and it is further proved that CsNPF1 promotes the synthesis of auxin in ovules and the formation of parthenocarpic fruits by directly combining with the CsYUC4 promoter sequence and activating the expression thereof; meanwhile, the content of cucurbitacin CuC in the fruit of the mutant cucumber is significantly higher than that of the corresponding wild type, and the expression of a key gene Bitterfruit (Bt) for controlling the CuC content of the cucumber fruit is significantly up-regulated, indicating that CsNPF1 reduces the bitterness of the fruit and improves the quality of the fruit by directly combining with the Bt promoter sequence and inhibiting the expression thereof. The application is conducive to developing a new cucumber variety with high yield and low bitterness of fruit, provides a new direction and important theoretical basis and practical guidance for cucumber molecular breeding, and has a good agricultural application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to the application of the cucumber CsNPF1 gene in regulating parthenocarpy and fruit bitterness. Background Technology

[0002] Plant flowering and fruiting typically depend on pollination and fertilization. However, under natural conditions, some plants can bear fruit without pollination and fertilization, or, under certain stimuli (such as auxins), unfertilized ovaries can form fruits. This phenomenon is called parthenocarpy. Parthenocarpy, due to its ability to produce seedless fruits without pollination, significantly improves the edibility and quality of fruits, thus becoming an important agronomic trait in crop breeding.

[0003] Parthenocarpy can be divided into natural parthenocarpy and induced parthenocarpy, depending on whether external stimulation is required. Natural parthenocarpy can be further subdivided into two forms: obligate parthenocarpy and facultative parthenocarpy. Obligate parthenocarpy refers to a trait determined solely by genetics, unaffected by environmental factors, consistently producing seedless fruit. Facultative parthenocarpy, on the other hand, is influenced by both genetics and environment, only producing seedless fruit when pollination and fertilization are hindered (e.g., in cucumbers). In recent years, due to natural and anthropogenic factors such as climate change and habitat destruction, the number of insects acting as pollinators in nature has significantly decreased, leading to a severe decline in crop yields. Therefore, developing varieties with excellent parthenocarpy ability can significantly increase yields and ensure fruit quality. Strong parthenocarpy varieties can not only effectively prevent flower and fruit drop caused by adverse environmental conditions but also significantly improve fruit set rate and yield. However, current research and application of genes related to parthenocarpy remain relatively limited. Therefore, using molecular biology techniques to discover key genes that regulate parthenocarpy, deeply analyze their mechanisms of action in regulating parthenocarpy, and improve the parthenocarpy rate of germplasm resources has become a core approach in breeding.

[0004] Bitterness is generally considered an undesirable taste, affecting consumers' acceptance of food. For some crops whose economic value lies in their fruit (such as cucumbers), the accumulation of bitterness in the fruit due to genetic factors or poor cultivation management can severely impact economic benefits. Therefore, identifying key genes involved in cucumber bitterness synthesis is of great significance for regulating fruit bitterness and improving fruit quality. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to address the shortcomings of the prior art by providing an application of the cucumber CsNPF1 gene in regulating parthenocarpy and fruit bitterness. The CsNPF1 gene can not only promote parthenocarpy in cucumbers, but also inhibit fruit bitterness.

[0006] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is as follows:

[0007] A cucumber CsNPF1 gene, the nucleotide sequence of which is shown in SEQ ID NO.1, and the amino acid sequence of the protein encoded by the CsNPF1 gene, which is shown in SEQ ID NO.2.

[0008] The present invention also provides an application of the CsNPF1 gene in regulating parthenocarpy and bitterness of cucumber.

[0009] This invention, by adopting the above technical solutions, has significant technical effects:

[0010] 1. This invention provides a cucumber gene CsNPF1. Studies have found that the auxin content in cucumber fruits from CsNPF1 gene knockout mutants is significantly lower than that in wild-type cucumbers. Furthermore, it has been demonstrated that CsNPF1 promotes auxin synthesis in ovules and the formation of parthenocarpic fruits by directly binding to and activating the CsYUC4 promoter sequence. At the same time, the content of bitter glycoside CuC in mutant cucumber fruits is significantly higher than that in the corresponding wild-type cucumbers, and the expression of Bitterfruit (Bt), a key gene controlling CuC content in cucumber fruits, is significantly upregulated. This indicates that CsNPF1 reduces fruit bitterness and improves fruit quality by directly binding to and inhibiting the Bt promoter sequence.

[0011] 2. This invention is conducive to promoting the development of new cucumber varieties with high yield and low bitterness, providing a new direction and important theoretical basis and practical guidance for cucumber molecular breeding, and has good prospects for agricultural application.

[0012] The present invention will now be described in further detail with reference to the accompanying drawings and embodiments. Attached Figure Description

[0013] Figure 1 This is a comparison of the phenotypes of wild-type 10Y and mutant npf1 in Example 1, and the results of the expression level determination of gene CsNPF1 in the fruits of wild-type 10Y and mutant npf1.

[0014] Figure 2 This is the result of the phylogenetic analysis of the cucumber CsNPF1 gene in Example 1;

[0015] Figure 3 It is the gene knockout plant npf1 in Example 2 CR1and npf1 CR2 Fruit phenotypic analysis;

[0016] Figure 4 It is the gene knockout plant npf1 in Example 2 CR1 and npf1 CR2 Phenotypic analysis of ovules;

[0017] Figure 5 This is an analysis of the effect of CsNPF1 on auxin content in Example 3;

[0018] Figure 6 In Example 3, CsNPF1 directly binds to the promoter of the auxin synthesis gene CsYUC4 to regulate auxin synthesis;

[0019] Figure 7 In Example 4, CsNPF1 directly binds to the Bt promoter of the fruit bitterness-related gene to regulate the synthesis of bitter substances. Detailed Implementation

[0020] Example 1

[0021] This embodiment describes the acquisition and identification of CsNPF1 in cucumber.

[0022] A spontaneously occurring non-parthenocarpic fruit mutant was screened from the 10Y inbred line of cucumber. Because it lacks the ability to produce parthenocarpic fruits, it was named non-parthenocarpicfruit 1 (npf1). To identify the genetic factors controlling the phenotypic variation of the npf1 mutant, segregating populations were constructed by crossing the npf1 mutant with wild-type lines 1-5 (relatively distantly related to the 10Y line). Phenotypic investigation showed that the F1 plants exhibited parthenocarpic fruiting and female fertility. In the F2 segregating population (116 individual plants), 86 plants were identical to the wild type, exhibiting parthenocarpic fruiting, while the remaining 30 plants exhibited non-parthenocarpic fruiting. Genomic DNA was extracted from the mutant cucumber, and a candidate gene was obtained through genome resequencing and KASP localization analysis.

[0023] Total RNA was extracted from mutant cucumbers and reverse transcribed into cDNA. Using information from the Cucurbitaceae genome database, sequencing primers for candidate genes were designed, and the cDNA was amplified by PCR.

[0024] The forward primer (F) sequence is: ATGGGGTGCGACGCTTTC.

[0025] The reverse primer (R) sequence is: TCAAGAGGGTCTCATAAGACAATGA;

[0026] The amplification reaction system was 20 μL: 10 μL 2×PrimeSTAR, 2 μL cDNA, 1 μL F, 1 μL R, and 6 μL H2O; the reaction conditions were: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 30 sec, 58℃ annealing for 30 sec, 72℃ extension for 2 min, for 30 cycles.

[0027] Sequencing analysis of the amplified candidate gene revealed that its open reading frame (ORF) is 1614 bp in length, consisting of 10 exons and 9 introns. This candidate gene was named CsNPF1. The nucleotide sequence of the CsNPF1 gene is shown in SEQ ID NO.1, and the amino acid sequence of the encoded protein is shown in SEQ ID NO.2.

[0028] The expression levels of the CsNPF1 gene in wild-type 10Y and mutant npf1 were analyzed by quantitative real-time PCR. The forward primer (F) sequence was GAACGATTGGCCTGATGTAA, and the reverse primer (R) sequence was ACTTCGGCTTCCTCTTCT. The amplification reaction system was 10 μL: 5 μL 2×ChamQ Universal SYBR qPCR Master Mix, 1 μL cDNA, 0.2 μL F, 0.2 μL R, and 3.6 μL H2O. The reaction conditions were: 95℃ pre-denaturation for 30 sec, 95℃ denaturation for 5 sec, 60℃ extension for 30 sec, for 40 cycles. Figure 1 a is a phenotypic comparison between wild-type 10Y and the mutant npf1. Figure 1 b represents the expression level of gene CsNPF1 in wild-type 10Y and mutant npf1 (-2DAA indicates 2 days before flowering, 3DAA indicates 3 days after flowering), indicating that the expression of CsNPF1 is severely suppressed in the non-asexual mutant.

[0029] Conserved domain analysis using the NCBI Conserved Domain Database (CCD) revealed that the protein encoded by the CsNPF1 gene belongs to the AP2 subfamily and contains two plant-specific AP2 / ERF conserved domains. Figure 2 BLASTP alignment analysis was performed on the amino acid sequence of the CsNPF1 protein, and a phylogenetic tree was constructed using amino acid sequences with high sequence similarity containing two AP2 functional domains. The results showed that the nucleotide sequence of the CsNPF1 protein is highly similar to that of the Arabidopsis APETALA2 (AP2) protein. In conclusion, it can be inferred that the CsNPF1 gene encodes a transcription factor containing two AP2 functional domains.

[0030] Example 2

[0031] This example is a verification of the genetic transformation of the CsNPF1 gene.

[0032] To verify the biological function of the CsNPF1 gene in regulating parthenocarpy, the transgenic variety Cu2, which exhibits high transformation efficiency and parthenocarpy, was selected for transgenic function verification. The method is as follows:

[0033] 1. Construction of CsNPF1 gene editing CRISPR / Cas9 vector

[0034] The CsNPF1 gene sequence was analyzed for targets using the CRISPR-GE website (http: / / skl.scau.edu.cn / ), and two targets (SgRNA1: CGCCTTCCCTCGGGCTCACT and SgRNA2: AGAAAGTGACGCCGCGGTAC) were selected. The sgRNA expression cassette fragment was amplified using the pCBC-DT1T2 vector as a template with the target primers (CsNPF1 DT1BsF: AATATATGGTCTCGATTGGCCTTCCCTCGGGCTCACTGTT, CsNPF1DT2 BsR: ATTATTGGTCTCGAAACGTACCGCGGCGTCACTTTCCAA, CsNPF1 DT1 F0: TG GCCTTCCCTCGGGCTCACTGTTTTAGAGCTAGAAATAGC, CsNPF1DT2 R0: AACGTACCGCGGCGTCACTTTCCAATCTCTTAGTCGACTCTAC). The sgRNA expression cassette was assembled into the CRISPR / Cas9 vector pKSE402 using an enzyme digestion-ligation reaction to obtain the gene editing vector CsNPF1-pKSE402.

[0035] 2. Agrobacterium-competent transformation

[0036] (1) Take Agrobacterium competent cells EHA105 stored at -80℃, thaw them on ice, add 2μg of CsNPF1-pKSE402 plasmid, gently aspirate and mix well, and incubate on ice for 30min. Quick freeze in liquid nitrogen for 2min.

[0037] (2) Heat shock at 37℃ for 5 minutes, then let stand on ice for 5 minutes.

[0038] (3) Add 600 μL of LB liquid (without antibiotics) and incubate at 28°C with shaking at 200 rpm for 3 h.

[0039] (4) Centrifuge at 6000 rpm for 5 min, remove part of the supernatant, leave about 100 μL, resuspend and spread evenly on LB solid medium (containing 50 mg / mL kanamycin sulfate and 50 mg / mL rifampin), and incubate upside down in an incubator at 28℃ for 2 to 3 days.

[0040] (5) Pick a single clone and place it in LB liquid medium containing 1 mL of the corresponding antibiotic. Incubate overnight at 28°C and 200 rpm on a shaker until the bacterial culture becomes turbid.

[0041] 3. Agrobacterium-mediated infection of cucumber cotyledons

[0042] (1) Take plump wild-type cucumber Cu2 seeds, soak them in water for a period of time, and then peel off the outer skin with small tweezers. Disinfect the peeled seeds in a clean bench with 75% alcohol for 30 seconds, then disinfect with 3% sodium hypochlorite solution for 10 minutes, and finally wash them with sterile water 5-6 times. Dry them on filter paper, sow them on MS solid medium, and incubate them at 28°C in the dark for 1 day.

[0043] (2) When the hypocotyl is about 1 cm long, use tweezers and a knife to cut off the lower half of the hypocotyl and cotyledons on sterile filter paper. Immediately place the upper half of the cotyledons with a U-shaped opening into the suspension (MS liquid medium containing 200 μM AS, 1.25 mM MES, 2 mg / mL 6-BA and 1 mg / mL ABA). Collect the Agrobacterium cells containing the target vector that have been shaken and cultured overnight the previous day, resuspend the cells in the suspension, and measure their OD. 600 Adjust the concentration to 0.2-0.3 as the inoculum solution;

[0044] (3) Place the cut cotyledons into the inoculum solution, vacuum 10 mL of bacterial suspension containing cotyledons for 90 s using a 20 mL sterile syringe, repeat once, and air dry on filter paper. Then place the dried cotyledons on a co-culture medium (MS solid medium containing 200 μM AS, 1.25 mM MES, 2 mg / mL 6-BA and 1 mg / mL ABA) with a layer of filter paper on the surface, and incubate at 28°C in the dark for 4 days;

[0045] (4) Transfer the cotyledons cultured in the previous step to resistance differentiation medium (MS solid medium containing 2 mg / mL 6-BA, 1 mg / mL ABA and 200 mg / L termethin) and culture in a tissue culture room for about 4 weeks. The cotyledons will differentiate into resistant shoots. Cut off the shoots and place them in rooting medium to continue culturing until roots form. The conditions in the tissue culture room are: 25℃, 12h light / 12h dark.

[0046] (5) Remove the cucumber seedlings with well-developed root systems from the culture medium and transfer them to small pots filled with nutrient soil and vermiculite. Cover the small pots with a resealable bag to prevent the cucumber seedlings from losing water and wilting. Allow them to acclimate under low light for one week. After they have recovered, remove the resealable bag and transplant them into a greenhouse after 2-3 weeks of growth.

[0047] 4. Identification of transgenic plants

[0048] Transgenic T0 generation plants were self-pollinated or crossed with wild-type Cu2 plants to obtain the T1 generation. The ratio of GFP-fluorescent seeds to non-fluorescent seeds in the T1 generation was observed under a stereofluorescence microscope to determine whether it conformed to a 3:1 (self-pollution) or 1:1 (self-pollution) ratio. Non-fluorescent seeds were selected for germination and sowing. Genomic DNA was extracted from leaves, and the target fragment was amplified using primers flanking SgRNA. PCR products were then sequenced to analyze for mutations. If a heterozygous mutation was found, the individual plant was self-pollinated to obtain the T2 generation. Homozygous mutant plants were then screened from the T2 generation. Two stable gene knockout lines (npf1) were identified through GFP analysis and PCR sequencing. CR1 and npf1 CR2 ).

[0049] Figure 3 It is a gene knockout plant npf1 CR1 and npf1 CR2 Fruit phenotypic analysis, where a is npf1 CR1 and npf1 CR2 There are two mutation types. The purple-red underline indicates the prespacer adjacent motif (PAM) sequence, and the purple-red box indicates the SgRNA sequence. '+' indicates nucleotide insertion, and '-' indicates nucleotide deletion. b is npf1. CR1 and npf1 CR2 Genotyping identification: the red box indicates the AP2 domain, the asterisk indicates the position of the stop codon, and the numbers indicate the position of the amino acid; c and d are wild-type Cu2 and npf1. CR1 and npf1 CR2 The phenotypic diagram shows that white arrows indicate parthenocarpic fruits, DAA indicates the number of days after flowering, and the scale bar is 5 cm; e represents wild-type Cu2 and npf1. CR1 and npf1 CR2 The parthenocarpy rate; fh are wild-type Cu2 and npf1 respectively. CR1 and npf1 CR2 The length, width, and weight of parthenocarpic fruits were measured (numerical values ​​are presented as mean ± standard deviation, two-tailed t-test). The results showed that npf1 CR1 The strain had deletions of 14bp and 33bp at the first and second target sites, respectively, while npf1 CR2The strain showed a 1 bp insertion and a 129 bp deletion between the two target sites. Figure 3 a). Both mutation types result in the CsNPF1 gene being translated into a truncated protein lacking two AP2 domains (149 and 177 amino acids, respectively). Figure 3 b). npf1 CR1 and npf1 CR2 The plant is morphologically similar to the wild-type Cu2. Figure 3 c), but showed significant differences in parthenocarpy ( Figure 3 (de). Wild-type Cu2 fruits, without pollination, showed significant increases in length, width, and weight from 2 days before flowering (-2DAA) to 9 days after flowering (9DAA), compared to the gene knockout mutant npf1. CR1 and npf1 CR2 The fruit growth stops after reaching 0DAA, leading to fruit drop (…). Figure 3 fh).

[0050] Figure 4 It is the gene knockout plant npf1 CR1 and npf1 CR2 Phenotypic analysis of ovules, where a represents wild-type Cu2 and npf1. CR1 and npf1 CR2 Freehand sections (top) and paraffin sections (bottom) of the fruit cross-section on the day of flowering. Blue dotted lines represent ovules; DAA indicates the number of days after flowering; ov represents ovule; in represents integument; nu represents nucellus; fu represents funiculum; dov represents abnormal ovules. The scale bar is 1 mm. b and c show TTC staining results for wild-type Cu2 and npf1, respectively. CR1 and npf1 CR2 Pollen viability and pollen tube elongation capacity were measured, with a scale bar of 100 μm. In Figure b, red represents high pollen viability, light red represents relatively high pollen viability, and colorless represents inactive pollen. Figure d shows wild-type Cu2 and npf1. CR1 Fruits after cross-pollination or self-pollination, scale bar 5cm; e is a longitudinal section of the fruit 40 days after pollination, the red dotted line represents the seeds, scale bar 5cm. The results indicate that, similar to the mutant npf1, the gene knockout mutant npf1... CR1 and npf1 CR2 ovule developmental abnormalities ( Figure 4 a), but pollen viability and pollen tube elongation were both normal. Figure 4 b,c). In addition, npf1 CR1 The fruit showed some enlargement and growth after artificial pollination, but no seeds were formed. Figure 4 d,e). Therefore, the gene knockout mutant npf1 CR1 and npf1CR2 All phenotypes (non-parthenocarpy and female sterility) were completely consistent with the mutant npf1, indicating that CsNPF1 is the target gene that causes the mutant npf1 phenotype.

[0051] Example 3

[0052] This example demonstrates the application of the CsNPF1 gene in regulating parthenocarpy in cucumber.

[0053] To further explore the molecular network of CsNPF1 gene regulation of parthenocarpy, the whole-genome expression profiles of wild-type 10Y and mutant npf1 fruits were analyzed using RNA-seq technology. A total of 214 differentially expressed genes were detected, including 140 upregulated genes and 74 downregulated genes (fold change ≥ 2, FDR < 0.05). Further KEGG analysis of these differentially expressed genes showed a high enrichment of plant hormone pathways, suggesting that the CsNPF1 gene may regulate parthenocarpy through plant hormone pathways. Ultra-high performance liquid chromatography-tandem mass spectrometry was used to analyze the expression profiles of wild-type 10Y, mutant npf1, wild-type Cu2, and gene knockout mutant npf1. CR1 The method for determining the auxin content of fruits is as follows:

[0054] (1) Two days after flowering, the fruits of wild-type and mutant plants were ground into powder in liquid nitrogen and placed in 2mL centrifuge tubes. The sample weight was approximately 50mg, and the specific value was recorded.

[0055] (2) Add 50 μL of internal standard working solution and 500 μL of extraction solution (isopropanol: water: hydrochloric acid = 2:1:0.002) to each sample, vortex rapidly for 10 s, and shake at 9000 rpm for 30 min at 4℃.

[0056] (3) Add 1 mL of chloroform, vortex for 10 s, and shake at 4℃ and 9000 rpm for 30 min;

[0057] (4) Centrifuge at 4℃ and 14000rpm for 5min to form two phases;

[0058] (5) Transfer 1.2 mL of the lower layer liquid into a new 1.5 mL centrifuge tube and dry it with nitrogen at room temperature;

[0059] (6) Add 100 μL of methanol to reconstitute, shake at 9000 rpm for 10 min at 4℃, and then centrifuge at 14000 rpm for 5 min;

[0060] (7) Use a 1mL syringe to draw up the supernatant and carefully filter it into a sample vial using a 0.22μm filter membrane, and then perform the analysis.

[0061] Figure 5This analysis examines the impact of CsNPF1 on auxin content. Specifically, (a) is a KEGG pathway enrichment analysis of differentially expressed genes in the transcriptomes of wild-type 10Y and mutant npf1 fruits; (b) is a KEGG pathway enrichment analysis of differentially expressed genes in wild-type 10Y, mutant npf1, wild-type Cu2, and gene knockout mutant npf1. CR1 The auxin content of the fruit; c is the stigma of the fruit of mutant npf1 sprayed with 200 μM naphthaleneacetic acid on the day of flowering, treated once every 3 days, for 3 treatments, with water as a control, scale bar is 1 cm; d is the statistical analysis of the length and width of mutant npf1 fruit after NAA treatment (numerical values ​​are shown as mean ± standard deviation, two-tailed t test). The results showed that the auxin content in the mutant was significantly lower than that in the wild type. Figure 5 b). Furthermore, spraying the stigma of the mutant npf1 fruit with a 200 μM concentration of auxin (naphthaleneacetic acid, NAA) can induce fruit enlargement. Figure 5 (c and d). These results suggest that CsNPF1 likely regulates parthenocarpy by influencing auxin levels.

[0062] Considering that CsNPF1 is a typical transcription factor, it may affect auxin content and parthenocarpy by directly regulating auxin-related target genes. Therefore, DNA affinity purification sequencing (DAP-seq) technology was used to screen for potential auxin-related target genes. The CDS sequence of CsNPF1 was amplified using PCR, and the SP6 promoter and Kozak sequence were added to its 5' end. Subsequently, the sequence was ligated into an expression vector with a 3×FLAG tag using an enzyme digestion and ligation method, successfully constructing the CsNPF1-FLAG plasmid. Using this plasmid, the CsNPF1-3×FLAG protein was generated according to the TNT SP6 high-yield wheat germ protein expression system (Promega L3260). 6 μg of plasmid was used in each reaction, with a reaction volume of 50 μL, and incubation at 25°C for 2 h. Then, 20 μL of anti-FLAG magnetic beads (M8823, Merck Millipore) were added to the reaction system, followed by incubation for 1 h for specific binding. Anti-FLAG magnetic beads were collected and washed three times to remove non-specific binders. Genomic DNA from wild-type cucumber 10Y fruits was treated with ultrasound, and a DNA library was constructed using the VAHTS Universal DNA Library Prep Kit for Illumina V3 (ND607, Vazyme). Anti-FLAG magnetic beads containing CsNPF1-FLAG protein were incubated with 50 ng of the DNA library. After incubation, DNA bound to the magnetic beads was extracted by affinity purification and the phenol-chloroform method. Finally, the extracted DNA fragments were amplified by PCR, purified, and quantified, and then sequenced using a DNBSEQ-T7 sequencer. Figure 6a represents the distribution of the CsNPF1 binding region in the cucumber genome as determined by DAP-seq analysis, with TSS representing the transcription start site. DAP-seq data analysis showed that the CsNPF1 binding motif is TTTGTT, which is very similar to the binding sites of the AP2 transcription factor reported in previous studies in Arabidopsis thaliana and Antirrhinum majus. Figure 6 b).

[0063] Then, paired-end sequencing was performed on RNA from the growth point of wild-type 10Y and mutant npf1, and from fruit 2 days after flowering, using the Illumina Hiseq2500 sequencing platform (BaiMike, Beijing), with three biological replicates for each material. Subsequently, the raw data were aligned with the cucumber reference genome chinese long v2 using the BaiMike cloud platform to obtain the FPKM values ​​of all genes. Differentially expressed genes between mutant npf1 and wild-type were then screened and identified based on two parameters: fold change (fold change ≥ 2) and false negative rate (FDR < 0.05). Finally, functional enrichment analysis of the differentially expressed genes was performed using GO (Gene Ontology) and KEGG (Kyoto Encyclopedia of Genes and Genomes). Figure 6 c is an enrichment peak diagram of the CsNPF1 core binding motif in the CsYUC4 promoter, with the black box representing the CsNPF1 core binding motif. Combining DAP-seq and RNA-seq data, a CsNPF1 binding peak was found in the promoter region of the differentially expressed auxin biosynthesis gene CsYUCCA4 (CsYUC4).

[0064] Electrophoretic migration arrest assay (EMSA): A probe synthesized using cis-acting elements on the promoters of the MBP-CsNPF1 fusion protein and CsYUC4 was used to verify whether the CsNPF1 protein and the CsYUC4 promoter directly interact in vitro. The method was as follows:

[0065] (1) Protein expression

[0066] 1) Transform the target plasmid MBP-CsNPF1 into the prokaryotic expression strain BL21, pick a single clone into a 2mL centrifuge tube, add 1mL LB liquid (containing 50μg / mL Amp), shake at 37℃ until the bacterial solution becomes turbid, PCR amplify the target fragment to identify whether the transformation was successful, and preserve the positive bacterial solution.

[0067] 2) Add the above bacterial solution to an Erlenmeyer flask containing 20 mL of LB liquid (containing 50 μg / mL Amp) at a ratio of 1:100, and incubate overnight at 37°C with shaking.

[0068] 3) Add the bacterial culture to a 200 mL Erlenmeyer flask containing 200 mL LB liquid (containing 50 μg / mL Amp) at a ratio of 2.5:100, and shake at 37°C until the bacterial culture reaches OD. 600 The concentration was 0.4–0.6, 0.4 mM IPTG was added, and the mixture was incubated at 16°C and 200 rpm for 18 hours.

[0069] 4) Centrifuge at 4℃ and 12000 rpm for 10 min, discard the supernatant, and collect the bacterial cells;

[0070] 5) Resuspend the bacterial cells in pre-cooled MBP resuspension (20mM Tirs 7.4, 200mM NaCl, 1mM EDTA, 1mM DTT) and sonicate on ice: 200W power, 3s on, 3s off, 15min.

[0071] 6) Centrifuge at 4℃ and 10,000 rpm for 30 min, and use the supernatant for direct protein purification.

[0072] (2) Protein purification

[0073] 1) Add 20% alcohol to the purification column to clean the pads, then add 200 μL of MBP packing material (100 μL packing material / 100 mL bacterial culture);

[0074] 2) Add 20% alcohol to the column to clean the packing material, repeat once;

[0075] 3) Add MBP resuspension to the column to clean the packing material, repeat once;

[0076] 4) Resuspend the packing material in the supernatant and pour it into a clean 100mL Erlenmeyer flask. Place it in an ice box and shake it at 60rpm for 2 hours.

[0077] 5) Collect the packing material, add MBP resuspension to the column to wash the packing material and remove impurities and proteins, repeat once;

[0078] 6) Add MBP elution buffer (MBP resuspension containing 50 mM maltose) in fractions. First, add 1 mL of MBP elution buffer, bind for 15 min, and collect the eluent in a centrifuge tube. Second, add 1 mL of MBP elution buffer, bind for 10 min, and collect the eluent in a centrifuge tube. Third, add 1 mL of MBP elution buffer, bind for 5 min, and collect the eluent in a centrifuge tube.

[0079] 7) Perform gel electrophoresis to determine protein concentration, then aliquot and store at -80℃ for later use.

[0080] (3) EMSA combined experiment

[0081] The method is based on the LightShift Chemiluminescent EMSA Kit (Thermo Fisher), with slight modifications.

[0082] 1) Preparation of DNA probes: Biotin-tagged primers (pCsYUC4-P_Bio forward primer: [Bio]AAGTTGGCTTGGTTATTTATCTTATTTTAAACAAAT, pCsYUC4-P_Bio reverse primer: ATTTGTTTAAAATAAGATAAATAACCAAGCCAACTT) and untagged primers (pCsYUC4-P_Cold forward primer: AAGTTGGCTTGGTTATTTATCTTATTTTAAACAAAT, pCsYUC4-P_Cold reverse primer: ATTTGTTTAAAATAAGATAAATAACCAAGCCAACTT) were diluted to 100 μM with ddH2O. 5 μL of each primer was mixed, and 15 μL of ddH2O was added to dilute to a primer concentration of 20 μM. The mixture was then boiled in boiling water for 10 min to denature the primers, and allowed to cool naturally to room temperature to obtain biotin-tagged and untagged probes.

[0083] 2) Binding reaction: In a 200 μL centrifuge tube, add 2 μL of 10× binding buffer, 20 μM probe, and 2 μg of protein sequentially. Add water to a final volume of 20 μL and mix gently (to prevent probe detachment). After addition, place on ice for 30 min to bind. For the competitive reaction, first add the unlabeled probe and protein, bind on ice for 30 min, then add the biotin-labeled probe, and bind on ice for another 30 min.

[0084] 3) Electrophoresis: Prepare a 6.5% non-denaturing gel and pre-electrophoresis in 0.5×TBE solution for 30 min at 140V. Replace with fresh 0.5×TBE solution, spot the sample, and perform electrophoresis on ice for 60–80 min at 140V. Stop electrophoresis when the bromophenol blue indicator reaches 2 / 3 of the gel.

[0085] 4) Transfer: Soak the black filter screen and filter paper in 0.5×TBE solution beforehand, and cut 8cm×6cm nylon membranes and soak them in 0.5×TBE solution for 10 minutes. Arrange them in the following order (from bottom to top: black side of clip - filter screen - filter paper - EMSA glue - nylon membrane - filter paper - filter screen - white side of clip). Place the clips in the transfer tank with the black side facing the black side and the red side facing the black side. Pour in 0.5×TBE solution and place the transfer tank on ice. Transfer the membrane at a constant current of 380mA for 45 minutes.

[0086] 5) UV crosslinking: Place the nylon membrane on clean filter paper and put it into the UV crosslinking instrument, setting it to 1.245 J / cm. 2 Crosslinking on both sides for 2 minutes each;

[0087] 6) Sealing: Place the nylon membrane face up into a 50mL centrifuge tube, add 5mL Blocking Buffer, and seal on a centrifuge for 20 minutes at 25rpm.

[0088] 7) Streptavidin-HRP labeling: Add 5 mL of Blocking Buffer containing 16.7 μL Streptavidin-HRP and incubate on a gyroscope for 20 min at 25 rpm;

[0089] 8) Washing: Discard the blocking solution and wash the membrane 4 times with 5 mL of 1×Washing Buffer. The first wash should be a quick rinse, followed by 10 min each time at 80 rpm.

[0090] 9) Equilibration: Discard the rinsing solution, add 5 mL of Substrate Equilibration Solution and equilibrate for 5 min at 80 rpm;

[0091] 10) Development: Remove the membrane from the centrifuge tube and use a pipette to evenly spread 1 mL of a 1:1 mixture of Luminol Solution / Stable Peroxide Solution on the membrane. Incubate in the dark for 2 minutes, then expose and detect.

[0092] Emulsion-assisted migration assay (EMSA) confirmed that CsNPF1 can directly bind to the CsYUC4 promoter containing the TTTGTT binding motif. Figure 6 d).

[0093] Dual-luciferase reporter assay: Using CsNPF1 as the effector and the promoter of CsYUC4 as the reporter, the effector and reporter were co-transformed into cucumber protoplasts to verify whether CsNPF1 interacts with the cis-acting element on the promoter of CsYUC4 in vivo. The method is as follows:

[0094] (1) Construction of dual-luciferase vector: First, the CsYUC4 promoter was cloned, with the forward primer being ATACGTTCATGAAGTTGTTGCAAAC and the reverse primer being GTGATGATCATCTTCTTGGTCTTTGC. Then, the CsYUC4 promoter fragment was ligated into the pGreenII0800 vector to construct the pYUC4:LUC reporter factor vector; the full-length CDS of the NPF1 gene was ligated into the pGreenII62SK vector to construct the 35S:NPF1 effector factor vector.

[0095] (2) Analysis of cucumber protoplast transformation and transcriptional activity

[0096] 1) 10 μg each of different combinations of effectors and reporter (35S:GFP and pYUC4:LUC; 35S:NPF1 and pYUC4:LUC) were co-transformed into cucumber protoplasts using a PEG-Ca mediated transformation method, as follows:

[0097] ① Select plump cucumber seeds, peel and disinfect them, inoculate them into MS solid medium, and culture them in the dark at 28℃ for 5-7 days. Use a blade to cut the hypocotyl and cotyledons of etiolated seedlings into thin strips, and gently place them into an Erlenmeyer flask containing 20mL of enzymatic hydrolysis solution (2mM MES, 0.4M mannitol, 1.5% [w / v] cellulase R-10, 0.4% [w / v] macrozyme R-10 and 0.1×W5 resuspension [2mM MES, 154mM NaCl, 5mM KCl and 125mM CaCl2, pH 5.7], pH 5.7). Incubate at room temperature on a shaker in the dark for 4 hours at 40rpm.

[0098] ② Carefully aspirate the enzyme hydrolysate from the cut pipette tip (try not to touch the tissue), add an equal volume of W5 resuspension solution to resuspend the tissue, and then slowly shake in a shaker at room temperature in the dark for 1 hour to release protoplasts at 80 rpm.

[0099] ③ Filter the liquid from the previous step, centrifuge at 1000 rpm (increase rate set to 1, decrease rate set to 0) at room temperature for 10 min, and carefully remove the supernatant with a pipette. Resuspend the protoplasts in 10 mL of W5 solution, centrifuge at 1000 rpm at room temperature for 10 min, and carefully remove the supernatant with a pipette;

[0100] ④ Resuspend the protoplasts in an appropriate amount of MMG solution (5 mM MES, 0.4 M mannitol and 20 mM CaCl2, pH 5.7) to achieve a concentration of 2 × 10⁻⁶. 5 / mL.

[0101] ⑤ Add 20 μg of plasmid to a 2 mL centrifuge tube (total volume 20 μL, add water if necessary), and add 200 μL of protoplast to the centrifuge tube using a cut yellow pipette tip, and mix gently.

[0102] ⑥ Add an equal volume of 220 μL PEG / Ca solution (40% PEG4000, 0.4 M mannitol, 100 mM CaCl2) to make the final PEG concentration 20%, mix gently, and incubate at room temperature for 20 min.

[0103] ⑦ Add 1 mL of W5 solution, mix gently, and stop the transfection process;

[0104] ⑧ Centrifuge at 1000 rpm for 5 min, and carefully remove 1 mL of supernatant;

[0105] ⑨ Add 1 mL of W5 solution, mix gently, and incubate at room temperature under weak light for 24-36 hours;

[0106] ⑩ Centrifuge at 1000 rpm at room temperature for 3 min, carefully remove 800 μL of supernatant, and gently mix.

[0107] 2) After culturing at room temperature in the dark for 18 hours, centrifuge at 1000 rpm for 5 minutes, carefully aspirate the supernatant, leaving about 50 μL of liquid, add 100 μL of 1×PLB lysis buffer, vortex for 10 seconds to allow the cells to fully lyse and release luciferase.

[0108] 3) Divide the reserved liquid into three tubes, each containing 40 μL. Measure the LUC and REN values ​​using the Promega Dual-Luciferase Reporter Gene Detection System on a Promega GloMax luminescence detector under the DLR-0-INJ setting.

[0109] Figure 6 e is a dual-luciferase assay to verify the transcriptional activation effect of CsNPF1 on CsYUC4. The results show that CsNPF1 promotes the transcription of CsYUC4.

[0110] Quantitative real-time PCR analysis of the CsYUC4 gene in wild-type Cu2 and gene knockout mutant npf1 CR1 and npf1 CR2The expression level was determined using the following primer sequences: forward primer (F) sequence: TCTTTCACTTTCCACTTACCCA, and reverse primer (R) sequence: GCCGTGAACCCATATGCA. The amplification reaction system consisted of 10 μL: 5 μL 2×ChamQ Universal SYBR qPCR MasterMix, 1 μL cDNA, 0.2 μL F, 0.2 μL R, and 3.6 μL H2O. The reaction conditions were: 95℃ pre-denaturation for 30 sec, 95℃ denaturation for 5 sec, 60℃ extension for 30 sec, for 40 cycles. Figure 6 f represents the quantitative real-time PCR analysis of the CsYUC4 gene in wild-type Cu2 and gene knockout mutant npf1. CR1 and npf1 CR2 The expression results indicate that CsYUC4 expression is present in the gene knockout mutant npf1. CR1 and npf1 CR2 The concentration of Cu2 in the medium is significantly lower than that in the wild type.

[0111] The in situ hybridization experiment is performed as follows:

[0112] (1) Probe preparation

[0113] 1) Purification of the target fragment: PCR amplification primers (CsNPF1_ISH_SP6_F: GATTTAGGTGACACTATAGaatGCTTCAAGCTCTTCCGCTGTG and CsNPF1_ISH_T7-R: tgTAATACGACTCACTATAGGGCCATCTGCTTTAAATCGTC) were designed for the specific region (approximately 100–500 bp) of the target gene cDNA. Using cDNA or plasmids containing the target fragment as templates, PCR amplification was performed using a high-fidelity enzyme, and the target fragment was purified and recovered.

[0114] 2) In vitro transcription: Add 2 μL of 10× transcription buffer, 2 μL of 10× transcription buffer, 1 μL of RNase inhibitor, 2 μL of T7 RNA polymerase, and 1 μg of the target fragment sequentially, then add RNase-free H2O to a final volume of 20 μL. Gently mix and incubate at 95°C for 2 hours.

[0115] 3) Probe purification: Add 1 μL DNase I, 1 μL tRNA, and 75 μL DNase-free H2O to the above transcript, mix gently, and incubate at 37°C for 30 min. After the reaction, add 95 μL pre-chilled 4M NH4Ac and 190 μL pre-chilled anhydrous ethanol, mix gently by inverting, and incubate at -20°C for 3 h to precipitate. Then centrifuge at 12000 rpm for 10 min at 4°C and discard the supernatant. Wash the precipitate with 600 μL 70% ethanol, centrifuge at 12000 rpm for 7 min at 4°C, and discard the supernatant. The probe was then air-dried on ice in a clean bench. After drying, 100 μL of RNase-free H2O and 100 μL of 2× carbonate buffer were added, and the mixture was incubated at 60°C for an appropriate time for hydrolysis. Then, 10 μL of 10% glacial acetic acid, 21 μL of 3M NaAc (pH 5.2), and 420 μL of anhydrous ethanol were added sequentially, and the mixture was gently mixed and incubated at -20°C for 3 hours to precipitate. The supernatant was discarded after centrifugation at 14,000 rpm for 10 minutes at 4°C. The probe was washed with 600 μL of 70% ethanol and centrifuged at 14,000 rpm for 7 minutes at 4°C, and the supernatant was discarded. The probe was then air-dried on ice in a clean bench. After the precipitate was dry, 40 μL of 50% formamide was added, and the probe was stored at -80°C for long-term preservation.

[0116] (2) Sample preparation

[0117] Fruits from the growth points of wild-type 10Y and mutant npf1 at different developmental days after flowering were used as samples for paraffin sectioning and embedding.

[0118] (3) Pretreatment before hybridization

[0119] 1) Place the cut paraffin sections on a staining rack and treat them twice in xylene solution for 10 minutes each time to dewax the samples.

[0120] 2) Rehydrate sequentially in a gradient of alcohols (100%, 95%, 85%, 70%, 50%, and 30%) for 30 seconds each.

[0121] 3) Digest in 0.85% NaCl solution for 2 min, 1×PBS solution for 2 min, Proteinase K solution at 37℃ for 30 min, 1×PBS solution containing 0.2% glycine for 2 min, 1×PBS solution for 2 min, 1×PBS solution containing 4% formaldehyde for 10 min, 1×PBS solution for 2 min, 1×PBS solution for 2 min, acetic anhydride solution with gentle stirring for 10 min, 1×PBS solution for 2 min, 1×PBS solution for 2 min;

[0122] 4) Then treat with 30%, 50%, 70%, 85% and 95% alcohol in sequence, each for 30 seconds, and treat with anhydrous ethanol twice, each time for 1 minute.

[0123] (4) Hybridization and color development

[0124] 1) Hybridization: First, dry the glass slides and then add hybridization buffer. Add 30 μL of probe (containing 2 μL of probe and 28 μL of 50% formamide) per slide. Denature the probe at 80°C for 2 min, then immediately place it on ice for 2–3 min (to prevent renaturation), followed by brief centrifugation. Add 4 times the volume (120 μL) of hybridization solution and gently invert to mix thoroughly. Drop the hybridization buffer onto the glass slide, spread it evenly with a pipette tip, then cover with a coverslip and place in a humidified chamber. Finally, seal the humidified chamber and incubate overnight in a 50°C oven.

[0125] 2) Color development: The above slides were sequentially incubated in 0.2×SSC solution at 55℃ for 1 h, 0.2×SSC solution at 55℃ for 1 h, 1×NTE solution at 37℃ for 5 min, and 1×NTE solution at 37℃ for 5 min, containing 20 μg / mL RNase A 1×NTE solution was incubated at 37℃ for 30 min, 1×NTE solution at 37℃ for 5 min, 1×NTE solution at 37℃ for 5 min, 0.2×SSC solution at 55℃ for 1 h, 1×TBS solution for 5 min, Roche blocking solution was gently shaken and incubated for 1 h, and 1×TBST solution for 45 min. After the slides were dried, they were rinsed twice with 120 μL of antibody dilution buffer (10 μL of antibody per 12.5 mL of 1×TBST solution). 120 μL of antibody reaction solution was added to the slides, and after covering with a coverslip, the slides were placed in a humidified chamber and incubated at room temperature for 2 h. After incubation, the slides were shaken and washed 4 times in 1×TBST solution for 15 min each time. After the slides were polished twice with the chromogenic substrate solution, 120 μL of substrate solution containing NBT / BCIP was added to the slides. The two slides were gently placed side by side (front) with the sample (avoiding air bubbles as much as possible) and placed vertically in a Coplin cup. After sealing, place in a dark environment at room temperature for 1 to 3 days for color development.

[0126] Figure 6 g represents the expression of CsYUC4 in fruits at different developmental days, detected by in situ hybridization experiments. Purple-red indicates signal strength, DAA indicates the number of days after flowering, in indicates the integument, nu indicates the nucellus, and fu indicates the peduncle (numerical values ​​are shown as mean ± standard deviation; two-tailed t-test). CsYUC4 was found to be specifically expressed in ovules, and its expression gradually increased with fruit development, consistent with the localization results of CsNPF1.

[0127] In summary, CsNPF1 promotes auxin synthesis in ovules and the formation of parthenocarpic fruits by directly binding to and activating the CsYUC4 promoter sequence.

[0128] Example 4

[0129] This example demonstrates the application of the CsNPF1 gene in regulating the bitterness of cucumber fruits.

[0130] To investigate whether the mutant npf1 affects fruit quality, fruits from both wild-type 10Y and the mutant npf1 were tasted. It was found that the bitterness of the mutant npf1 fruit was significantly stronger than that of the wild-type 10Y, and the bitterness was attributed to the triterpenoid compound cucurbitacin (CuC). The content of CuC in the wild-type and mutant was determined using ultra-high performance liquid chromatography-tandem mass spectrometry. The method was as follows:

[0131] (1) Two days after flowering, the fruits of wild-type and mutant plants were ground into powder in liquid nitrogen and placed in 2mL centrifuge tubes. The sample weight was approximately 200mg, and the specific value was recorded.

[0132] (2) Add 400 μL of methanol to each sample, vortex rapidly for 10 s, and sonicate for 15 min;

[0133] (3) Centrifuge at 4℃ and 14000rpm for 5min, and transfer the supernatant to a 1.5mL centrifuge tube;

[0134] (4) Use a 1mL syringe to draw up the supernatant and carefully filter it into a sample vial using a 0.22μm filter membrane, and then perform the analysis.

[0135] The study of the CsNPF1 gene and the Bt promoter, a gene associated with fruit bitterness, was conducted using the same method as in Example 3. Specifically, this included:

[0136] The Bt gene was analyzed using quantitative real-time PCR in wild-type Cu2 and the gene knockout mutant npf1. CR1 and npf1 CR2 Expression level analysis was performed using the following primers: forward primer (F) sequence: GTTGCTGATCACCCTCCATTGATCG; reverse primer (R) sequence: GCCTTCTTTGGCGTTCAACATCTCT. The PCR amplification reaction system consisted of 10 μL: 5 μL 2×ChamQ Universal SYBRqPCR Master Mix, 1 μL cDNA, 0.2 μL F, 0.2 μL R, and 3.6 μL H2O. The reaction conditions were: 95℃ pre-denaturation for 30 sec, 95℃ denaturation for 5 sec, 60℃ extension for 30 sec, for 40 cycles.

[0137] The binding of CsNPF1 to the Bt promoter was verified by EMSA, with the probe fragment being TTGGATCCCCAATTTGGTGCTATAAATAAAGGGGTA. The primers for probe synthesis were as follows: pBt-P_Bio forward primer: [Bio]TTGGATCCCCAATTTGGTGCTATAAATAAAGGGGTA; pBt-P_Bio reverse primer: TACCCCTTTATTTATAGCACCAAATTGGGGATCCAA; pBt-P_Cold forward primer: TTGGATCCCCAATTTGGTGCTATAAATAAAGGGGTA; pBt-P_Cold reverse primer: TACCCCTTTATTTATAGCACCAAATTGGGGATCCAA.

[0138] A dual-luciferase reporter assay was performed: First, the pBt promoter was cloned, with the forward primer being GGTGTAGCTTAATCATTCTCCT and the reverse primer being GATCAGCAACAGAAAGGTG. Then, using CsNPF1 as the effector and the Bt promoter as the reporter, the effector and reporter were co-transformed into cucumber protoplasts in different combinations (35S:GFP and pBt:LUC; 35S:NPF1 and pBt:LUC) to verify whether CsNPF1 interacts with the cis-acting element on the Bt promoter in vivo. The dual-luciferase vector was constructed as follows: the Bt promoter fragment was ligated into the pGreenII0800 vector to construct the pBt:LUC reporter vector; the full-length CDS of the NPF1 gene was ligated into the pGreenII62SK vector to construct the 35S:NPF1 effector vector.

[0139] Figure 7 The study showed that CsNPF1 directly binds to the Bt promoter of the fruit bitterness-related gene to regulate bitter glycoside synthesis. In this data, a represents the bitter glycoside content of wild-type 10Y and the mutant npf1 fruit; b represents the bitter glycoside content of wild-type Cu2 and the gene knockout mutant npf1. CR1 The bitter content of the fruit; c is the quantitative real-time PCR analysis of the Bt gene in wild-type Cu2 and the gene knockout mutant npf1. CR1 and npf1 CR2 The expression of CsNPF1 is shown in Figure d; enrichment peaks of the CsNPF1 core binding motif in the Bt promoter are shown in black boxes; Figure e shows EMSA verification of CsNPF1 binding to the Bt promoter; Figure f shows dual-luciferase assay verification of the transcriptional repression effect of CsNPF1 on Bt (numerical values ​​are shown as mean ± standard deviation; two-tailed t-test). The results show that the mutant npf1 and the gene knockout mutant npf1... CR1The CuC content in the fruit of the mutant was significantly higher than that of its corresponding wild-type 10Y or Cu2( Figure 7 a, b). Quantitative real-time PCR analysis showed that, compared to wild-type 10Y, the gene knockout mutant npf1... CR1 and npf1 CR2 In the mutant fruits, the expression of the key gene Bitterfruit (Bt), which controls CuC content in cucumber fruits, was significantly upregulated. Figure 7 c). Meanwhile, a CsNPF1 binding peak was also found in the Bt promoter region in the DAP-seq data. Figure 7 d). EMSA and dual-luciferase assays also validated the results of the DAP-seq and quantitative PCR analyses described above. Figure 7 (e, f). The above results indicate that CsNPF1 reduces fruit bitterness and improves fruit quality by directly binding to and inhibiting the expression of the Bt promoter sequence.

[0140] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention in any way. Any simple modifications, alterations, and equivalent changes made to the above embodiments based on the inventive essence shall still fall within the protection scope of the present invention.

Claims

1. A type of cucumber CsNPF1 The application of genes in upregulating parthenocarpy in cucumbers is characterized by, The CsNPF1 The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the amino acid sequence encoding the protein is shown in SEQ ID NO.

2.

2. A type of cucumber CsNPF1 The application of genes in downregulating the bitterness of cucumber fruits is characterized by, The CsNPF1 The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the amino acid sequence encoding the protein is shown in SEQ ID NO.2.