A molecular marker, primer combination, kit and application related to the fruit orientation of chinese pepper

By developing specific molecular markers and primer combinations upstream of the Up gene, and using PCR amplification and electrophoresis detection, the problem of accurate identification of fruit orientation in Chinese peppers was solved, achieving efficient and accurate fruit orientation identification.

CN119592740BActive Publication Date: 2026-04-17INSTITUTE OF VEGETABLES & FLOWERS CHINESE ACADEMY OF AGRICULTURAL SCIENCES
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510087105.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-01-20
Publication Date
2026-04-17
Estimated Expiration
2045-01-20

AI Technical Summary

Technical Problem

The lack of accurate and stable molecular markers in existing technologies for identifying the orientation of Chinese chili pepper fruits leads to inaccurate genetic mapping.

Method used

A specific molecular marker and its primer combination were developed, and the orientation of Chinese pepper fruits was identified by PCR amplification and electrophoresis using an 8104bp structural variation site located upstream of the Up gene.

Benefits of technology

It enables precise identification of the orientation of Chinese chili pepper fruits during the seedling stage, improving the identification effect and accuracy, and achieving 100% ability to distinguish between fruits facing upwards and downwards.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119592740B_ABST
    Figure CN119592740B_ABST
Patent Text Reader

Abstract

The application discloses a molecular marker, a primer combination, a kit and application related to fruit orientation of Chinese pepper. The application successfully locates a key variation site related to fruit orientation of Chinese pepper on the upstream of Up gene by combining comparative genomics and resequencing analysis, designs a molecular marker primer based on the variation site, and verifies that the variation can affect fruit orientation by using a Chinese pepper population. The development and utilization of the molecular marker can precisely identify fruit orientation of Chinese pepper at the seedling stage. Unlike traditional genetic linkage markers, the molecular marker of the application is located on the upstream of the gene, not a linkage marker, and therefore has higher identification effect and accuracy.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular breeding technology, specifically to a molecular marker, primer combination, kit, and application related to the orientation of Chinese chili pepper fruits. Background Technology

[0002] Chili peppers (Capsicum spp.) belong to the genus Capsicum in the family Solanaceae and originated in the tropical and subtropical regions of the Americas. There are five cultivated species: annual pepper (Capsicum annuum L.), shrub pepper (Capsicum frutescens L.), Chinese pepper (Capsicum chinense Jacq.), drooping pepper (Capsicum baccatum L.), and hairy pepper (Capsicum pubescens Ruiz & Pa). As one of the world's most important vegetable crops, chili peppers have significant economic and industrial value. With the development of molecular marker technology, they have been widely applied in research and applications such as assessing diversity and phylogenetic relationships in chili peppers, constructing genetic maps, and performing marker-assisted selection (MAS).

[0003] With the rapid development of high-throughput sequencing technology, an increasing number of high-quality chili genomes have been published, providing higher accuracy for chili variation detection. This provides a reliable basis for analyzing chili diversity using structural variations (SVs).

[0004] Among Solanaceae crops, fruit orientation is a unique trait of chili peppers. The shift in fruit tip direction from the upright of wild types to the drooping of cultivated varieties was significant for the domestication of chili peppers. Wild chili peppers face upwards, an orientation that may have facilitated bird foraging and thus promoted seed dispersal. During selective domestication, chili pepper varieties with downward-facing fruits emerged, a change likely related to increased fruit size and better resistance to biotic and abiotic threats. Downward-facing fruits reduce bird foraging and minimize damage from direct sunlight.

[0005] The genetic control of fruit orientation in chili peppers is simple, governed by the Up locus located on chromosome 12. Related molecular markers have been reported, including A2C7469 (genetic distance from fruit orientation of 1.7 cM) and upCAPS (genetic distance from fruit orientation of 4.3 cM). However, when these molecular markers were used for genetic mapping studies, the chili pepper genome sequence was not yet fully understood, and precise physical candidate regions and genes could not be identified.

[0006] The publication of the chili pepper genome sequence in 2014 provided a foundation for determining the physical location of the trait. In 2016, Han et al. (2016) constructed a high-density map by resequencing a population of recombinant inbred lines and their parents, and located the QTLs for fruit orientation to chromosomes 1, 4, and 12, respectively. Cheng et al. (2016) used Zunla-1 as a reference genome and constructed a microarray using resequencing data for genetic mapping, locating chili pepper fruit orientation to the 36.54 Mb to 41.06 Mb interval on chromosome 12. Based on the annotation of the Zunla-1 genome, they predicted a total of 65 protein-coding genes. Cao et al., using Zunla-1 as a reference genome, located a 579 bp structural variant related to fruit orientation in one-year-old chili peppers using genome-wide association analysis and pooled sequencing analysis.

[0007] There is still a need to develop an accurate, stable, and reliable molecular marker related to the orientation of Chinese chili pepper fruits. Summary of the Invention

[0008] To address at least some of the technical problems in the prior art, this invention provides a molecular marker, primer combination, kit, and application related to the orientation of Chinese chili pepper fruits. Specifically, this invention includes the following:

[0009] In a first aspect, the present invention provides a molecular marker associated with the orientation of Chinese chili pepper fruits, said molecular marker being a structurally variable molecular marker having the sequence shown in SEQ ID NO.1.

[0010] In a second aspect, the present invention provides a primer combination for amplifying the molecular marker described in the first aspect.

[0011] In some embodiments, according to the primer combination of the present invention, the primer combination includes a forward primer and a reverse primer.

[0012] In some embodiments, according to the primer combination of the present invention, the primer combination comprises:

[0013] The forward primer shown in SEQ ID NO.2 is used to amplify the first fragment, and the reverse primer shown in SEQ ID NO.3 is used to amplify the first fragment;

[0014] The forward primer shown in SEQ ID NO.4 for amplifying the second fragment, and the reverse primer shown in SEQ ID NO.5 for amplifying the second fragment;

[0015] The forward primer shown in SEQ ID NO.6 for amplifying the third fragment, and the reverse primer shown in SEQ ID NO.7 for amplifying the third fragment;

[0016] The forward primer shown in SEQ ID NO. 8 for amplifying the fourth fragment, and the reverse primer shown in SEQ ID NO. 9 for amplifying the fourth fragment; and

[0017] The forward primer shown in SEQ ID NO.10 is used to amplify the fifth fragment, and the reverse primer shown in SEQ ID NO.11 is used to amplify the fifth fragment.

[0018] A third aspect of the present invention provides a kit for identifying the orientation of Chinese chili pepper fruits, comprising the primer combination described in this invention.

[0019] A fourth aspect of the invention provides the application of the molecular markers, primer combinations, or kits described in the invention in the genetic analysis of Chinese peppers.

[0020] In some embodiments, according to the application described in the present invention, the genetic analysis includes genetic diversity analysis, germplasm identification, or assisted breeding.

[0021] A fifth aspect of the present invention provides a method for identifying the orientation of Chinese chili pepper fruits, comprising the step of detecting the presence of a molecular marker of the sequence shown in SEQ ID NO.1 in the DNA of the Chinese chili pepper to be identified.

[0022] In some embodiments, the method for identifying the orientation of Chinese chili pepper fruits according to the present invention includes the following steps:

[0023] (1) Extract DNA from the sample;

[0024] (2) Using the primer combination described in this invention, nucleic acids containing the molecular marker are amplified from the sample DNA by PCR; and

[0025] (3) The orientation of Chinese chili pepper fruits was determined by detecting the length of the PCR products in the samples by electrophoresis.

[0026] In some embodiments, according to the method for identifying the orientation of Chinese chili pepper fruits according to the present invention, the Chinese chili pepper fruit is oriented downwards when the molecular marker is present, and upwards when the molecular marker is absent.

[0027] This invention, combining comparative genomics and resequencing analysis, successfully located a key variant site upstream of the Up gene associated with fruit orientation in Chinese chili peppers. Based on this variant site, molecular marker primers were designed, and the effect of this variant on fruit orientation was verified using a Chinese chili pepper population. The development and utilization of this molecular marker enables precise identification of Chinese chili pepper fruit orientation at the seedling stage. Unlike traditional linkage markers, the molecular marker of this invention is located upstream of the gene, rather than being a linkage marker, thus exhibiting higher identification efficacy and accuracy. Attached Figure Description

[0028] Figure 1 Examples of fruit orientation phenotypes: a: fruit facing upwards, b: fruit facing downwards.

[0029] Figure 2 Figure a: Upstream sequence of the Up gene; Figure b: PCR amplification agarose gel electrophoresis results. Detailed Implementation

[0030] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0031] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that the upper and lower limits of the range and each intermediate value between them are specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, are also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0032] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0033] Molecular markers

[0034] In a first aspect, the present invention provides a specific molecular marker having a characteristic sequence that distinguishes the fruit orientation of Chinese chili pepper materials. This molecular marker is a structural variation of 8104 bp located 717 bp upstream of the Up gene. In one specific embodiment, the sequence has the nucleotide sequence shown in SEQ ID NO.1.

[0035] Primer combination

[0036] A second aspect of the present invention provides a specific primer combination for amplifying the molecular markers described herein, comprising a forward primer and a reverse primer. In one specific embodiment, the primer combination comprises:

[0037] The forward primer shown in SEQ ID NO.2 is used to amplify the first fragment, and the reverse primer shown in SEQ ID NO.3 is used to amplify the first fragment;

[0038] The forward primer shown in SEQ ID NO.4 for amplifying the second fragment, and the reverse primer shown in SEQ ID NO.5 for amplifying the second fragment;

[0039] The forward primer shown in SEQ ID NO.6 for amplifying the third fragment, and the reverse primer shown in SEQ ID NO.7 for amplifying the third fragment;

[0040] The forward primer shown in SEQ ID NO. 8 for amplifying the fourth fragment, and the reverse primer shown in SEQ ID NO. 9 for amplifying the fourth fragment; and

[0041] The forward primer shown in SEQ ID NO.10 is used to amplify the fifth fragment, and the reverse primer shown in SEQ ID NO.11 is used to amplify the fifth fragment.

[0042] Reagent test kit

[0043] This invention also provides a kit for identifying the orientation of Chinese pepper fruits, comprising the primer combination described herein and optional reagents for polymerase chain reaction (PCR). The reagents for PCR include any reagents used in conventional PCR, such as polymerases, buffers, etc.

[0044] In addition to the components described above, the kit of the present invention may also include precautions related to the regulation of manufacturing, use, or sale of the diagnostic kit. Furthermore, the kit of the present invention may also provide detailed instructions for use, storage, and troubleshooting. The kit may optionally be housed in a suitable device, preferably for high-throughput robotic operation.

[0045] In some embodiments, the components of the kit of the present invention may be provided as dry powder. When the reagents and / or components are provided as dry powder, the powder may be reconstituted by adding a suitable solvent. It is contemplated that the solvent may also be provided in another container. The container typically includes at least one vial, test tube, flask, bottle, syringe, and / or other container means in which the solvent may optionally be placed in equal portions. The kit may also include means for containing a second container of sterile, pharmaceutically acceptable buffers and / or other solvents.

[0046] In some embodiments, the components of the kit of the present invention may be provided in solution form, such as an aqueous solution. When present in aqueous solution form, the concentration or content of these components can be readily determined by those skilled in the art according to different needs. For example, for storage purposes, the component concentration may be higher, and when in operation or in use, the concentration can be reduced to the working concentration, for example, by diluting the higher concentration solution.

[0047] In kits containing more than one component, the kit typically also includes second, third, or other additional containers for individually holding other components. Additionally, combinations of multiple components may be contained within the containers. Any combination or reagent described herein may be a component of the kit.

[0048] application

[0049] This invention further provides the application of molecular markers, primer combinations, or kits in the genetic analysis of Chinese peppers, including but not limited to genetic diversity analysis, germplasm identification, and assisted breeding.

[0050] Method for identifying the orientation of Chinese chili pepper fruits

[0051] This invention provides a method for identifying the orientation of Chinese chili pepper fruits, comprising the step of detecting the presence of a molecular marker with the sequence shown in SEQ ID NO.1 in the DNA of the Chinese chili pepper to be identified. The molecular marker has already been described and will not be repeated here.

[0052] In this invention, the method for detecting the presence of a molecular marker with the sequence shown in SEQ ID NO.1 can be any method known in the art, including methods for amplifying nucleic acids containing the characteristic sequence, and methods for directly sequencing the plant genome, etc.

[0053] In some embodiments, the method of the present invention for identifying the orientation of Chinese chili pepper fruits includes the step of amplifying a gene sequence containing a characteristic sequence from the DNA of the Chinese chili pepper sample to be identified by PCR using forward and reverse primers.

[0054] In an exemplary embodiment, the method for identifying the orientation of Chinese chili pepper fruits includes the following steps:

[0055] (1) Extract DNA from the sample;

[0056] (2) The step of amplifying nucleic acid containing the molecular marker from the sample DNA by PCR using forward primers and reverse primers;

[0057] (3) The orientation of Chinese chili pepper fruits was determined by detecting the length of the PCR products in the samples by electrophoresis.

[0058] In step (1), "sample" refers to the whole plant or a part of the plant, such as plant roots, leaves or plant stems.

[0059] In step (2), the ratio of forward primer to reverse primer is 1:1. PCR reaction program: 85-98℃ for 1-5 min; 85-98℃, 10-30 s, 40-70℃, 10-30 s, 50-80℃, 30-90 s, for a total of 10-40 cycles; 50-80℃, 1-10 min. More preferably, the PCR reaction program is: 90-96℃ for 2-5 min; 90-96℃, 12-20 s, 50-65℃, 15-20 s, 70-75℃, 40-80 s, for a total of 20-35 cycles; 65-75℃, 1-5 min.

[0060] In step (3), when the length of the PCR product of the sample is detected by electrophoresis, if the amplified fragments of the first to fifth fragments are present, then the molecular marker (8104bp) is present, and the Chinese pepper fruit is facing downwards. If only the amplified fragment of the fifth fragment is present or the molecular marker is missing, then the Chinese pepper fruit is facing upwards.

[0061] Example

[0062] This embodiment utilizes high-quality genomes from 11 different pepper species, including 5 wild species and 6 cultivated species. These 6 cultivated species cover all 5 cultivated pepper species. Based on this, a systematic comparative genomics analysis was conducted, as detailed below.

[0063] Using the wild chili pepper PM1533 as the reference genome, other genomes were aligned with PM1533 using minimap2 (v2.24-r1122) with the parameter set to -ax asm10. SVs were detected using SyRI (v1.6) with default parameters. Only deletions or insertions greater than 50 bp were retained.

[0064] Twenty Chinese chili pepper accessions were resequencing using an Illumina HiSeq 2000 platform. Trimmomatic v0.39 was used to process the raw data, removing adapters, poly-N fragments, and low-quality fragments to obtain clean data. This clean data was then aligned to the Chinese chili pepper genome data using BWA 0.75 with the parameters aln-o 1-e 10-t 4-l 32-i 15-q 10. Samtools 0.1.19 was used with the Bayesian algorithm, with parameters -q 1-C 50-SDm 2-F0.002-u, and the mpileup command was executed for variant detection. High-quality variants were obtained through filtering, with a minimum allele frequency greater than 0.01 and a deletion rate less than 0.1%.

[0065] Phenotypic identification of fruit orientation in Chinese chili pepper materials was performed, and the fruit orientation phenotypic trait was divided into two types: upward and downward. Figure 1 ).

[0066] Multi-genome comparison revealed a rare 8.1 kb deletion variant (SV) in the genome of Chinese pepper with fruit facing upwards. This SV is located 717 bp upstream of the Up gene Cchi12g000958 (Chr12: 37,916,651 bp - 37,918,089 bp, +), as shown in SEQ ID NO.1. This SV is not present in other existing wild and cultivated pepper genomes. Further analysis of resequencing data of Chinese pepper revealed that this sequence is absent in Chinese pepper materials with fruit facing upwards, but present in Chinese pepper materials with fruit facing downwards. Figure 2 a).

[0067] To further verify the relationship between SV and fruit orientation, DNA was extracted from fruit-up and fruit-down materials of Chinese chili peppers, and SV molecular marker primers were synthesized. The primer sequences are as follows:

[0068] Up-seg1-F: TATTAGACCGGTTCGGGTTG (SEQ ID NO.2);

[0069] Up-seg1-R:TTGAGCCGAAGGTTTATTGG(SEQ ID NO.3);

[0070] Up-seg2-F: TGAGAGCGGTCATTCAACAG (SEQ ID NO.4);

[0071] Up-seg2-R: GGTGATGAAAGCTGTGCTGA (SEQ ID NO.5);

[0072] Up-seg3-F: CAGGGATGGTGGAAGACTGT (SEQ ID NO.6);

[0073] Up-seg3-R: GGACGTAGGGTCCGTCAGT (SEQ ID NO.7);

[0074] Up-seg4-F: CCTGAAACAATCGAGCACCT (SEQ ID NO.8);

[0075] Up-seg4-R: TCGACGAATTATTGGCCTTC (SEQ ID NO.9);

[0076] Up-seg5-F: GTTCCTCATTTGCCCTTTGA (SEQ ID NO.10);

[0077] Up-seg5-R: TTAGCTTTGCGGCCATAGTC (SEQ ID NO. 11).

[0078] PCR amplification was performed on Chinese chili pepper materials with fruit facing upwards and downwards. The amplification products were detected by agarose gel electrophoresis. The electrophoresis results are as follows: Figure 2 As shown in b.

[0079] Identification of Chinese chili peppers using molecular markers of fruit orientation. Figure 2 In b, 1 and 2 are Chinese chili peppers with the fruit facing down, and 3 is also a Chinese chili pepper with the fruit facing down. Segmented amplification of this SV revealed that the seg1-seg5 amplified fragment was present in the fruit-facing materials 1 and 2, indicating the presence of an 8.1kb fragment in the fruit-facing materials, with an identification accuracy of 100%. In 3, only the seg5 amplified fragment was present, indicating the absence of an 8.1kb fragment in the fruit-facing materials.

[0080] The specific material preparation and verification procedures are as follows:

[0081] 1. Preparation of materials

[0082] Take 2g of tender leaves, wrap them in aluminum foil, pre-cool them with liquid nitrogen, and freeze them at -80℃ for DNA extraction.

[0083] 2. DNA extraction

[0084] The DNA extraction method used is the CTAB method, and the steps are as follows:

[0085] (1) Take a 2ml centrifuge tube, write the number on it, add two magnetic beads, and then add 1-2 pieces of the sample stored at -80℃.

[0086] (2) Add 250 μl of 2% CTAB (containing 0.15% BME) extraction solution, use a tissue homogenizer at 30 rpm for 2 min, centrifuge at 12000 rpm for 1 min, and finally add 500 μl of 2% CTAB extraction solution.

[0087] (3) Place the centrifuge tubes in a 65℃ water bath for 40 minutes, and mix well after the water bath. The amount of sample should not be too large, otherwise the cells will not lyse sufficiently due to insufficient extraction buffer.

[0088] (4) After taking it out, mix it up and down, add 750 μl of chloroform / isoamyl alcohol (24:1), shake it up and down again, and let it stand for 10 min.

[0089] (5) Centrifuge at 12000 rpm for 8 min at 4℃;

[0090] (6) Slowly draw 400 μl of the supernatant with a pipette tip and add it to a 1.5 ml centrifuge tube that has been pre-filled with 600 μl of ice-cold anhydrous ethanol. Gently invert the tube to mix.

[0091] (7) Centrifuge at 12000 rpm for 8 minutes, and slowly pour off all the liquid;

[0092] (8) Add 4 ml of 75% ethanol to rinse the DNA. After rinsing, discard the supernatant and repeat once.

[0093] (9) Air dry at room temperature, then add 400 μl of sterile ddH2O to dissolve the DNA;

[0094] 3. PCR reaction system

[0095] SNP-labeled PCR amplification system (20 μl):

[0096]

[0097]

[0098] Labeled PCR amplification procedure:

[0099]

[0100] 4. Detection of labeled PCR products

[0101] Weigh 2.0g of agarose into an Erlenmeyer flask, measure 100ml of 0.5×TBE buffer, heat in a microwave oven until the agarose is completely dissolved, add 6μl of nucleic acid dye EB, mix well, pour into a gel casting mold, and let the agarose solidify at room temperature for about 25 minutes. Remove the comb, take out the gel and place it in the electrophoresis tank.

[0102] Load 6-7 μL of PCR product onto the gel, using a D2000 bp DNA ladder as a standard to indicate molecular weight. Electrophoresis buffer is 0.5×TBE, and the gel is electrophoresed at a constant voltage of 180V for 30 min. After electrophoresis, the gel is developed under a BIO-RAD UV gel imaging system, and polymorphic bands are statistically analyzed.

[0103] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be readily apparent to those skilled in the art. This application specification and embodiments are merely exemplary.

Claims

1. Use of a primer combination or a kit in identifying fruit orientation in Capsicum annuum L. cultivars, characterized in that, The primer combination is used to amplify molecular markers related to fruit orientation in Chinese chili pepper cultivars. These molecular markers are structurally variable markers with sequences shown in SEQ ID NO.

1. The primer combination includes: The forward primer shown in SEQ ID NO.2 for amplifying the first fragment and the reverse primer shown in SEQ ID NO.3 for amplifying the first fragment; The forward primer shown in SEQ ID NO.4 for amplifying the second fragment and the reverse primer shown in SEQ ID NO.5 for amplifying the second fragment; The forward primer shown in SEQ ID NO.6 for amplifying the third fragment and the reverse primer shown in SEQ ID NO.7 for amplifying the third fragment; The forward primer shown in SEQ ID NO.8 for amplifying the fourth fragment and the reverse primer shown in SEQ ID NO.9 for amplifying the fourth fragment; The kit includes the primer combination described above.

2. A method for identifying fruit orientation in Chinese pepper cultivars, characterized by, The method includes a step of detecting the presence of a molecular marker of the sequence shown in SEQ ID NO.1 in the DNA of a Chinese chili pepper cultivar to be identified using the primer combination described in claim 1, wherein the molecular marker is a structural variation molecular marker, and when the molecular marker is present, the fruit of the Chinese chili pepper cultivar faces downward, and when the molecular marker is absent, the fruit of the Chinese chili pepper cultivar faces upward.

3. The method for identifying fruit orientation of Chinese pepper cultivars according to claim 2, characterized in that, Includes the following steps: (1) Extract DNA from the sample; (2) Using the primer combination of claim 1, amplifying nucleic acid containing the molecular marker from the sample DNA by PCR; and (3) The orientation of Chinese chili cultivars was identified by electrophoresis detection of PCR products in the samples.

Citation Information

Patent Citations

  • SNP locus closely related to orientation of capsicum fruit and its universal molecular marker, acquisition method and application thereof

    CN110305978A

  • Application of SNP closely related to capsicum fruit orientation, application of specific CAPS primer and method for identifying capsicum fruit orientation

    CN113355442A