Lentivirus for treating cancer as well as preparation method and application of lentivirus

Abstract

The invention provides a lentivirus for treating cancer as well as a preparation method, application and a corresponding pharmaceutical composition of the lentivirus. According to the invention, an hTERT promoter and a CDC6shRNA gene sequence are inserted behind an enzyme cutting site of a vector, an obtained plasmid is transferred into an expression strain, the expression strain is cultured and screened to obtain a cloned strain, and the cloned strain is shaken and packaged to obtain the hTERT-CDC6shRNA lentivirus; when the lentivirus disclosed by the invention is used for infecting cancer cells, the experimental result shows that the proliferation of the cancer cells can be effectively inhibited.

Description

Technical Field

[0001] The present application relates to the field of tumor gene therapy. Specifically, the present application provides a lentivirus for treating cancer and a preparation method and application thereof. Background Art

[0002] Cancer kills millions of people every year and is one of the biggest health challenges facing humanity. There is currently no effective means of prevention and treatment. The three major weapons used by humans at the earliest: surgery, radiotherapy, chemotherapy, and now molecular targeted therapy and immunotherapy, have low cure rates and high costs. The pain endured by patients and the huge side effects caused to their bodies are beyond the understanding of ordinary people. Today, with the rapid development of science and technology, cancer is still a global problem.

[0003] Scientists have been working tirelessly on the road to conquering cancer. The 2001 Nobel Prize in Physiology or Medicine recognized the outstanding contributions made by American scientist Leland H. Harwell and British scientists Timothy Hunt and Paul M. Nurse in discovering key regulatory factors of the cell cycle. As early as 1983, Timothy Hunt used sea urchin eggs as experimental materials and found that the content of two proteins in the cleavage process varied with the cell cycle, which pioneered this theoretical research; the 2006 Nobel Prize in Physiology or Medicine recognized the outstanding contributions made by American scientists in discovering the RNA (ribonucleic acid) interference mechanism, which originated from a research result published by Americans Andrew Farr and Craig Mello in the journal Nature in 1998. These major discoveries have opened up a very broad field for human research on life. Studies have shown that certain small RNA molecules can determine the fate of a cell by guiding genes to turn on or off, which will have a profound impact on inducing cells to form a certain type of tissue. Recent studies have found that this method can cause the corresponding protein to be unable to be synthesized, thereby "turning off" specific genes and controlling cell growth. Cell division cycle proteins are essential for the initiation of human DNA replication and are necessary for DNA replication and cell proliferation. The research on the replication mechanism of human DNA in tumors has received extensive attention. Studies have found that CDC6 protein is highly expressed in a variety of tumor cells, and its expression level is related to tumor load; and by inhibiting its expression, tumor cell proliferation can be selectively prevented. Decreased expression will block cell proliferation and promote apoptosis.

[0004] Lentivirus vector is a gene therapy vector developed based on HIV-1 (human immunodeficiency virus type 1). Lentivirus can infect cells in the active phase of mitosis, as well as cells that divide slowly and are in the terminal phase of division, including hematopoietic stem cells, neural stem cells, neurons at the end of differentiation, hepatocytes, etc. In in vitro cell culture experiments and in vivo transplantation experiments, the target gene introduced by the lentivirus vector can be expressed long-term and stably. In addition, the lentivirus vector does not express any HIV-I protein and has low immunogenicity. The modified lentivirus vector can accommodate exogenous genes of about 10kb, so most cDNAs can be cloned into the lentivirus vector. These advantages make the lentivirus vector an effective tool for in vivo and in vitro gene transfer. Summary of the invention

[0005] This patent is to construct the artificially synthesized hTERT-CDC6shRNA (base number 1521bp) gene sequence into a lentiviral vector. hTERT telomerase is an RNA-dependent DNA polymerase, whose core structure contains the necessary RNA structure, and is composed of the reverse transcription active human telomerase catalytic subunit (hTERT) and related proteins. The hTERT promoter region lacks TATA box and CAAT box, and its structure is a GC-rich CpG island. 181bp upstream of the transcription start site is the core promoter region, with multiple transcription factor binding sites. In mature and differentiated human tissue cells, the expression of the hTERT gene is in a closed state, and in tumor cells, the gene is activated at the transcriptional level. Therefore, the promoter of the hTERT gene can specifically guide the tumor gene to be expressed only in tumor cells. Cancer cells contain a large amount of CDC6 protein that is not found in normal cells, and the more cell divisions of cancer cells, the higher the content of CDC6 protein. The principle of using "CDC6shRNA active gene" focuses on the characteristic of "cancer has unlimited proliferation". It can eliminate a DNA replication factor called CDC6 that exists in common cancer cells, knock down CDC6 protein, and effectively make cancer cells self-destruct. It also uses lentivirus vector to efficiently penetrate cancer cells to restore the normal regulatory function of proto-oncogenes and mutated, missing or inactivated tumor suppressor genes, and restore cancer cells to normal cells, thereby achieving the purpose of tumor suppression. Through the results of in vitro experiments, we found that this gene sequence has a significant anti-cancer effect.

[0006] On the one hand, the present application provides a lentivirus for treating cancer, wherein the lentivirus for treating cancer carries an hTERT promoter and a CDC6shRNA gene.

[0007] Furthermore, the hTERT promoter sequence is SEQ ID NO.2.

[0008] Furthermore, the CDC6shRNA gene sequence is SEQ ID NO.3.

[0009] Furthermore, the lentivirus carries the hTERT promoter-CDC6shRNA combination gene.

[0010] Furthermore, the hTERT promoter-CDC6shRNA combination gene sequence is SEQ ID NO.1.

[0011] On the other hand, the present application provides the use of the above-mentioned lentivirus for treating cancer in the preparation of a drug for treating cancer.

[0012] Furthermore, the cancer is lung cancer, liver cancer, papillary thyroid cancer, ovarian cancer, renal clear cell adenocarcinoma, pancreatic cancer, or human endometrial adenocarcinoma.

[0013] Furthermore, the cancer is lung cancer, liver cancer, or papillary thyroid cancer.

[0014] Furthermore, the cancer is lung cancer.

[0015] On the other hand, the present application provides a pharmaceutical composition comprising the above-mentioned lentivirus for treating cancer.

[0016] Furthermore, the pharmaceutical composition also includes a pharmaceutically acceptable excipient.

[0017] Furthermore, the pharmaceutical composition is in the form of an injection.

[0018] On the other hand, the present application provides a method for preparing the above-mentioned lentivirus for treating cancer:

[0019] (1) inserting hTERT promoter and CDC6shRNA gene sequence after the restriction site of the vector to obtain a plasmid;

[0020] (2) transferring the plasmid into the expression strain, culturing and screening the successfully transferred strain;

[0021] (3) shaking the successfully transferred strain obtained in step (2) to obtain an hTERT-CDC6shRNA expression plasmid;

[0022] (4) Packaging the expression plasmid described in step (3) to obtain hTERT-CDC6shRNA lentivirus.

[0023] Those skilled in the art can select suitable excipients for the pharmaceutical composition involved in this application based on general knowledge in the pharmaceutical field. Available excipients include but are not limited to solvents, cosolvents, stabilizers, dispersants, viscosity modifiers, antioxidants, pH modifiers, sustained-release agents, fillers, sweeteners, adhesives, gas generators, coating agents, etc. Excipients suitable for injection are particularly preferred. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 is the electrophoresis diagram of plasmid hTERT-CDC6shRNA (lane 2);

[0025] Figure 2 Comparison of cell growth at 24-72h in Example 3;

[0026] Figure 3 The cell counting results in Example 3;

[0027] Figure 4 The data analysis results in Example 3;

[0028] Figure 5 Comparison of cell growth at 24-72h in Example 4;

[0029] Figure 6 The cell counting results in Example 4;

[0030] Figure 7 The data analysis results in Example 4 are as follows;

[0031] Figure 8 Comparison of cell growth at 24-72h in Example 5;

[0032] Fig. 9 The cell counting results in Example 5;

[0033] Fig.10 The data analysis results in Example 5;

[0034] Fig.11 Comparison of cell growth at 48-96h in Example 6;

[0035] Fig.12 The cell counting results in Example 6;

[0036] Fig.13 The data analysis results in Example 6;

[0037] Fig.14 Comparison of cell growth at 24-72h in Example 7;

[0038] Fig.15 The cell counting results in Example 7;

[0039] Fig.16 The data analysis results in Example 7;

[0040] Fig.17 Comparison of cell growth at 24-72h in Example 8;

[0041] Fig.18 The cell counting results in Example 8;

[0042] Fig.19 This is the data analysis result in Example 8.

[0043] Fig. 20 Comparison of cell growth at 24-72h in Example 9;

[0044] Fig.21 The cell counting results in Example 9;

[0045] Fig. 22 This is the data analysis result in Example 9. DETAILED DESCRIPTION

[0046] Example 1 Construction of hTERT-CDC6 shRNA overexpression clone

[0047] Relevant gene sequences were retrieved from Genbank, and CDC6 shRNA sequences were designed. The hTERT-CDC6 shRNA overexpression clone was constructed using the seamless cloning method.

[0048] Here are the steps:

[0049] Vector Plenty6.3 / V5-TOPO (abbreviated as D) (purchased from Thermo Fisher Scientific) was digested with restriction sites ClaI and MluI, upstream primers:

[0050] aattcaaaattttatcgataagacaattcacaaacacagccc (SEQ ID NO.4) downstream primer: actaaccggtacgcgttcagtctgagtcaggcccttc (SEQ ID NO.5), inserted hTERT promoter and CDC6shRNA gene sequence to obtain hTERT-CDC6shRNA plasmid.

[0051] step:

[0052] 1. Vector digestion

[0053] Enzyme digestion system preparation:

[0054]

[0055] (Note: Enzyme digestion reaction conditions: 37℃ / 3h)

[0056] 2. Seamless cloning connection

[0057]

[0058] (Note: Seamless cloning and ligation reaction conditions: 37℃ / 30min)

[0059] 3. Transformation and coating of ligation products

[0060] Melt 50μl TOP10 competent cells on ice, take 5μl ligation product and competent cells and mix them; ice bath for 30min, heat shock in 42℃ water bath for 90sec, ice bath for 2min; transfer the transformation product to an EP tube containing 500μl non-resistant LB liquid culture medium, place in a shaker, and culture at 37℃, 180rpm for 30min; centrifuge the EP tube containing the transformed bacteria at 4000rpm for 2min; pour out the supernatant in the clean bench, leaving about 100μl culture medium to mix the precipitate, and evenly apply it on the LB resistance culture plate; turn the plate upside down and place it in a 37℃ bacterial incubator to culture overnight (12-16h). Pick a monoclonal colony from the above plate and place it in 6ml LB liquid culture medium, 37℃, 250rpm, and culture overnight (12-16h); extract plasmids, sequence and identify, and compare the sequencing results with the target gene sequence. The identification result is the correct plasmid.

[0061] Obtain plasmid hTERT-CDC6shRNA.

[0062] The gene sequences involved:

[0063] hTERT-CDC6shRNA gene sequence, SEQ ID NO.1

[0064] agacaattcacaaacacagccctttaaaaaggcttagggatcactaaggggatttctagaagagcgacc

[0065] tgtaatcctaagtatttacaagacgaggctaacctccagcgagcgtgacagcccagggagggtgcgagg

[0066] cctgttcaaatgctagctccataaataaagcaatttcctccggcagtttctgaaagtaggaaaggttac

[0067] atttaaggttgcgtttgttagcatttcagtgtttgccgacctcagctacagcatccctgcaaggcctcg

[0068] ggagacccagaagtttctcgccccttagatccaaacttgagcaacccggagtctggattcctgggaagt

[0069] cctcagctgtcctgcggttgtgccggggccccaggtctggaggggaccagtggccgtgtggcttctact

[0070] gctgggctggaagtcgggcctcctagctctgcagtccgaggcttggagccaggtgcctggaccccgagg

[0071] ttgccctccaccctgtgcgggcgggatgtgaccagatgttggcctcatctgccagacagagtgccgggg

[0072] cccagggtcaaggccgttgtggctggtgtgaggcgcccggtgcgcggccagcaggagcgcctggctcca

[0073] tttcccaccctttctcgacgggaccgccccggtgggtgattaacagatttggggtggtttgctcatggt

[0074] ggggacccctcgccgcctgagaacctgcaaagagaaatgacgggcctgtgtcaaggagcccaagtcgcg

[0075] gggaagtgttgcagggaggcactccgggaggtcccgcgtgcccgtccagggagcaatgcgtcctcgggt

[0076] tcgtccccagccgcgtctacgcgcctccgtcctccccttcacgtccggcattcgtggtgcccggagccc

[0077] gacgccccgcgtccggacctggaggcagccctgggtctccggatcaggccagcggccaaagggtcgccg

[0078] cacgcacctgttcccagggcctccacatcatggcccctccctcgggttaccccacagcctaggccgatt

[0079] cgacctctctccgctggggccctcgctggcgtccctgcaccctgggagcgcgagcggcgcgcgggcggg

[0080] gaagcgcggcccagacccccgggtccgcccggagcagctgcgctgtcggggccaggccgggctcccagt

[0081] ggattcgcgggcacagacgcccaggaccgcgcttcccacgtggcggagggactggggacccgggcaccc

[0082] gtcctgccccttcaccttccagctccgcctcctccgcgcggaccccgccccgtcccgacccctcccggg

[0083] tccccggcccagccccctccgggccctcccagcccctccccttcctttccgcggccccgccctctcctc

[0084] gcggcgcgagtttcaggcagcgctgcgtcctgctgcgcacgtgggaagccctggccccggccacccccg

[0085] cgatgaattccccagctgattggtattgctaatacttcaagagagtattagcaataccaatcagctttt

[0086] ttg

[0087] hTERT promoter sequence, SEQ ID NO.2

[0088] agacaattcacaaacacagccctttaaaaaggcttagggatcactaaggggatttctagaagagcgacc

[0089] tgtaatcctaagtatttacaagacgaggctaacctccagcgagcgtgacagcccagggagggtgcgagg

[0090] cctgttcaaatgctagctccataaataaagcaatttcctccggcagtttctgaaagtaggaaaggttac

[0091] atttaaggttgcgtttgttagcatttcagtgtttgccgacctcagctacagcatccctgcaaggcctcg

[0092] ggagacccagaagtttctcgccccttagatccaaacttgagcaacccggagtctggattcctgggaagt

[0093] cctcagctgtcctgcggttgtgccggggccccaggtctggaggggaccagtggccgtgtggcttctact

[0094] gctgggctggaagtcgggcctcctagctctgcagtccgaggcttggagccaggtgcctggaccccgagg

[0095] ttgccctccaccctgtgcgggcgggatgtgaccagatgttggcctcatctgccagacagagtgccgggg

[0096] cccagggtcaaggccgttgtggctggtgtgaggcgcccggtgcgcggccagcaggagcgcctggctcca

[0097] tttcccaccctttctcgacgggaccgccccggtgggtgattaacagatttggggtggtttgctcatggt

[0098] ggggacccctcgccgcctgagaacctgcaaagagaaatgacgggcctgtgtcaaggagcccaagtcgcg

[0099] gggaagtgttgcagggaggcactccgggaggtcccgcgtgcccgtccagggagcaatgcgtcctcgggt

[0100] tcgtccccagccgcgtctacgcgcctccgtcctccccttcacgtccggcattcgtggtgcccggagccc

[0101] gacgccccgcgtccggacctggaggcagccctgggtctccggatcaggccagcggccaaagggtcgccg

[0102] cacgcacctgttcccagggcctccacatcatggcccctccctcgggttaccccacagcctaggccgatt

[0103] cgacctctctccgctggggccctcgctggcgtccctgcaccctgggagcgcgagcggcgcgcgggcggg

[0104] gaagcgcggcccagacccccgggtccgcccggagcagctgcgctgtcggggccaggccgggctcccagt

[0105] ggattcgcgggcacagacgcccaggaccgcgcttcccacgtggcggagggactggggacccgggcaccc

[0106] gtcctgccccttcaccttccagctccgcctcctccgcgcggaccccgccccgtcccgacccctcccggg

[0107] tccccggcccagccccctccgggccctcccagcccctccccttcctttccgcggccccgccctctcctc

[0108] gcggcgcgagtttcaggcagcgctgcgtcctgctgcgcacgtgggaagccctggccccggccacccccg

[0109] cgat

[0110] CDC6shRNA gene sequence, SEQ ID NO.3

[0111] cccagctgattggtattgctaatacttcaagagagtattagcaataccaatcagc

[0112] Example 2 Preparation and production process of lentivirus

[0113] The hTERT-CDC6shRNA plasmid of Example 1 was transformed into Stbl3 competent cells to screen for resistant monoclonal strains. The specific operation was as follows:

[0114] Take out competent cells Stbl3 (purchased from Thermo Fisher Scientific) and hTERT-CDC6shRNA plasmid from the -80℃ refrigerator and place on ice to thaw. Take 1μg of plasmid and add it to the competent cells, mix gently, and place it on ice for 25min. Quickly place the competent cells with the added plasmid in a preheated 42℃ water bath for heat shock for 45sec, and place it on ice again for 2min. Add 250μl LB liquid culture medium to the competent cells with the added plasmid, 220rpm / min, 37℃, and recover for 1h. Dry the LB solid culture medium completely, absorb 50μl of the recovered transformation bacterial liquid, add the prepared LB solid culture medium, spread it evenly with a coating rod, and seal the culture dish with a sealing film. Place the sealed LB solid culture medium upside down in a 37℃ incubator and culture for 12-16h to obtain a resistant monoclonal strain.

[0115] The above monoclonal strain was shaken to obtain hTERT-CDC6shRNA plasmid.

[0116] Select a typical single colony in a clean bench and place it in a 15ml sterile centrifuge tube (containing 5ml LB liquid culture medium) at 37℃, 220rpm / min, and culture for 12-16h, OD600 is 0.6-0.9. The next day, inoculate it into LB culture medium at a volume ratio of 1:100, culture at 37℃, 220rpm / min, and culture for 16h to extract the plasmid.

[0117] The plasmid extracted in the previous step is packaged with the mixed packaging plasmids pLP1, pLP / VSVG, and pLP2 to obtain hTERT-CDC6shRNA lentivirus. The specific packaging operation is as follows:

[0118] The packaging cells are 293F cells, and the cell transfection density is 4.0-4.5×10 6 / ml.

[0119] Cell transfection steps: A: Use 5% opti-MEM to dilute the plasmid, the total amount of plasmid is 2.5ug / ml, and the ratio of packaging plasmid pLP1, pLP / VSVG, pLP2 and lentiviral plasmid is 1:1:1:2. B: Use 5% opti-MEM to dilute the plasmid, the amount of transfection reagent (purchased from Thermo Fisher Scientific, catalog number: A35348) is 6μl / ml, and it is placed at room temperature for 1min. The diluted plasmid is added to the diluted transfection reagent, placed at room temperature for 15min, and then added to 293F cells and mixed thoroughly. After 4h, 5% supplement and 4% enhancer are added, and the supernatant is collected after 56h. After purification by purification column, it is concentrated and the liquid is replaced. First, concentrate 5 times, and then use 3 times the volume of filtration and replacement solution (buffer: 0.02M phosphate buffer pH7.2 with 1% glycerol, 20mg / ml sucrose, 1mg / ml L-arginine, 2mg / ml glycine, 2% PEG400) to obtain the lentivirus, which is then packaged and stored at -80°C.

[0120] The activity titer of lentivirus detected by QPCR was 5.39×10 7 TU / ml.

[0121] The steps for lentiviral activity detection are as follows:

[0122] 293T cells were used to detect the activity of lentivirus. The specific operation is as follows:

[0123] 1×10 5 293T cells were inoculated into 6-well plates. After 24 hours of plating, the cell density was B (approximately 2x10 5 / ml), 2ml of culture medium per well. The next day, discard the culture medium and replace it with 1ml / well fresh DMEM culture medium. Gently drop 50μl of lentivirus control (Shanghai Jikai Gene Technology) and 50μl of virus into the wells, and make a blank control at the same time. After 24h of infection, replace the culture medium with 2ml of fresh culture medium and continue to culture for 48h. Extract the cell genome to detect activity.

[0124] After the culture is completed, the cells are digested and the genome is extracted as follows:

[0125] The culture medium was aspirated, 1 ml of 1× PBS was added to each well to gently wash the cells and then discarded, the cells were digested with 0.5 ml of trypsin, and 1 ml of DMEM culture medium was added to resuspend the collected cells in a 1.5 ml centrifuge tube. The genomic DNA was extracted using a genome extraction kit (Tiangen Biochemical Technology (Beijing)), and the genomic DNA was eluted with 100 μl of Elution buffer; the dsDNA concentration and purity were detected by microplate reader.

[0126] Follow the steps to perform QPCR experiment to detect the activity of lentivirus. The specific steps are as follows:

[0127] Take the 293T cell reference gene DNA standard and dilute it 10× to a concentration of 1.0×10 8 copy-1.0×10 4 The target plasmid standard was diluted to a concentration of 1.0×10 8 copy-1.0×10 4 copy, and establish a standard curve.

[0128] Add 19 μl of the prepared PCR reaction system to the PCR reaction wells on the plate, and arrange the 293T cell reference gene DNA and target gene primers in an alternating pattern. Place the 293T cell reference gene DNA in rows A and B, and the target gene primers in rows C and D. Add 1 μl of DNA template to each reaction well, and set up a negative control in which enzyme-free water is used instead of the template;

[0129] The PCR reaction system was as follows, with two replicates for each sample:

[0130] Reagents volume 2×qPCR mix 10μl Forward Primer (10μM) 0.4μl Reverse Primer (10μM) 0.4μl Probe (10 μM) 0.2μl DNA template 1μl Enzyme-free water 8μl total 20μl

[0131] PCR amplification procedure

[0132]

[0133] Results Analysis

[0134] Substitute the obtained Ct values ​​of the target gene and reference gene into the standard curve to obtain their respective copy numbers Q1 and Q2, and calculate the ratio of the target gene to the reference copy number Q1 / Q2. Then calculate the titer (transduction units per ml, TU / ml) according to the following formula:

[0135]

[0136] The 293T cell reference gene DNA primer probe sequences are as follows:

[0137] Forward primer TGC AGA TTT GGA CCT GCG AG(SEQ ID NO.6)

[0138] Reverse primer GAA TAG CCA AGG TGA GCG GC (SEQ ID NO.7)

[0139] Probe ACC TGA AGG CTC TGC GCG GAC TTG T(SEQ ID NO.8)

[0140] The target gene primer and probe sequences are as follows:

[0141] Forward primer GCT CCT TTC CGG GAC TTT CG(SEQ ID NO.9)

[0142] Reverse primer ATT GTC AGT GCC CAA CAG CC(SEQ ID NO.10)

[0143] Probe TCC CTA TTG CCA CGG CGG AAC TCA TCG(SEQ ID NO.11)

[0144] Example 3 Experiment of Lentivirus Infection of Human Lung Cancer Cells (ChaGO-K-1)

[0145] Human lung cancer cells (ChaGO-K-1) were obtained from the Cell Resource Center of Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. RPMI-1640 (purchased from Thermo Fisher Scientific) + 10% FBS (purchased from Gibco) culture medium was used. The culture flask was placed in a carbon dioxide incubator for culture under the conditions of 37°C, 5% CO2. After 24 hours of cell culture, the cell confluence rate was observed under a microscope at 80%-90%, and then the cells were passaged. After three passages, the cells were counted and plated.

[0146] Cell seeding and plating:

[0147] Cell culture plate (6-well plate), culture volume is 2.5 ml / well, cell inoculation amount is 1.00×10 5 ChaGo-K-1 cells were trypsinized and resuspended in 10 ml RPMI-1640 complete medium. The cell count was 1.81×10 6 / ml, diluted 18.1 times, inoculated 4 wells, 1ml ChaGo-K-1 cell suspension + 17.1ml RPMI-1640 complete medium, 2 wells for experiment, the remaining 2 wells for standby. Add 1ml diluted cell suspension + 1.5ml fresh medium to each well, mix gently, culture conditions: 37℃, 5% CO2.

[0148] Virus infection, cell observation:

[0149] The 6-well plates were labeled as ChaGo-K-1 blank and ChaGo-K-1 virus. ChaGo-K-1 cells were added with virus (5.39×10 7 TU) were infected, the cell status was observed under a microscope every day for 24h, 48h, and 72h, and the medium was changed. The volume of the medium was 2.5ml. After the ChaGo-K-1 virus was changed, the virus (5.39×10 7 The experiment was stopped after 72 h, and the cells were digested with trypsin, resuspended in 1 ml of RPMI-1640 complete medium, and counted using a cell counter (Thermo).

[0150] Comparison of cell status at 24-72h Figure 2 As shown, it can be seen that the cell morphology changes after virus infection, the cells do not stretch after attaching to the wall, and the cell growth is obviously inhibited.

[0151] Figure 3 , 4 This is the cell count 72 hours after infection, in which the live cell density of the blank reached 4.28×10 5 / well, while the density of viable cells after virus infection was only 1.06×10 5 / well. The live cell density of blank was 1.00×10 5 / ml increased to 4.28×10 5 / ml. The viable cell density after virus infection increased from 1.00×10 5 / ml increased to 1.06×10 5 / ml. According to the tumor inhibition rate calculation formula T / C = (1-T / C) × 100, where T represents the virus group and C represents the blank group; by calculating the tumor inhibition ratio of the virus group relative to the blank group, the tumor inhibition rate can be calculated to be 75.23%.

[0152] Cell counting results:

[0153]

[0154] In summary, according to the cell growth conditions during the experiment, 72 hours after virus infection, the growth rate of virus-infected ChaGo-K-1 cells was significantly lower than that of ChaGo-K-1 blank cells, and the tumor inhibition rate reached 75.23%, showing an effective effect in inhibiting tumor cell growth.

[0155] Example 4 Experiment of Lentivirus Infection of Human Hepatocellular Carcinoma Cells (Li-7)

[0156] Human hepatoma cells (Li-7) were obtained from the Cell Resource Center of Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. RPMI-1640 (purchased from Thermo Fisher Scientific) + 10% FBS (purchased from Gibco) culture medium was used. The culture flask was placed in a carbon dioxide incubator for culture under the conditions of 37°C and 5% CO2. After 24 hours of cell culture, the cell confluence rate was observed under a microscope at 80%-90%, and then the cells were passaged. After three passages, the cells were counted and plated. Cell inoculation and plating:

[0157] Cell culture plate (6-well plate), culture volume is 2.5 ml / well, cell inoculation amount is 1.00×10 5 Li-7 cells were trypsinized and resuspended in 10 ml RPMI-1640 complete medium. The cell count was 9.91×10 5 / ml, diluted 9.91 times, inoculated 4 wells, 1ml Li-7 cell suspension + 8.91ml RPMI-1640 complete medium, 2 wells for experiment, the remaining 2 wells for standby. Add 1ml diluted cell suspension + 1.5ml fresh medium to each well, mix gently, culture conditions: 37℃, 5% CO2.

[0158] Virus infection, cell observation:

[0159] The 6-well plates were labeled as Li-7 blank and Li-7 virus. Li-7 cells were added with virus (5.39×10 7 TU) were infected for 24h, 48h, and 72h after infection. The cell status was observed under a microscope every day, and the photos were taken and the medium was changed. The volume of the medium was 2.5ml. After the Li-7 virus was changed, the virus (5.39×10 7 The experiment was stopped after 72 h, and the cells were digested with trypsin, resuspended in 1 ml of RPMI-1640 complete medium, and counted using a cell counter (Thermo).

[0160] Comparison of cell status at 24-72h Figure 5 As shown, it can be seen that the cell morphology changes after virus infection, the cells do not stretch after attaching to the wall, and the cell growth is obviously inhibited.

[0161] Figure 6 , 7 The cell counts at 72 hours after infection show that the live cell density of the blank reaches 4.34×10 5 / well, while the density of viable cells after virus infection was only 1.11×10 5 / well. The live cell density of blank was 1.00×10 5 / ml increased to 4.34×10 5 / ml. The viable cell density after virus infection increased from 1.00×105 / ml only increased to 1.11×10 5 / ml. According to the tumor inhibition rate calculation formula T / C = (1-T / C) × 100, where T represents the virus group and C represents the blank group; by calculating the tumor inhibition ratio of the virus group relative to the blank group, the tumor inhibition rate can be calculated to be 74.42%.

[0162] Cell counting results:

[0163]

[0164] In summary, according to the cell growth conditions during the experiment, 72 hours after virus infection, the growth rate of virus-infected Li-7 cells was significantly lower than that of Li-7 blank cells, and the tumor inhibition rate reached 74.42%, showing an effective effect in inhibiting tumor cell growth.

[0165] Example 5 Experiment of Lentivirus Infection of Human Papillary Thyroid Cancer Cells (B-CPAP)

[0166] Human papillary thyroid cancer cells (B-CPAP) were obtained from the Cell Resource Center of Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. RPMI-1640 (purchased from Thermo Fisher Scientific) + 10% FBS (purchased from Gibco) culture medium was used. The culture flask was placed in a carbon dioxide incubator for culture under the conditions of 37°C and 5% CO2. After 24 hours of cell culture, the cell confluence rate was observed under a microscope at 80%-90%, and then the cells were passaged. After three passages, the cells were counted and plated.

[0167] Cell seeding and plating:

[0168] Cell culture plate (6-well plate), culture volume is 2.5 ml / well, cell inoculation amount is 1.00×10 5 B-CPAP cells were trypsinized and resuspended in 10 ml RPMI-1640 complete medium. The cell count was 1.07 × 10 6 / ml, diluted 10.7 times, inoculated 4 wells, 1ml B-CPAP cell suspension + 9.7ml RPMI-1640 complete medium, 2 wells for experiment, the remaining 2 wells for standby. Add 1ml diluted cell suspension + 1.5ml fresh medium to each well, mix gently, culture conditions: 37℃, 5% CO2.

[0169] Virus infection, cell observation:

[0170] The 6-well plates were labeled as B-CPAP blank and B-CPAP virus. Virus (5.39×10 7TU) were infected for 24h, 48h, and 72h after the cell status was observed under a microscope, and the cells were photographed and the medium was changed. The volume of the medium was 2.5ml. B-CPAP virus was added after the medium was changed (5.39×10 7 The experiment was stopped after 72 h, and the cells were digested with trypsin, resuspended in 1 ml of RPMI-1640 complete medium, and counted using a cell counter (Thermo).

[0171] Comparison of cell status at 24-72h Figure 8 As shown, it can be seen that the cell morphology changes after virus infection, the cells do not stretch after attaching to the wall, and the cell growth is obviously inhibited.

[0172] Fig. 9 , 10 The cell counts at 72h after infection, where the live cell density of the blank reached 1.01×10 6 / well, while the density of viable cells after virus infection was only 2.93×10 5 / well. The live cell density of blank was 1.00×10 5 / ml increased to 1.01×10 6 / ml. The viable cell density after virus infection increased from 1.00×10 5 / ml increased to 2.93×10 5 / ml. According to the tumor inhibition rate calculation formula T / C = (1-T / C) × 100, where T represents the virus group and C represents the blank group; by calculating the tumor inhibition ratio of the virus group relative to the blank group, the tumor inhibition rate can be calculated to be 70.99%.

[0173] Cell counting results:

[0174]

[0175] In summary, according to the cell growth conditions during the experiment, 72 hours after virus infection, the growth rate of virus-infected B-CPAP cells was significantly lower than that of B-CPAP blank cells, and the tumor inhibition rate reached 70.99%, showing an effective effect in inhibiting tumor cell growth.

[0176] Example 6 Experiment of Lentivirus Infection of Human Ovarian Cancer Cells (Caov-3)

[0177] Human ovarian cancer cells (Caov-3) were obtained from the Cell Resource Center of Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. DMEM (purchased from Thermo Fisher Scientific) + 10% FBS (purchased from Gibco) culture medium was used. The culture flask was placed in a carbon dioxide incubator for culture under the conditions of 37°C, 5% CO2. After 48 hours of cell culture, the cell confluence rate was observed under a microscope at 80%-90%, and then the cells were passaged. After three passages, the cells were counted and plated.

[0178] Cell seeding and plating:

[0179] Cell culture plate (6-well plate), culture volume is 2.5 ml / well, cell inoculation amount is 1.00×10 5 Caov-3 cells were trypsinized and resuspended in 10 ml DMEM complete medium. The cell count was 1.37 × 10 6 / ml, diluted 13.7 times, inoculated 4 wells, 1ml Caov-3 cell suspension + 12.7ml DMEM complete medium, 2 wells for experiment, the remaining 2 wells for standby. Add 1ml diluted cell suspension + 1.5ml fresh medium to each well, mix gently, culture conditions: 37℃, 5% CO2.

[0180] Virus infection, cell observation:

[0181] The 6-well plates were labeled as Caov-3 blank and Caov-3 virus. Caov-3 cells were added with virus (5.39×10 7 TU) infection, the cell status was observed under a microscope every day at 48h, 72h, and 96h, and the medium was changed with a volume of 2.5ml. After the Caov-3 virus was changed, the virus (5.39×10 7 The experiment was stopped after 96 h, and the cells were digested with trypsin, resuspended in 1 ml of DMEM complete medium, and counted using a cell counter (Thermo).

[0182] Comparison of cell status at 48-96h Figure 2 As shown, it can be seen that the cell morphology changes after virus infection, the cells do not stretch after attaching to the wall, and the cell growth is obviously inhibited.

[0183] Figure 3 The cell counts at 96h after infection show that the live cell density of the blank reached 5.69×10 5 / well, while the viable cell density after virus infection only reached 1.70×10 5 / well. The live cell density of blank was 1.00×10 5 / ml increased to 5.69×10 5 / ml. The viable cell density after virus infection increased from 1.00×10 5 / ml increased to 1.70×10 5 / ml. According to the tumor inhibition rate calculation formula T / C = (1-T / C) × 100, where T represents the virus group and C represents the blank group; by calculating the tumor inhibition ratio of the virus group relative to the blank group, the tumor inhibition rate can be calculated to be 70.12%.

[0184] Cell counting results:

[0185]

[0186]

[0187] In summary, according to the cell growth during the experiment, 96 hours after virus infection, the growth rate of Caov-3 cells infected by the virus was significantly lower than that of Caov-3 blank cells. The tumor inhibition rate reached 70.12%, showing an effective effect of inhibiting tumor cell growth.

[0188] Example 7 Experiment of lentivirus infection of human renal clear cell adenocarcinoma cells (786-0)

[0189] Human renal clear cell adenocarcinoma cells (786-0) were obtained from the Cell Resource Center of Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. RPMI-1640 (purchased from Thermo Fisher Scientific) + 10% FBS (purchased from Gibco) culture medium was used. The culture flask was placed in a carbon dioxide incubator for culture under the conditions of 37°C, 5% CO2. After 24 hours of cell culture, the cell confluence rate was observed under a microscope at 80%-90%, and then the cells were passaged. After three passages, the cells were counted and plated.

[0190] Cell seeding and plating:

[0191] Cell culture plate (6-well plate), culture volume is 2.5 ml / well, cell inoculation amount is 1.00×10 5 786-0 cells were trypsinized and resuspended in 10 ml RPMI-1640 complete medium. The cell count was 8.45 × 10 5 / ml, diluted 8.45 times, inoculated 4 wells, 1ml 786-0 cell suspension + 7.45ml RPMI-1640 complete medium, 2 wells for experiment, the remaining 2 wells for standby. Add 1ml diluted cell suspension + 1.5ml fresh medium to each well, mix gently, culture conditions: 37℃, 5% CO2.

[0192] Virus infection, cell observation:

[0193] The 6-well plates were labeled as 786-0 blank and 786-0 virus. Virus (5.39×10 7 TU) were used to observe the cell status under a microscope every day at 24h, 48h, and 72h after infection, take photos, and change the medium. The volume of the replacement medium was 2.5ml. After the 786-0 virus was replaced, virus (5.39×10 7 The experiment was stopped after 72 h, and the cells were digested with trypsin, resuspended in 1 ml of RPMI-1640 complete medium, and counted using a cell counter (Thermo).

[0194] Comparison of cell status at 24-72h Fig.11 As shown, it can be seen that the cell morphology changes after virus infection, the cells do not stretch after attaching to the wall, and the cell growth is obviously inhibited.

[0195] Fig.12 , 13 The cell counts at 72 hours after infection show that the live cell density of the blank reaches 5.51×10 5 / well, while the viable cell density after virus infection was only 2.11×10 5 / well. The live cell density of blank was 1.00×10 5 / ml increased to 5.51×10 5 / ml. The viable cell density after virus infection increased from 1.00×10 5 / ml increased to 2.11×10 5 / ml. According to the tumor inhibition rate calculation formula T / C = (1-T / C) × 100, where T represents the virus group and C represents the blank group; by calculating the tumor inhibition ratio of the virus group relative to the blank group, the tumor inhibition rate can be calculated to be 61.70%.

[0196] Cell counting results:

[0197]

[0198] In summary, according to the cell growth conditions during the experiment, 72 hours after virus infection, the growth rate of virus-infected 786-0 cells was significantly lower than that of 786-0 blank cells, and the tumor inhibition rate reached 61.70%, showing an effective effect in inhibiting tumor cell growth.

[0199] Example 8 Experiment of Lentivirus Infection of Human Pancreatic Cancer Cells (PANC-1)

[0200] Human pancreatic cancer cells (PANC-1) were obtained from the Cell Resource Center of Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. DMEM (purchased from Thermo Fisher Scientific) + 10% FBS (purchased from Gibco) culture medium was used. The culture flask was placed in a carbon dioxide incubator for culture under the conditions of 37°C, 5% CO2. After 24 hours of cell culture, the cell confluence rate was observed under a microscope at 80%-90%, and then the cells were passaged. After three passages, the cells were counted and plated.

[0201] Cell seeding and plating:

[0202] Cell culture plate (6-well plate), culture volume is 2.5 ml / well, cell inoculation amount is 1.00×10 5 cells / well. PANC-1 cells were trypsinized and resuspended in 10 ml of DMEM complete medium. The cell count was 1.04×10 6 / ml, diluted 10.4 times, inoculated 4 wells, 1ml PANC-1 cell suspension + 9.4ml RPMI-1640 complete medium, 2 wells for experiment, the remaining 2 wells for standby. Add 1ml diluted cell suspension + 1.5ml fresh medium to each well, mix gently, culture conditions: 37℃, 5% CO2.

[0203] Virus infection, cell observation:

[0204] The 6-well plates were labeled as PANC-1 blank and PANC-1 virus. PANC-1 cells were added with virus (5.39×10 7 TU) were used to observe the cell status under a microscope every day at 24h, 48h, and 72h after infection, and take photos and change the medium. The volume of the replacement medium was 2.5ml. After the PANC-1 virus was replaced, virus (5.39×10 7 The experiment was stopped after 72 h, and the cells were digested with trypsin, resuspended in 1 ml of DMEM complete medium, and counted using a cell counter (Thermo).

[0205] Comparison of cell status at 24-72h Fig.14 As shown, it can be seen that the cell morphology changes after virus infection, the cells do not stretch after attaching to the wall, and the cell growth is obviously inhibited.

[0206] Fig.15 , 16 Cell counts at 72h after infection, with the live cell density of the blank reaching 5.75×10 5 / well, while the density of viable cells after virus infection was only 2.58×10 5 / well. The live cell density of blank was 1.00×10 5 / ml increased to 5.75×10 5 / ml. The viable cell density after virus infection increased from 1.00×10 5 / ml increased to 2.58×10 5 / ml. According to the tumor inhibition rate calculation formula T / C = (1-T / C) × 100, where T represents the virus group and C represents the blank group; by calculating the tumor inhibition ratio of the virus group relative to the blank group, the tumor inhibition rate can be calculated to be 55.13%.

[0207] Cell counting results:

[0208]

[0209] In summary, according to the cell growth conditions during the experiment, 72 hours after virus infection, the growth rate of virus-infected PANC-1 cells was significantly lower than that of PANC-1 blank cells, and the tumor inhibition rate reached 55.13%, showing an effective effect in inhibiting tumor cell growth.

[0210] Example 9 Experiment of Lentivirus Infection of Human Endometrial Adenocarcinoma Cells (HEC-1-B)

[0211] Human endometrial adenocarcinoma cells (HEC-1-B) were obtained from the Cell Resource Center of Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. DMEM (purchased from Thermo Fisher Scientific) + 10% FBS (purchased from Gibco) culture medium was used. The culture flask was placed in a carbon dioxide incubator for culture under the conditions of 37°C and 5% CO2. After 24 hours of cell culture, the cell confluence rate was observed under a microscope at 80%-90%, and then the cells were passaged. After three passages, the cells were counted and plated.

[0212] Cell seeding and plating:

[0213] Cell culture plate (6-well plate), culture volume is 2.5 ml / well, cell inoculation amount is 1.00×10 5 cells / well. HEC-1-B cells were trypsinized and resuspended in 10 ml DMEM complete medium. The cell count was 2.82×10 6 / ml, diluted 28 times, inoculated 4 wells, 1ml HEC-1-B cell suspension + 27ml RPMI-1640 complete medium, 2 wells were used for the experiment, and the remaining 2 wells were used as spare. 1ml diluted cell suspension + 1.5ml fresh medium was added to each well, and gently mixed. The culture conditions were: 37℃, 5% CO2.

[0214] Virus infection, cell observation:

[0215] The 6-well plates were labeled HEC-1-B blank and HEC-1-B virus. HEC-1-B cells were added with virus (5.39×107 TU) were used to observe the cell status under a microscope every day for 24h, 48h, and 72h after infection, and take photos and change the medium. The volume of the replacement medium was 2.5ml. After the HEC-1-B virus was replaced, virus (5.39×10 7 The experiment was stopped after 72 h, and the cells were digested with trypsin, resuspended in 1 ml of DMEM complete medium, and counted using a cell counter (Thermo).

[0216] Comparison of cell status at 24-72h Fig.17 As shown, it can be seen that the cell morphology changes after virus infection, the cells do not stretch after attaching to the wall, and the cell growth is obviously inhibited.

[0217] Fig.18 , 19 The cell counts at 72 hours after infection show that the live cell density of the blank reaches 4.34×10 5 / well, while the density of viable cells after virus infection was only 2.17×10 5 / well. The live cell density of blank was 1.00×10 5 / ml increased to 4.34×10 5 / ml. The viable cell density after virus infection increased from 1.00×10 5 / ml increased to 2.17×10 5 / ml. According to the tumor inhibition rate calculation formula T / C = (1-T / C) × 100, where T represents the virus group and C represents the blank group; by calculating the tumor inhibition ratio of the virus group relative to the blank group, the tumor inhibition rate can be calculated to be 50%.

[0218] Cell counting results:

[0219]

[0220] In summary, according to the cell growth conditions during the experiment, 72 hours after virus infection, the growth rate of virus-infected HEC-1-B cells was significantly lower than that of HEC-1-B blank cells, and the tumor inhibition rate reached 50%, showing an effective effect in inhibiting tumor cell growth.

Claims

1. A lentivirus for treating cancer, characterized in that: The cancer treating lentivirus carries hTERT promoter and CDC6shRNA gene.

2. The lentivirus according to claim 1, wherein the hTERT promoter sequence is SEQ ID NO.

2.

3. The lentivirus according to claim 1 or 2, wherein the CDC6shRNA gene sequence is SEQ ID NO.

3. The lentivirus according to claim 1 , wherein the lentivirus carries the hTERT promoter-CDC6 shRNA combination gene.

5. The lentivirus according to claim 4, wherein the hTERT promoter-CDC6shRNA combination gene sequence is SEQ ID NO.

1.

6. Use of the lentivirus according to any one of claims 1 to 5 in the preparation of a drug for treating cancer.

7. The use according to claim 6, wherein the cancer is lung cancer, liver cancer, papillary thyroid cancer, ovarian cancer, renal clear cell adenocarcinoma, pancreatic cancer, or human endometrial adenocarcinoma.

8. The use according to claim 7, wherein the cancer is lung cancer, liver cancer, or papillary thyroid cancer.

9. The use according to claim 8, wherein the cancer is lung cancer.

10. A pharmaceutical composition, characterized in that The pharmaceutical composition comprises the lentivirus according to any one of claims 1 to 5. The pharmaceutical composition according to claim 10 , wherein the pharmaceutical composition further comprises a pharmaceutically acceptable excipient.

12. The pharmaceutical composition according to claim 10 or 11, wherein the pharmaceutical composition is in the form of an injection.

13. The method for preparing a lentivirus according to any one of claims 1 to 5, characterized in that: The method comprises: (1) inserting hTERT promoter and CDC6shRNA gene sequence after the restriction site of the vector to obtain a plasmid; (2) transferring the plasmid into the expression strain, culturing and screening the successfully transferred strain; (3) shaking the successfully transferred strain obtained in step (2) to obtain an hTERT-CDC6shRNA expression plasmid; (4) Packaging the expression plasmid described in step (3) to obtain hTERT-CDC6shRNA lentivirus.

Images