Application of lactyltransferase inhibitor in pancreatic cancer and immunotherapy thereof

Abstract

The invention relates to the technical field of cancer treatment, and provides application of a lactyltransferase inhibitor in pancreatic cancer and immunotherapy thereof. According to the present invention, the histone lactosyltransferase inhibitor and the anti-programmed death receptor-1 antibody are combined to form the composition for pancreatic cancer and immunotherapy thereof, such that the recognition and the removal of the immune system on the cancer cells can be enhanced, the growth of the pancreatic cancer tumor can be effectively inhibited, and the survival time of the pancreatic cancer patient can be prolonged. The histone lactosyltransferase inhibitor reduces the infiltration level of tumor-associated neutrophil, increases the infiltration level of CD8 positive T cells, reverses the composition of a pancreatic cancer inhibitory immune microenvironment, and generates a synergistic anti-tumor effect with an anti-programmed death receptor-1 antibody. The traditional Chinese medicine composition is suitable for early-stage, middle-stage and late-stage treatment of pancreatic cancer, improves the survival rate and the treatment effect of pancreatic cancer patients, remarkably reduces the side effects of treatment and improves the living quality of the pancreatic cancer patients.

Description

Technical Field

[0001] The present invention belongs to the technical field of cancer treatment, and in particular relates to the application of a lactyl transferase inhibitor in pancreatic cancer and immunotherapy thereof. Background Art

[0002] Pancreatic cancer is a malignant tumor of the digestive tract with a poor prognosis. It often has no obvious symptoms in the early stage and is often in the middle or late stage when diagnosed, missing the opportunity for surgical resection, resulting in poor treatment effect and rapid disease progression. In addition, the existing technology for treating pancreatic cancer is limited, and the high recurrence and chemotherapy resistance of the disease make pancreatic cancer also have a high mortality rate.

[0003] Currently, the main treatments for pancreatic cancer include surgical resection, chemotherapy, and radiotherapy. Surgical resection can achieve certain therapeutic effects in patients with early pancreatic cancer, but the overall effectiveness of surgical treatment is limited because most patients are unable to undergo surgery at the time of diagnosis. Chemotherapy and radiotherapy can prolong patient survival in some cases, but they are often accompanied by serious side effects and have limited efficacy in advanced patients. In addition, pancreatic cancer has a very strong immunosuppressive microenvironment, with a small number of tumor-infiltrating lymphocytes and low immune cell activity, so single traditional immunotherapy also has limited efficacy for pancreatic cancer. Summary of the invention

[0004] In view of the deficiencies of the prior art, the present invention provides the use of a lactyl transferase inhibitor in pancreatic cancer and its immunotherapy, which aims to solve the problems mentioned in the background technology.

[0005] In a first aspect, the present invention provides a composition of lactyltransferase inhibitors, which is composed of a histone lactyltransferase inhibitor and an anti-programmed death receptor-1 antibody, wherein the histone lactyltransferase inhibitor is a small molecule compound or an RNA interference molecule that inhibits PCAF activity.

[0006] Furthermore, the small molecule compound is a bromodomain inhibitor.

[0007] Furthermore, the sequence of the RNA interference molecule is shown in SEQ ID NO.1-4.

[0008] In another aspect, the present invention provides use of a composition of lactyl transferase inhibitors in the preparation of a drug for pancreatic cancer and immunotherapy thereof.

[0009] Furthermore, the drug is used for the early, middle or late stage treatment of pancreatic cancer.

[0010] Furthermore, the drug treats pancreatic cancer by reducing tumor neutrophil infiltration, increasing CD8-positive T cell infiltration, and reversing the suppressive immune microenvironment of pancreatic cancer.

[0011] Furthermore, the drug includes one or more pharmaceutical carriers or pharmaceutical excipients of the composition.

[0012] Furthermore, the drug is administered by injection.

[0013] The present invention has the following technical effects: (1) The use of a combination of histone lactyltransferase inhibitors and anti-programmed death receptor-1 antibodies for pancreatic cancer and its immunotherapy can enhance the immune system's recognition and clearance of cancer cells, effectively inhibit the growth of pancreatic cancer tumors, and prolong the survival of pancreatic cancer patients. Histone lactyltransferase inhibitors specifically reduce the level of H3K18la (lactylation modification of lysine 18 at histone H3) in pancreatic cancer cells, reduce the infiltration level of tumor-associated neutrophils, increase the infiltration level of CD8-positive T cells, and reverse the composition of the inhibitory immune microenvironment of pancreatic cancer, thereby producing a synergistic anti-tumor effect with anti-programmed death receptor-1 antibodies. The combination of lactyltransferase inhibitors is suitable for the early, mid-term and late-stage treatment of pancreatic cancer, especially for patients who are resistant to existing therapies. It can also improve the survival rate and treatment effect of pancreatic cancer patients, while significantly reducing the side effects of treatment and improving the quality of life of pancreatic cancer patients.

[0014] (2) The lactoacyltransferase inhibitor is a small molecule compound or RNA interference molecule that inhibits the activity of PCAF (p300 / CBP-associated factor, a histone acetyltransferase) and has the function of inhibiting the activity of histone lactoacyltransferase. In particular, Bromosporine can significantly reduce the level of H3K18la in pancreatic cancer cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] A more complete understanding of exemplary embodiments of the present invention may be obtained by referring to the following drawings: Figure 1 In Example 1 of the present invention, the effects of blank solvent and various histone acetyltransferase inhibitors on the level of H3K18la (lysine 18th lactylation modification of histone H3) in the pancreatic cancer cell line BxPC3 were detected by Western blotting, and Histone H3 (histone H3) was used as the internal reference protein.

[0016] Figure 2 The binding of PCAF (p300 / CBP-associated factor, a histone acetyltransferase) with acetyl-CoA and lactyl-CoA was simulated by molecular docking using Autodock software (automatic molecular docking software) in Example 1 of the present invention, wherein Figure 2 a in the equation is the binding of PCAF to acetyl-CoA. Figure 2b in the figure represents the binding of PCAF to lactyl-CoA.

[0017] Figure 3 In Example 1 of the present invention, the modification level of H3K18la and the expression of the internal reference protein Histone H3 in four pancreatic cancer cells treated with different concentrations of Bromosporine were detected by Western blotting.

[0018] Figure 4 In Example 1 of the present invention, the levels of H3K18la, Histone H3, PCAF and β-Actin (β-actin) in the two pancreatic cancer cells after control and knockdown of shPCAF were detected by Western blotting.

[0019] Figure 5 This is the ratio of neutrophils in subcutaneous transplanted tumors of euthanized mice treated with blank solvent and Bromosporine in Example 2 of the present invention.

[0020] Figure 6 This is the ratio of CD8 positive T cells in the subcutaneous transplanted tumors of euthanized mice treated with blank solvent and Bromosporine in Example 2 of the present invention.

[0021] Figure 7 This is the curve showing the change in tumor volume of subcutaneous transplanted tumors in Example 2 of the present invention, under the condition of blank solvent and Bromosporine treatment.

[0022] Figure 8 The morphology and size of subcutaneous transplanted tumors in euthanized mice treated with blank solvent and Bromosporine in Example 2 of the present invention.

[0023] Fig. 9 This is a statistical graph of the subcutaneous transplanted tumor mass of euthanized mice treated with blank solvent and Bromosporine in Example 2 of the present invention.

[0024] Fig.10 This is a curve showing the change in volume of subcutaneous transplanted tumors in mice in the control group, monotherapy group 1, monotherapy group 2 and combination therapy group in Example 3 of the present invention.

[0025] Fig.11 The morphology and size of subcutaneous transplanted tumors of euthanized mice in the control group, monotherapy group 1, monotherapy group 2 and combination therapy group in Example 3 of the present invention.

[0026] Fig.12This is a statistical chart of the subcutaneous transplanted tumor mass of euthanized mice in the control group, monotherapy group 1, monotherapy group 2 and combination therapy group in Example 3 of the present invention.

[0027] Fig.13 This is the body weight change curve of mice suffering from pancreatic cancer in the control group, monotherapy group 1, monotherapy group 2 and combination therapy group in Example 3 of the present invention.

[0028] Fig.14 These are photos of kidneys of euthanized mice in the control group, monotherapy group 1, monotherapy group 2, and combination therapy group in Example 3 of the present invention.

[0029] Fig.15 This is a statistical chart of kidney weights of euthanized mice in the control group, monotherapy group 1, monotherapy group 2, and combination therapy group in Example 3 of the present invention.

[0030] Fig.16 In Example 3 of the present invention, the expression levels and distribution of Ly6G and CD8 proteins in subcutaneous transplanted tumors of mice in the control group, monotherapy group 1, monotherapy group 2 and combination therapy group were detected by immunohistochemistry.

[0031] Fig.17 This is a statistical graph of the proportion of neutrophils and CD8-positive T cells in subcutaneous transplanted tumors of mice in the control group, monotherapy group 1, monotherapy group 2, and combination therapy group in Example 3 of the present invention, wherein Fig.17 a in the figure is the neutrophil ratio statistical chart, Fig.17 Figure b is a statistical chart of the proportion of CD8 positive T cells.

[0032] Fig.18 These are representative photographs of mice bearing pancreatic cancer orthotopic transplanted tumors in the control group, monotherapy group 1, monotherapy group 2, and combination therapy group detected by fluorescence in situ imaging in Example 4 of the present invention.

[0033] Fig.19 This is a statistical graph of the total fluorescence flux of pancreatic cancer orthotopic transplanted tumor mice detected by fluorescence in situ imaging in the control group, single drug treatment group 1, single drug treatment group 2 and combined treatment group in Example 4 of the present invention.

[0034] Fig. 20 This is the survival curve of mice with orthotopic transplanted pancreatic cancer in the control group, monotherapy group 1, monotherapy group 2 and combination therapy group in Example 4 of the present invention. DETAILED DESCRIPTION

[0035] In order to make the technical problems, technical solutions and beneficial effects to be solved by the present invention more clearly understood, the present invention is further described in detail below in conjunction with the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0036] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present invention belongs; the terms used herein are only for the purpose of describing specific embodiments rather than limiting the present invention.

[0037] In some embodiments, the present invention provides a composition of lactyltransferase inhibitors, which consists of a histone lactyltransferase inhibitor and an anti-programmed death receptor-1 antibody. The histone lactyltransferase inhibitor is one or more molecules that inhibit the activity of histone lactyltransferase. The molecules that inhibit the activity of histone lactyltransferase are small molecule compounds or RNA interference molecules that inhibit the activity of PCAF (p300 / CBP-associated factor, a histone acetyltransferase).

[0038] Specifically, the small molecule compound is a bromodomain inhibitor.

[0039] Specifically, the sequence of the RNA interference molecule is shown in SEQ ID NO.1-4.

[0040] In some embodiments, the present invention provides use of a composition of lactyl transferase inhibitors in the preparation of a drug for pancreatic cancer and immunotherapy thereof.

[0041] Specifically, the drug is used to treat pancreatic cancer in the early, middle or late stages.

[0042] Specifically, the drug treats pancreatic cancer by reducing tumor neutrophil infiltration, increasing CD8-positive T cell infiltration, and reversing the suppressive immune microenvironment of pancreatic cancer.

[0043] Specifically, the drug includes one or more pharmaceutically acceptable carriers or pharmaceutically acceptable excipients of the composition.

[0044] In particular, the drug is administered by injection.

[0045] It can be understood that the use of histone lactyltransferase inhibitors in combination with anti-programmed death receptor-1 antibodies as a composition for pancreatic cancer and its immunotherapy can enhance the immune system's recognition and elimination of cancer cells, effectively inhibit the growth of pancreatic cancer tumors, and prolong the survival of pancreatic cancer patients. Histone lactyltransferase inhibitors specifically reduce the level of H3K18la (lysine lactylation modification at position 18 of histone H3) in pancreatic cancer cells, reduce the infiltration level of tumor neutrophils, increase the infiltration level of CD8-positive T cells, and reverse the composition of the inhibitory immune microenvironment of pancreatic cancer, thereby producing a synergistic anti-tumor effect with anti-programmed death receptor-1 antibodies.

[0046] The composition of the lactyl transferase inhibitor is suitable for the early, middle and late treatment of pancreatic cancer, and is particularly suitable for patients who are resistant to existing therapies. It can also improve the survival rate and treatment effect of pancreatic cancer patients, while significantly reducing the side effects of treatment and improving the quality of life of pancreatic cancer patients.

[0047] The lactyltransferase inhibitor is a small molecule compound or RNA interference molecule that inhibits PCAF activity and has the function of inhibiting the activity of histone lactyltransferase. In particular, the bromodomain inhibitor can strongly reduce the level of H3K18la in pancreatic cancer cells.

[0048] Experimental Materials: (1) Human pancreatic cancer cells BxPC3, PANC1, and MIA PaCa-2 and mouse pancreatic cancer cells KPC and PANC02 were obtained from ATCC (American Type Culture Collection).

[0049] (2) The experimental mice were 6-8 weeks old male C57BL / 6J mice.

[0050] (3) The shRNA sequences for knocking down PCAF (p300 / CBP-associated factor, a histone acetyltransferase) are: Human 1#: GCAGACTTACAGCGAGTCTTT (SEQ ID NO. 1); Human 2#: GCAGATACCAAACAAGTTTAT (SEQ ID NO. 2); Mouse source 1#: CTCTTGAGAAACGCACGCTTA (SEQ ID NO. 3); Mouse source 2#: AGTGGTATCTAGACTATTAAT (SEQ ID NO. 4).

[0051] Embodiment 1: like Figure 1As shown, the effects of blank solvent and various histone acetyltransferase inhibitors on the level of H3K18la (lysine 18th position acylation modification of histone H3) in the pancreatic cancer cell line BxPC3 were detected by Western blotting. Histone H3 was used as the internal reference protein. It can be seen that the decrease in the level of H3K18la after treatment with Bromosporine was the most obvious. Bromosporine is a bromodomain inhibitor that inhibits PCAF activity.

[0052] As shown in Table 1, Table 1 shows the names of 8 acetyltransferase inhibitors and their targeted histone acetyltransferases: Table 1 Names of acetyltransferase inhibitors and their targeted histone acetyltransferases

[0053] like Figure 2 As shown, molecular docking simulation was performed using Autodock software (automatic molecular docking software), and it was found that the affinity between PCAF protein and acetyl-CoA and lactyl-CoA was comparable, and the binding sites were also very close. It can be seen that PCAF may be a lactoyl transferase for H3K18la.

[0054] like Figure 3 As shown, the modification level of H3K18la was detected by Western blotting after treating human pancreatic cancer cells BxPC3 and PANC1 and mouse pancreatic cancer cells KPC and PANC02 with 0, 5, and 20 μM Bromosporine, respectively. It can be seen that with the increase of Bromosporine concentration, the level of H3K18la in each pancreatic cancer cell line decreased.

[0055] like Figure 4 As shown, PCAF was knocked down by shRNA in human pancreatic cancer cells BxPC3 and PANC1, and the levels of H3K18la, Histone H3, PCAF and β-Actin (β-actin) in the control and two pancreatic cancer cells after shPCAF knockdown were detected by Western blotting. It can be seen that the level of H3K18la in human pancreatic cancer cells BxPC3 and PANC1 was decreased due to PCAF knockdown.

[0056] The level of H3K18la in pancreatic cancer cells directly reflects the degree of histone lactylation. A high level of H3K18la means a high degree of histone lactylation, and vice versa. In pancreatic cancer, histone lactylation is associated with the activation of oncogenes. Lactic acid, as the end product of glycolysis, accumulates in the tumor microenvironment, promoting epigenetic regulation of tumor cells, that is, inhibiting histone lactylation may prevent the progression of pancreatic cancer. In summary, the level of H3K18la in pancreatic cancer cell lines can be reduced by inhibiting PCAF activity, which can be used to treat pancreatic cancer.

[0057] Embodiment 2: (1) The mouse subcutaneous tumor formation experiment was approved by the Experimental Animal Welfare Ethics Committee of the First Affiliated Hospital of Nanchang University, with approval number CDYFY-IACUC-202407QR128. Mouse pancreatic cancer cells KPC and Matrigel (a basement membrane matrix extracted from mouse Engelbreth-Holm-Swarm (EHS) tumor cells) were mixed in a ratio of 2:1 to prepare a suspension; then 100 μL of the suspension (3×10 6 Normal mice were induced to develop pancreatic cancer by subcutaneous injection of 100 cells into the right abdomen of 6-8 week old male C57BL / 6J mice; (2) When the volume of the subcutaneous transplanted tumor reached 100-200 mm³, the pancreatic cancer mice received daily injections of Bromosporine for 10 consecutive days, and the volume of the subcutaneous transplanted tumors of the treated mice was measured every day. The pancreatic cancer mice that completed the treatment were euthanized, and the subcutaneous transplanted tumors of the euthanized mice were removed. Finally, the subcutaneous transplanted tumors were weighed and photographed.

[0058] (3) Subcutaneous transplanted tumor tissue was minced and incubated in RPMI 1640 medium containing mouse tissue digestion enzymes at 37°C for 1 hour, and then filtered through a 70 µM cell mesh to prepare a single cell suspension. For staining of intracellular markers, the cell suspension was pre-incubated with a cell activation mixture at 37°C for 4 hours, and then incubated with fluorescently labeled antibodies in intracellular staining permeabilization wash buffer (Elabscience) at 4°C for 1 hour. Flow cytometric analysis was performed on a DxFLEX flow cytometer, and the data were analyzed using FlowJo software (flow cytometry data analysis software).

[0059] The fluorescently labeled antibodies used include: anti-CD45 antibody, FITC anti-CD3 antibody, anti-CD4 antibody, anti-CD8a antibody, anti-CD11b antibody, anti-Ly-6G antibody, anti-TIGIT antibody, anti-CD279 (PD-1) antibody, and anti-Granzyme B recombinant antibody.

[0060] Flow cytometry analysis results Figure 5 and Figure 6 As shown, Figure 5 The results show the infiltration level of neutrophils in subcutaneous transplanted tumors. Figure 6 The results show the infiltration level of CD8 positive T cells in subcutaneous transplanted tumors. It can be seen that after Bromosporine treatment, the infiltration level of tumor-associated neutrophils in subcutaneous transplanted tumors was significantly reduced, and the infiltration level of CD8 positive T cells was significantly increased; the treatment of subcutaneous transplanted tumors is shown in Figure 2. Figure 7-Figure 9 As shown, Figure 7 The figure shows the change curve of subcutaneous transplanted tumor volume. Figure 8 Shown are the morphology and size of subcutaneous transplanted tumors in euthanized mice. Fig. 9 Shown are statistical graphs of subcutaneous tumor masses from euthanized mice.

[0061] It can be seen that Bromosporine inhibited the growth of subcutaneous transplanted tumors in mice.

[0062] Embodiment 3: (1) The pancreatic cancer-bearing mice of Example 2 were randomly divided into the following 4 groups: Control group: treated with blank solvent (dimethyl sulfoxide) and isotype control antibody (IgG2a); Monotherapy group 1: treated with Bromosporine (30 mg / kg) and isotype control antibody (IgG2a); Monotherapy group 2: treated with blank solvent (dimethyl sulfoxide) and anti-PDR-1 monoclonal antibody (200 μg / mouse); Combined treatment group: treated with Bromosporine (30 mg / kg) and anti-PD-1 monoclonal antibody (200 μg / mouse).

[0063] (2) Thirteen days after subcutaneous injection, the control group, monotherapy group 1, monotherapy group 2, and combination therapy group received injection treatments, respectively. The blank solvent / Bromosporine was injected on the 1st, 4th, 8th, and 11th days after the start of treatment, and the IgG2a / anti-programmed death receptor-1 monoclonal antibody was injected on the 2nd, 3rd, 5th, 9th, 10th, and 12th days after the start of treatment. From the beginning of treatment, the size of the subcutaneous transplanted tumor was measured with a vernier caliper, and its volume was calculated according to the formula: Volume = (shortest diameter of the tumor × longest diameter of the tumor) / 2, and the differences in tumor growth curves among the groups were compared. The pancreatic cancer mice that completed the treatment were euthanized, and the subcutaneous transplanted tumors of the euthanized mice were removed. Finally, the subcutaneous transplanted tumors were weighed and photographed.

[0064] The treatment results of each group were Figure 10-15 As shown, Fig.10 Shown are the curves of changes in the subcutaneous transplanted tumor volumes of mice in the control group, monotherapy group 1, monotherapy group 2, and combination therapy group; Fig.11 Shown are the morphology and size of subcutaneous transplanted tumors in euthanized mice in the control group, monotherapy group 1, monotherapy group 2, and combination therapy group; Fig.12 Shown are statistical graphs of subcutaneous transplanted tumor masses of euthanized mice in the control group, monotherapy group 1, monotherapy group 2, and combination therapy group; Fig.13 Shown are the body weight change curves of pancreatic cancer-bearing mice in the control group, monotherapy group 1, monotherapy group 2, and combination therapy group; Fig.14 Shown are photos of kidneys of euthanized mice in the control group, monotherapy group 1, monotherapy group 2, and combination therapy group; Fig.15 Shown are statistical graphs of kidney weights of euthanized mice in the control group, monotherapy group 1, monotherapy group 2, and combination therapy group.

[0065] It can be seen that compared with monotherapy group 1 and monotherapy group 2, the combined treatment group significantly inhibited the growth of subcutaneous transplanted tumors, and the combined treatment group had no significant effect on the body weight and kidneys of mice.

[0066] The results of immunohistochemical detection were Fig.16 and Fig.17 As shown, Fig.16 Shown are the expression levels and distribution of Ly6G and CD8 proteins in subcutaneous transplanted tumors of mice in the control group, monotherapy group 1, monotherapy group 2, and combination therapy group; Fig.17 Shown are statistical graphs of the proportions of neutrophils and CD8-positive T cells in subcutaneous transplanted tumors of mice in the control group, monotherapy group 1, monotherapy group 2, and combination therapy group.

[0067] It can be seen that compared with monotherapy group 1 and monotherapy group 2, the combination treatment group can better activate CD8-positive T cells and inhibit neutrophils.

[0068] Embodiment 4: (1) A pancreatic cancer orthotopic transplant tumor model was constructed using fluorescently labeled mouse pancreatic cancer cell KPC cells, and fluorescent in situ imaging was performed. First, the fluorescently labeled mouse pancreatic cancer cell KPC cells were cultured to the logarithmic growth phase and collected to prepare a cell suspension of fluorescently labeled mouse pancreatic cancer cell KPC cells. Then, the pancreas of immunodeficient 6-8 week old male C57BL / 6J mice was anesthetized, the pancreas of immunodeficient 6-8 week old male C57BL / 6J mice was exposed, and 50 μL of the cell suspension of fluorescently labeled mouse pancreatic cancer cell KPC cells (2×10 6The cells were injected into the pancreas of 6-8 week-old immunodeficient male C57BL / 6J mice. After injection, the injection site was gently pressed and the incision was sutured to ensure that the mice with pancreatic cancer orthotopic transplanted tumors recovered and had no postoperative complications. One week after surgery, 150 mg / kg D-luciferin potassium salt was injected into the peritoneum of the pancreatic cancer orthotopic transplanted tumor mice to activate the fluorescent signal of the mouse pancreatic cancer cells KPC cells containing fluorescent markers; after 10-15 minutes, the in vivo fluorescence imaging system was used to image and record the intensity and distribution of the fluorescence signal, evaluate the growth of the orthotopic transplanted tumors in the pancreatic cancer orthotopic transplanted tumor mice, and analyze the volume of the orthotopic transplanted tumors using the imaging system.

[0069] (2) Mice bearing orthotopic pancreatic cancer were randomly divided into the following 4 groups: Control group: treated with blank solvent (dimethyl sulfoxide) and isotype control antibody (IgG2a); Monotherapy group 1: treated with Bromosporine (30 mg / kg) and isotype control antibody (IgG2a); Monotherapy group 2: treated with blank solvent (dimethyl sulfoxide) and anti-PDR-1 monoclonal antibody (200 μg / mouse); Combined treatment group: treated with Bromosporine (30 mg / kg) and anti-PD-1 monoclonal antibody (200 μg / mouse).

[0070] All treatments were administered by intraperitoneal injection, with blank solvent / Bromosporine injected on days 1, 4, 8, and 11 after treatment, and IgG2a / anti-programmed death receptor-1 monoclonal antibody injected on days 2, 3, 5, 9, 10, and 12 after treatment. Figure 18-Figure 20 As shown, Fig.18 Shown are representative photos of mice with pancreatic cancer orthotopic xenografts in the control group, monotherapy group 1, monotherapy group 2, and combination therapy group on day 7 of treatment; Fig.19 Shown is a statistical graph of the total fluorescence flux of pancreatic cancer orthotopic transplanted tumor mice in the control group, monotherapy group 1, monotherapy group 2 and combination therapy group on the seventh day of treatment; Fig. 20 Shown are the survival curves of mice bearing orthotopic transplanted pancreatic cancer in the control group, monotherapy group 1, monotherapy group 2, and combination therapy group.

[0071] It can be seen that the combination of Bromosporine and anti-programmed death receptor-1 monoclonal antibody significantly inhibited the growth of orthotopic transplanted tumors and increased the survival probability of mice.

[0072] In summary, histone lactyltransferase inhibitors specifically reduce the level of H3K18la in pancreatic cancer cells, reduce the infiltration level of tumor neutrophils, increase the infiltration level of CD8-positive T cells, and reverse the composition of the inhibitory immune microenvironment of pancreatic cancer, thereby producing a synergistic anti-tumor effect with anti-programmed death receptor-1 antibodies. Histone lactyltransferase inhibitors combined with anti-programmed death receptor-1 antibodies are used in pancreatic cancer and its immunotherapy drugs, which can significantly inhibit the malignant progression of pancreatic cancer, and its effect is significant and the toxic side effects are small. And the activity of histone lactyltransferase can be inhibited by inhibiting PCAF activity. The method of inhibiting PCAF activity includes knocking down the shRNA sequence of PCAF and using a PCAF inhibitor. The shRNA sequence is shown in SEQ ID NO.1-4, and the PCAF inhibitor can be Bromosporine.

[0073] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A composition of a lactyl transferase inhibitor, characterized in that: The composition consists of a histone lactyl transferase inhibitor and an anti-programmed death receptor-1 antibody. The histone lactyl transferase inhibitor is a small molecule compound or an RNA interference molecule that inhibits PCAF activity.

2. The composition of lactyl transferase inhibitor according to claim 1, characterized in that: The small molecule compound is a bromodomain inhibitor.

3. The composition of lactyl transferase inhibitor according to claim 1, characterized in that: The sequences of the RNA interference molecules are shown in SEQ ID NO.1-4.

4. Use of a composition of lactyl transferase inhibitors in the preparation of drugs for pancreatic cancer and its immunotherapy.

5. Use of the composition of lactyl transferase inhibitors according to claim 4 in the preparation of drugs for pancreatic cancer and immunotherapy thereof, characterized in that: The medicine is used for the early, middle or late stage treatment of pancreatic cancer.

6. Use of the composition of lactyl transferase inhibitors according to claim 5 in the preparation of drugs for pancreatic cancer and immunotherapy thereof, characterized in that: The drug treats pancreatic cancer by reducing tumor neutrophil infiltration, increasing CD8-positive T cell infiltration, and reversing the suppressive immune microenvironment of pancreatic cancer.

7. The use according to claim 6, characterized in that: The medicament includes one or more pharmaceutically acceptable carriers or pharmaceutically acceptable excipients of the composition.

8. The use according to claim 7, characterized in that: The drug is administered by injection.

Images