Application of mitochondrial miR-3473b inhibitor in preparation of medicine for treating viral myocarditis

Abstract

The invention belongs to the technical field of biological medicines, and particularly relates to application of a mitochondrial miR-3473b inhibitor in preparation of a medicine for treating viral myocarditis. According to the present invention, the test results show that the mitomiR-3473b is the mitomiRNA with the highest up-regulation in the M1 macrophage, and has high expression in the myocardial macrophage of the CVB3 infected mouse; the invention further finds that the overexpression of the mitomiR-3473b promotes the polarization of the macrophage M1 and the oxidative damage of the mitochondria, while the knock-down of the mitomiR-3473b reverses the changes, and particularly, the mitomiR-3473b inhibitor relieves the viral myocarditis and the mitochondrial damage induced by the CVB3 in vivo. Therefore, the application potential and the development prospect of the mitochondrial miR-3473b inhibitor serving as the medicine for treating the viral myocarditis are effectively proved.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to the application of a mitochondrial miR-3473b inhibitor in the preparation of a therapeutic drug for viral myocarditis. Background Art

[0002] Viral myocarditis (VM) is an inflammatory heart disease that may lead to cardiac dysfunction or even death. Although a variety of infectious causes have been found, viruses remain the most common pathogens of myocarditis, among which Coxsackievirus B3 (CVB3) is a key pathogen of myocarditis. The immunology of myocarditis believes that CVB3 directly attacks myocardial cells through receptor-mediated endocytosis of eosinophilic RNA viruses. The immune activation of myocardial cell inflammation is mainly regulated by natural killer cells and macrophages, leading to cytokine-mediated inflammation including tumor necrosis factor (TNF), interferon γ (IFN-γ), and interleukin 1 (IL-1). Therefore, immunomodulatory strategies, such as the use of immunomodulators and immunosuppressants, may be beneficial for the treatment of VM. However, the immunological mechanism of VM has not been fully elucidated and further research is needed.

[0003] Macrophages are the main immune cell subsets that invade the myocardium in the early stage of CVB3 infection and play a key role in the development of VM. Macrophages usually have remarkable plasticity and can be polarized into the classically activated M1 type or the alternatively activated M2 type according to different cardiac environmental stimuli. Under the stimulation of lipopolysaccharide (LPS) and IFN-γ, M1 macrophages exhibit pro-inflammatory and phagocytic properties by highly expressing genes such as interleukin-1β (IL-1β), nitric oxide synthase (Nos2) and promote the development of myocarditis. In contrast, under the stimulation of interleukin (IL)-4, M2 macrophages can express genes such as arginase 1 (Arg1), transforming growth factor β (TGF-β) to promote cell growth, tissue repair and endocytosis. Therefore, inhibiting M1 macrophages or promoting M2 macrophages can reduce myocardial inflammation. Although the role of macrophages in the pathogenesis of myocarditis has been demonstrated, the underlying mechanism mediating M1 / M2 macrophage polarization is still unclear.

[0004] More and more studies have shown that intracellular metabolic reprogramming is closely related to the correct polarization and function of macrophages. M1 macrophages rely on glycolysis, consume more glucose and produce lactate, while M2 macrophages are characterized by mitochondrial oxidative phosphorylation (OXPHOS). In the previous study of the present invention, it was found that lncRNA AK083884 can alleviate VM by regulating the PKM2 / HIF-1α axis-mediated macrophage metabolic reprogramming. In addition, the metabolism of amino acids, lipids, vitamins, and iron is also related to macrophage polarization. However, the metabolic pathways involved in the process of macrophage polarization have not been fully studied. Studying the metabolic characteristics and gene regulatory networks during macrophage polarization will greatly promote the understanding of the bidirectional relationship between cell metabolism and macrophage function under physiological and pathological conditions in the field, and may provide new therapeutic targets for macrophage-related diseases.

[0005] Mitochondria are organelles that generate most of the ATP through oxidative phosphorylation (OXPHOS). Mitochondria are not only ATP energy centers, but also producers of reactive oxygen species (ROS) that participate in oxidative stress. New evidence shows that the switch of mitochondrial metabolism and physiology is essential for different states of macrophage polarization, including oxidative metabolism, tricarboxylic acid cycle, and changes in mitochondrial ultrastructure, mtDNA, and membrane potential. At the same time, more and more studies have confirmed that mitochondrial dysfunction and ROS are closely related to inflammatory diseases, including VM. Cardiomyocyte replication of enterovirus induces activation of apoptotic pathways in cardiomyocyte mitochondria in acute myocarditis. Mitochondrial membrane phospholipid localization disorders and reduced mtDNA clearance play an important role in the pathogenesis of viral myocarditis. In addition, regulating mitochondrial function can alleviate myocardial inflammation, apoptosis, fibrosis, and mitochondrial damage, thereby improving VM caused by CVB3. However, the molecular mechanism of the causal relationship between mitochondria and the occurrence of myocarditis remains unclear.

[0006] MicroRNA (miRNA) is a conserved non-coding RNA consisting of 18 to 25 nucleotides. The miRNA machinery in the cytoplasm mainly binds to target mRNA through base pairing, guiding the RNA-induced silencing complex (RISC) to degrade mRNA or inhibit its translation, thereby regulating gene expression at the post-transcriptional level. In addition, miRNAs are also present in membrane-bound organelles such as the nucleus, mitochondria, and exosomes. These miRNAs located in mitochondria play a key role in mitochondrial function and are called "mitochondrial miRNAs." Most of them originate from the nuclear genome and are transported to the mitochondria, while a small number of mitochondrial miRNAs are transcribed from mitochondrial DNA. These miRNAs, as regulators of mitochondrial function, affect the development of multiple diseases through mitochondrial dysfunction and are associated with the pathophysiology of many diseases, such as cardiovascular disease, liver disease, and tongue squamous cell carcinoma. However, the transcriptional regulatory mechanism of miRNAs on the mitochondrial genome is still unclear. In addition, there is no study on the association between miRNA and VM caused by CVB3, and its mechanism of action is also unclear. Summary of the invention

[0007] In order to overcome the deficiencies in the prior art, the first aspect of the present invention is to provide the use of a mitochondrial miR-3473b inhibitor in the preparation of a therapeutic drug for viral myocarditis.

[0008] The second aspect of the present invention is to provide a nanocarrier loaded with a mitochondrial miR-3473b inhibitor.

[0009] The third aspect of the present invention is to provide the use of the above-mentioned nanocarrier loaded with mitochondrial miR-3473b inhibitor.

[0010] To achieve the above object, in the first aspect of the present invention, the technical solution adopted is: Use of a mitochondrial miR-3473b inhibitor in preparing a therapeutic drug for viral myocarditis. The product name of the mitochondrial miR-3473b inhibitor is micrOFF mmu-miR-3473b inhibitor, and the product number is miR213427144630-1-5.

[0011] Mitochondrial miRNAs (mitomiRNA) can be derived from both the nucleus and mitochondria, and play a key role in mitochondrial function. However, the distribution and function of mitomiRNAs in macrophage polarization and immune-mediated inflammation have not been fully studied, and there is no information on the mechanism of action of mitomiR-3473b (whose nucleotide sequence is GGGCUGGAGAGAUGGCUCAG) and CVB3-induced viral myocarditis (VM). Through multiple experiments, the present invention first confirmed that mitochondrial miR-3473b regulates CVB3-induced viral myocarditis by regulating macrophage metabolic reprogramming, and also confirmed the potential application of mitochondrial miR-3473b inhibitors as therapeutic drugs for viral myocarditis, which can provide a development direction for the development of new therapeutic drugs for viral myocarditis.

[0012] As a preferred solution, the viral myocarditis is caused by Coxsackievirus B3 as the main pathogen.

[0013] The second aspect of the present invention adopts the following technical solution: A nanocarrier loaded with a mitochondrial miR-3473b inhibitor is mainly prepared from an amphiphilic molecule MMPA, a mitochondrial miR-3473b inhibitor, a polymer NHS-PEG-PDPA, salicylic acid and CTP peptide; the product name of the mitochondrial miR-3473b inhibitor is micrOFF mmu-miR-3473b inhibitor, and the product number is miR213427144630-1-5.

[0014] As a preferred solution, the method for preparing a nanocarrier loaded with a mitochondrial miR-3473b inhibitor comprises the following steps: The amphiphilic molecule MMPA, the mitochondrial miR-3473b inhibitor, and the polymer NHS-PEG-PDPA are mixed in water, and then ultrasonically emulsified and centrifuged to obtain nanoparticles; the nanoparticles are dissolved in a solvent, and then salicylic acid is added for a first incubation, and then CTP peptide is added for a second incubation, and the nanocarrier loaded with the mitochondrial miR-3473b inhibitor is obtained after centrifugation.

[0015] As a preferred solution, the dosage ratio of the amphiphilic molecule MMPA, the mitochondrial miR-3473b inhibitor, the polymer NHS-PEG-PDPA, salicylic acid, and the CTP peptide is 50 μg: 1 nmol: 4 mg: 20 μg: 30 μg.

[0016] As a preferred solution, the solvent is dimethyl sulfoxide; the temperature of the first incubation is 36-38°C, and the time is 3-6 hours; the temperature of the second incubation is 36-38°C, and the time is 20-30 hours.

[0017] In the third aspect of the present invention, the technical solution adopted is: The use of the nanocarrier loaded with the mitochondrial miR-3473b inhibitor in the preparation of a therapeutic drug for viral myocarditis.

[0018] As a preferred solution, the viral myocarditis is caused by Coxsackievirus B3 as the main pathogen.

[0019] As a preferred solution, the therapeutic drug comprises the nanocarrier loaded with the mitochondrial miR-3473b inhibitor and a pharmaceutically acceptable excipient. Further, the present invention does not specifically limit the types of pharmaceutically acceptable excipients, and technicians can routinely select excipients according to the dosage form of the drug. For example, the excipient can be one or more of an excipient, a binder, a diluent, a filler, and a pharmaceutical solvent.

[0020] As a preferred solution, the therapeutic drug is administered orally or by injection; the injection is intravenous injection or intramuscular injection.

[0021] The technical solution of the present invention has the following advantages and beneficial effects: (1) The present invention reveals the effect of classical M1 activation on the mitomiRNA expression profile in bone marrow-derived macrophages (BMDMs) through experiments, and finds that mitomiR-3473b is the most highly upregulated mitomiRNA in M1 macrophages and is also highly expressed in myocardial macrophages of CVB3-infected mice. The present invention further finds that overexpression of mitomiR-3473b promotes macrophage M1 polarization and mitochondrial oxidative damage, while knocking down mitomiR-3473b reverses these changes. Correspondingly, the mitomiR-3473b inhibitor alleviates CVB3-induced VM and mitochondrial damage in vivo. In terms of mechanism of action, mitomiR-3473b regulates macrophage polarization by downregulating oxidative phosphorylation and upregulating glycolysis reprogramming metabolism. These regulations are achieved by partially inhibiting mitochondrial DNA transcription by mitomiR-3473b. That is to say, the present invention has confirmed through multiple experiments that mitochondrial miR-3473b regulates CVB3-induced viral myocarditis by regulating macrophage metabolic reprogramming, and also confirmed the application potential and development prospects of mitochondrial miR-3473b inhibitors as therapeutic drugs for viral myocarditis.

[0022] (2) Furthermore, the present invention also provides a nanocarrier loaded with a mitochondrial miR-3473b inhibitor, which is a nanoplatform based on cardiac and mitochondrial targeting and a novel drug delivery system developed by the present invention. The nanocarrier is loaded with a miR-3473b inhibitor and can be effectively used for the treatment of VM. Experiments have confirmed that the novel drug delivery system provided by the present invention can protectively regulate the cardiac immune microenvironment, thereby achieving cardiac repair. Further animal experiments have confirmed that miR-3473b regulates macrophage polarization and metabolic reprogramming through mitochondrial transcriptional regulation, and can effectively regulate CVB3-induced myocardial inflammation. Therefore, the present invention confirms that miR-3473b is a potential clinical target for VM treatment and a promising nanomedicine therapeutic target, and also indicates that miR-3473b inhibitors are suitable for development and application as VM therapeutic drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 is the expression result of mitochondrial miRNA in M0 and M1 macrophages in the present invention; wherein, Figure 1 A is the experimental flow chart of mitochondrial isolation and purification; Figure 1 B, validation of mitochondria purified from macrophages using the indicated protein markers (Tom20 for mitochondria); Figure 1 C is the annotation and proportion of small RNA categories of all samples; Figure 1 D is the Venn diagram of miRNAs in M0 and M1 macrophages; Figure 1 E is the volcano plot of differentially expressed mitochondrial miRNAs in M0 and M1 macrophages; Figure 1 F is a heat map of differentially expressed mitochondrial miRNAs in M0 and M1 macrophages; Figure 1 G is the top 20 results of KEGG enriched pathways of differentially expressed mitochondrial miRNA target genes; Figure 2 The results of RT-qPCR and FISH experiments in the present invention; wherein, Figure 2 A shows the 12 mitochondrial miRNAs that were more highly expressed in M1 macrophages than in M0 macrophages as determined by RT-qPCR; Figure 2 B is the co-localization result of miR-3473b and mitochondria (MitoTracker Green) determined by FISH experiment; Figure 3 is the expression result of miR-3473b participating in macrophage polarization in vitro in the present invention; wherein, Figure 3 A and Figure 3B shows the expression results of miR-3473b in M1 macrophages transfected with miR-3473b mimics or miR-3473b inhibitors by qRT-PCR, and U6 was used as an internal control; Figure 3 C and 3D are the results of qRT-PCR detection of miR-3473b expression in mitochondria of M1 macrophages transfected with miR-3473b mimics or miR-3473b inhibitors, respectively, and 12S rRNA was used as the internal control of mitochondria; Figure 4 is the test result of the marker of miR-3473b participating in macrophage polarization in vitro in the present invention; wherein, Figure 4 A and Figure 4 B is the results of qRT-PCR analysis of the expression of M1 markers (NOS2, TNF-α, and IL-12) mRNA in M1 macrophages after treatment with miR-3473b mimics or miR-3473b inhibitors; Figure 4 C and Figure 4 D is the results of qRT-PCR analysis of the expression of M2 markers (Arg1, FIZZ1, and YM1) mRNA in M1 macrophages after treatment with miR-3473b mimics or miR-3473b inhibitors; Figure 4 E and Figure 4 F is the results of WB analysis of the expression of M1 marker (iNOS) and M2 marker (Arg1) proteins in M1 macrophages after treatment with miR-3473b mimics or miR-3473b inhibitors, NC is the negative control of mimics or inhibitors; Figure 5 The test results of miR-3473b regulating mitochondrial function and cell apoptosis in the present invention; wherein, Figure 5 A and 5B are flow cytometry assays using MitoSOX™ red stain to detect ROS produced by M1 macrophages after treatment with miR-3473b mimics or miR-3473b inhibitors; Figure 5 C, ATP levels were measured after treatment of M1 macrophages with miR-3473b mimics or miR-3473b inhibitors; Figure 5 D. Figure 5 E: The apoptosis of M1 macrophages after treatment with miR-3473b mimics or miR-3473b inhibitors was detected by flow cytometry using Annexin V-PI single staining method; Figure 6The results of Western blot detection of the expression levels of molecules related to apoptosis (Caspase-9, Caspase-3, Bcl-2 and Bax) in M1 macrophages after treatment with miR-3473b mimics or miR-3473b inhibitors in the present invention; Figure 7 The results of miR-3473b regulating mitochondrial gene transcription and metabolic reprogramming in the present invention; wherein, Figure 7 A: After M1 macrophages were treated with miR-3473b mimics, 13 mitochondrial gene transcripts were determined by qRT-PCR; Figure 7 B: After treating M1 macrophages with miR-3473b inhibitor, the transcripts of 13 mitochondrial genes were determined by qRT-PCR; Figure 7 C shows the RNAhybrid analysis that revealed the targeted binding sites of miR-3473b and mtDNA; Figure 7 D is the result of alignment of overlapping mtDNA with three miR-3473b mimic mutants (underline indicates mismatched bases); Figure 7 E shows that the mRNA expressions of ND1, ND3, ATP6 and CO2 in M1 macrophages were inhibited by miR-3473b mimics and miR-3473b mimic mutants (5'-mut and Mid-mut), but not by miR-3473a mimic mutants; Figure 8 In the present invention, miR-3473b affects the oxygen consumption rate, acidification rate, and expression level of glycolysis-related genes; wherein, Figure 8 A shows the result that miR-3473b overexpression inhibits the oxygen consumption rate (OCR) of M1 macrophages; Figure 8 B is the test result that miR-3473b overexpression promotes the extracellular acidification rate (ECAR) of M1 macrophages; Figure 8 C is the test result of the expression level of glycolysis-related genes (PKM2 and HIF-1α) detected by WB after M1 macrophages were treated with miR-3473b mimics; Fig. 9 This is the test result of knocking down miR-3473b to alleviate myocardial inflammation in the mouse VM model in the present invention; wherein, Fig. 9 A and 9B show the results of qRT-PCR determination of miR-3473b expression and mRNA expression of 13 mitochondrial genes in VM mice after PBS or CVB3 was injected into the myocardium to establish VM models; Fig. 9 C is a schematic diagram of the CVB3-induced mouse VM model, in which AAV9-carried miR-3473b inhibitor or ZsGreen control was injected through the tail vein 3 weeks before CVB3 infection; Fig. 9 D is the result of staining heart sections with hematoxylin-eosin (H&E) staining; Fig. 9 E: The serum cTnI level of mice was measured by ELISA; Fig. 9 F is the survival curve of mice after CVB3 infection, and the total number of mice in the NC or miR-3473b group was 12; Fig. 9 G is the result of evaluating the body weight of mice after CVB3 infection; Fig.10 This is the test result of knocking down miR-3473b to alleviate cardiac dysfunction in the mouse VM model in the present invention; wherein, Fig.10 The left figure is a representative schematic diagram of echocardiography of mice in the NC group and the miR-3473b inhibitor group 7 days after CVB3 infection; Fig.10 The right panel shows echocardiographic parameters, including test results of fractional shortening and ejection fraction; Fig.11 The effect of miR-3473b on the polarization of myocardial infiltrating macrophages after VM infection was investigated. Three weeks before CVB3 infection, the mice were treated by tail vein injection of miR-3473b inhibitors or ZsGreen controls encapsulated by AAV9 vectors; wherein, Fig.11 A: Myocardial infiltrating macrophages were isolated from the hearts of VM mice; mRNA levels of M1 (NOS2, TNF-α, and IL-12) and M2 (Arg1, FIZZ1, and YM1) marker genes were analyzed by qRT-PCR; Fig.11 B, protein levels of M1 (iNOS) and M2 (Arg1) were analyzed by WB; Fig.11 C: The percentage of M1 and M2 macrophages in mouse hearts determined by flow cytometry; Fig.12 The immunofluorescence staining results of F4 / 80 (green, M1 macrophage marker) and iNOS (red) and F4 / 80 (green, M2 macrophage marker) and Arg1 (red) were performed in the heart sections of VM mice in the present invention; Fig.13 The test results of miR-3473b regulating mitochondrial function and cell apoptosis in the viral myocarditis model in the present invention; wherein, Fig.13 A is the expression of ND1, ND3, ND4, ND4L, ND5, ND6 and ATP8 in mouse myocardial tissue tested by qRT-PCR; Fig.13 B is TUNEL staining indicating the level of cell apoptosis after miR-3473b downregulation; Fig.13C is the WB result showing the expression of Caspase-9, Cle-Caspase-3, Bax, PKM2, HIF-1α, and Bcl-2 after miR-3473b down-regulation; Fig.14 The characterization of CTP-NPs (MT-miRNA inhibitor) in macrophages in the present invention; wherein, Fig.14 A is the size distribution of CTP-NPs (MT-miRNA-3473b inhibitor) in aqueous solution at pH 7.4; Fig.14 B is a representative transmission electron microscopy image of CTP-NPs (MT-miRNA-3473b inhibitor); Fig.14 C is a fluorescence image showing the fluorescence results of endosomes or mitochondria in macrophages after 1, 4, and 6 hours of incubation; Fig.15 The expression levels of miRNA-3473b and mt-RNAs in macrophages treated with PBS, CTP-NPs (MT-NC inhibitor) or CTP-NPs (MT-miRNA-3473b inhibitor) were analyzed by qRT-PCR in the present invention; Fig.16 The in vivo therapeutic effect of CTP-NPs (MT-miRNA inhibitor) in the present invention; wherein, Fig.16 A is the in vivo distribution of CTP-NPs (FITC-MT-NC inhibitor) and CTP-NPs (FITC-MT-miRNA-3473b inhibitor) in the mouse heart 24 h after injection; Fig.16 B is a schematic diagram of the CVB3-induced VM model and the CTP-NPs (MT-NC inhibitor) and CTP-NPs (MT-miRNA-3473b inhibitor) treatment of mice; Fig.16 C is the result of hematoxylin-eosin (H&E) staining of heart tissue; Fig.16 D is the content of cTnI in mouse serum measured by ELISA; Fig.16 E is the weight assessment result of mice; Fig.17 Representative echocardiographic images of NPs-treated mice 7 days after CVB3 infection and analyzed echocardiographic parameters (fractional shortening and ejection fraction) are shown in the present invention. DETAILED DESCRIPTION

[0024] The technical scheme and technical effects of the present invention will be clearly and completely described below in conjunction with specific embodiments and test examples. However, it should be understood by those skilled in the art that the embodiments are only used to illustrate the technical scheme of the present invention and should not be regarded as limiting the scope of protection of the present invention. The test methods used in the following examples are conventional methods unless otherwise specified; the raw materials used are all commonly used in the art, available to the public or commercially available, unless otherwise specified.

[0025] Among them, the mitochondrial miR-3473b inhibitor involved in the following examples was purchased from Guangzhou Ruibo Biotechnology Co., Ltd., the product name is micrOFF mmu-miR-3473b inhibitor, the product number is miR213427144630-1-5, 5nmol.

[0026] Example 1

[0027] This embodiment provides the use of a mitochondrial miR-3473b inhibitor in the preparation of a therapeutic drug for viral myocarditis. The product name of the mitochondrial miR-3473b inhibitor is micrOFF mmu-miR-3473b inhibitor, and the product number is miR213427144630-1-5. Viral myocarditis is mainly caused by Coxsackie virus B3.

[0028] Example 2

[0029] This embodiment provides a nanocarrier loaded with a mitochondrial miR-3473b inhibitor, which is mainly prepared from an amphiphilic molecule MMPA, a mitochondrial miR-3473b inhibitor, a polymer NHS-PEG-PDPA, salicylic acid, and a CTP peptide. The product name of the mitochondrial miR-3473b inhibitor is micrOFF mmu-miR-3473b inhibitor, and the product number is miR213427144630-1-5.

[0030] The method for preparing the nanocarrier loaded with the mitochondrial miR-3473b inhibitor comprises the following steps: 10 μL of mitochondrial targeting and membrane penetrating peptide amphiphile MMPA (C17H35-CONH-GRRRRRRGGGK(TPP)G-OH, product number 04010067387, Shanghai Qiangyao Biotechnology Co., Ltd., concentration in DMF is 5 mg / mL), 10 μL of miRNA-3473b inhibitor (product number miR213427144630-1-5, Guangzhou Ruibo Biotechnology Co., Ltd., aqueous solution concentration is 100 nmol / mL) and 200 μL of polymer NHS-PEG-PDPA solution (product number R-NPDA-193, Xi'an Ruixi Biotechnology Co., Ltd., concentration in CH2Cl2 is 20 mg / mL) were mixed; then the mixture was added to 5 mL of deionized water and emulsified using a micro-tip probe ultrasonic disperser (power: 40 W, each cycle runs for 3 seconds and stops for 10 seconds); the NPs suspension obtained after emulsification was centrifuged at 10000 rpm for 30 min to remove organic solvents and free compounds to obtain NPs; The NPs obtained in the previous steps were dissolved in an appropriate amount of dimethyl sulfoxide solution (5% DMSO, 5uL DMSO dissolved in 95uL PBS) and incubated with 20μL salicylic acid (SA, 1mg / mL, PBS) at 37°C for 4h; then, 30μL of cardiac targeting peptide (CTP peptide, 1mg / mL, PBS, Shanghai Qiangyao Biotechnology Co., Ltd., product number 04010066069) was added and incubated at 37°C for 24h to couple CTP with the NHS end on NPs to obtain nanocarriers loaded with mitochondrial miR-3473b inhibitors, which were recorded as CTP-NPs (i.e., the modified MT-miRNA-3473b inhibitors).

[0031] Test example The test process and test indicators involved in the following test examples of the present invention are specifically as follows.

[0032] 1.1 Test Materials The experimental mice used in the experiment were five-week-old BALB / c male mice purchased from a biological company (GemPharmatech) and raised under specific pathogen-free (SPF) conditions. All animal experimental procedures were in accordance with the provisions of the "Regulations on the Administration of Experimental Animals" and approved by the Animal Ethics Committee of Yijishan Hospital of Wannan Medical College.

[0033] 1.2 Isolation of bone marrow-derived macrophages (BMDMs) Under a sterile environment, BMDMs were isolated from the femur and tibia of mice and suspended in DMEM medium (Hyclone, Logan, UT, USA) containing 20 v / v% fetal bovine serum (FBS, Hyclone) and 20 v / v% L929 cell supernatant; after suspension, BMDMs were seeded into 6-well plates and cultured in a humidity-controlled incubator (5% CO2, 37°C). After one week of culture, BMDMs were cultured in fresh RPMI-1640 medium (containing 10 v / v% FBS) for 24 hours to maintain their activity. To induce BMDMs to polarize toward M1, BMDMs were cultured in DMEM medium (10 v / v% FBS) containing 100 ng / mL lipopolysaccharide (LPS, Sigma, USA) and 20 ng / mL interferon-γ (IFN-γ, PeproTech, Cranbury, NJ, USA) for 24 hours. Meanwhile, to induce BMDMs to polarize toward M2, BMDMs were cultured in a medium containing 20 ng / mL of interleukin-4 (IL-4, PeproTech) for 48 h.

[0034] 1.3. Isolation of mitochondrial components Mitochondria were isolated from macrophages obtained in the previous step using the Mitochondria Isolation Kit (Miltenyi Biotec, Germany). Cold lysis buffer was added to the macrophages and homogenized using the gentleMACS separator (Miltenyi Biotec) according to the mitochondrial isolation procedure. Anti-TOM22 microspheres were added directly to the cell lysate and mitochondria were captured using magnetically labeled microspheres. The mitochondrial pellet was washed by centrifugation at 13,000 g for 2 minutes at 4°C, and then the mitochondrial pellet was suspended in storage buffer for later use.

[0035] 1.4 Mitochondrial miRNA Sequencing Beijing Novogene Bioinformatics Technology Co., Ltd. sequenced the miRNAs of mitochondrial small RNAs. 3' and 5' adapters were ligated to both ends of the small RNAs. Subsequently, first-strand cDNA synthesis was performed after hybridization with reverse transcription primers. Double-stranded cDNA libraries were created by PCR amplification. After purification and size selection, they were sequenced using SE50 technology on the Illumina platform, containing libraries with insert sizes ranging from 18 to 40 bp. Quantification was performed by Qubit and real-time PCR, and size distribution analysis was performed by Bioanalyzer. The quantified libraries were combined and sequenced on the Illumina platform according to the effective library concentration and the required data volume. Differential expression analysis between two conditions / groups was performed using the DESeq R package. P values ​​were adjusted according to the Benjamini & Hochberg method, and the corrected P value threshold was set to 0.05 by default to determine significant differential expression. In addition, the P values ​​were modified using the qvalue criterion to set the qvalue threshold below 0.01 and the log2 (foldchange) absolute value above 1 as the default value for significant differential expression detection. For miRNA, target gene prediction was performed in psRobot using psRobot_tar, and for animals, target gene prediction was performed using miRanda. The statistical enrichment of target gene candidates in KEGG pathways was evaluated using KOBAS software. The raw data have been submitted to the gene sequence archive of the China National Center for Bioinformation (GSA: CRA019993).

[0036] 1.5. Real-time quantitative PCR (qRT-PCR) RNA from mitochondria, cells, and tissues was extracted using the TRIzol kit (Ambion, Life Technologies, CA, USA). cDNA was synthesized from RNA using the QuantiTect reverse transcription kit (Thermo Scientific, Lithuania, USA). Gene expression was detected using the Bio-Rad CFX Connect RT-PCR system (Qiagen, Hilden, Germany) and SYBR Green PCR Master Mix. GAPDH or U6 was used for normalization. Comparative cycle threshold values ​​(2 -ΔΔCT ) method for gene expression analysis.

[0037] 1.6. RNA fluorescence in situ hybridization (FISH) and immunofluorescence (IF) The FISH procedure was as follows: Cy3-labeled miRNA-3473b probe was designed and constructed by GenePharma. The sequence of the constructed miRNA-3473b probe was CTGAGCCATCTCTCCAGCCC. Before hybridization, macrophages were incubated in 0.1 µM of mitochondrial green fluorescent probe (MitoTracker Green, Molecular Probes) for 30 min to target mitochondria. The fluorescent signal of the miRNA-3473b probe was determined using GenePharma's FISH kit according to the manufacturer's protocol. Finally, nuclear DNA was stained with DAPI.

[0038] The IF protocol was as follows: Paraffin-embedded mouse heart tissue was cut into 3-μm-thick sections. The sections were dewaxed and rehydrated using Xylol and a series of different ethanol concentrations. Antigen retrieval was performed using Beyotime's antigen retrieval solution. After blocking with 1% BSA, the sections were incubated with primary antibodies and fluorescently labeled secondary antibodies. Cell nuclei were stained with DAPI. The primary antibodies used were as follows: iNOS (Abcam), arginase (Arg1) (Abcam), F4 / 80 (Abcam). All images were taken on a ZEISS LSM800 confocal microscope system (Carl Zeiss, Germany).

[0039] 1.7. miRNA-3473b mimics Mimics (including 3' mutation mimics, middle mutation mimics, and 5' mutation mimics) and miRNA-3473b inhibitor (product number miR213427144630-1-5) were purchased from Guangzhou RiboBio Technology Co., Ltd. (RiboBio). Cells were transfected using the riboFECTTM CP transfection kit (RiBoBio) according to the manufacturer's method.

[0040] 1.8. Generation of ROS Mitochondrial ROS production was detected using MitoSOX™ Red mitochondrial probe from Thermo Fisher. For the test, macrophages were treated with MitoSOX probe and incubated at 37°C in the dark for 10 min; ROS in macrophages were then analyzed using CytoFLEX flow cytometer from Beckman Coulter (Brea, USA).

[0041] 1.9. Cell apoptosis detection The apoptosis of macrophages was detected using the Annexin V-FITC / propidium iodide (PI) apoptosis detection kit (Nanjing Beibo Biotechnology Co., Ltd.). Macrophages were stained with Annexin V-FITC / PI and analyzed using a BeckmanCoulter CytoFLEX flow cytometer. The apoptosis of cardiac tissue sections was detected using the TUNEL kit according to the manufacturer's instructions. All images were taken by a KFBIO digital pathology scanner (KONFOONG) and analyzed using CaseViewer.

[0042] 1.10. Western blotting Cells or tissues pretreated with Miltenyi gentleMACS Dissociator were lysed with Laemmli buffer (Sigma, USA). Protein lysates were separated by 10% SDS-PAGE gel and then transferred to nitrocellulose (NC) filters (Millipore) and incubated with primary antibodies against Caspase-9 (Proteintech), Cleaved Caspase-3 (Proteintech), Bax (CST, Danvers, MA, USA), Bcl-2 (CST), iNOS (CST), Arg1 (CST), PKM2 (CST), HIF-1α (Proteintech), and β-actin (Proteintech), followed by incubation with secondary antibodies. Protein bands were visualized with a Bio-Rad ChemiDoc chemiluminometer (Hercules, CA, USA) after ECL color development (Millipore, enhanced chemiluminescence). Protein quantification was performed using ImageJ software.

[0043] 1.11. Construction of viral myocarditis (VM) model The Coxsackie CVB3 strain used in the present invention is derived from the infectious strain of the Nancy strain. The CVB3 virus titer was measured by a 50% tissue culture infectious dose (TCID50) assay using a HeLa cell (ATCC No.: CCL-2) monolayer. 1×10 5 PFU of CVB3 (100ul PBS) was injected intraperitoneally into BALB / c mice to establish a viral myocarditis (VM) model, and the sham operation group was injected with an equal amount of PBS solution. After one week of treatment, the mice were euthanized by injection of 3% sodium pentobarbital.

[0044] 1.12. Adeno-associated virus vector (AAV) infection of mice Adeno-associated virus vectors (AAV9) encoding mouse miR-3473b inhibitors and corresponding negative controls (NC) were obtained from Hanheng (Shanghai, China). BALB / c mice were injected with 1.7×1012 vg / mL of AAV9 encoding miR-3473b inhibitors or NC via the tail vein, 200 μL per mouse. Three weeks later, a viral myocarditis (VM) model was established.

[0045] 1.13 Cardiac function assessment The present invention uses H&E staining to evaluate the histopathology of the VM model. Paraffin-embedded heart tissue was cut into 5-micron thick slices. The slices were stained with H&E according to standard procedures. All images were taken on a KFBIO digital pathology scanner and analyzed using 3DHISTECH CaseViewer. Two blinded pathologists performed pathological assessments on inflammatory cell infiltration in heart tissue sections.

[0046] Serum cTnI concentration was measured using a DXI800 (Beckman Coulter) immunoassay analyzer. Cardiac function was examined using a Vevo 3100 LT echocardiography system in anesthetized mice. FS (left ventricular fractional shortening) and EF (left ventricular ejection fraction) were analyzed from left ventricular long-axis B-mode images.

[0047] 1.14 Flow cytometry After anesthesia, mouse hearts were collected and homogenized using a Miltenyi gentleMACS separator. Single-cell suspensions were incubated with anti-CD11b antibodies (eBioscience; BD Pharmingen; Biolegend) for 30 min. After fixation and permeabilization, cells were stained with anti-CD86 antibodies (eBioscience) or anti-CD206 antibodies (Thermo Flyscience). Cell samples were examined using a CytoFLEX flow cytometer (Beckman Coulter). Macrophage cell types were analyzed using CytExpert software (BeckmanCoulter).

[0048] 1.15. Cellular Energy Metabolism Analysis The extracellular acidification rate (ECAR) and mitochondrial oxygen consumption rates (OCRs) of M1 macrophages were measured using the Seahorse XF Glycolytic Stress Test Kit and the XF Cell Mitochondrial Stress Test Kit, respectively. M1 macrophages transfected with miRNA mimics were digested and seeded at a density of 10,000 cells per well in XF 24-well plates. The ECAR and OCR in XF 24-well plates were monitored in real time using the Seahorse XFe24 Analyzer (Agilent Technologies). The ECAR and OCR in the results were calculated using Seahorse WAVE software (Agilent).

[0049] 1.16. Preparation of miRNA inhibitor-loaded nanoparticles (NPs) 10 μL of mitochondrial targeting and membrane penetrating peptide amphiphile MMPA (C17H35-CONH-GRRRRRRGGGK(TPP)G-OH, product number 04010067387, Shanghai Qiangyao Biotechnology Co., Ltd., concentration in DMF is 5 mg / mL), 10 μL of miRNA-3473b inhibitor (product number miR213427144630-1-5, Guangzhou Ruibo Biotechnology Co., Ltd., aqueous solution concentration is 100 nmol / mL) and 200 μL of polymer NHS-PEG-PDPA solution (product number R-NPDA-193, Xi'an Ruixi Biotechnology Co., Ltd., concentration in CH2Cl2 is 20 mg / mL) were mixed; then the mixture was added to 5 mL of deionized water and emulsified using a micro-tip probe ultrasonic disperser (power: 40 W, each cycle runs for 3 seconds and stops for 10 seconds); the NPs suspension obtained after emulsification was centrifuged at 10000 rpm for 30 min to remove organic solvents and free compounds to obtain NPs; The NPs obtained in the previous steps were dissolved in an appropriate amount of dimethyl sulfoxide solution (5% DMSO, 5uL DMSO dissolved in 95uL PBS) and incubated with 20μL salicylic acid (SA, 1mg / mL, PBS) at 37°C for 4h; then, 30μL cardiac targeting peptide (CTP peptide, 1mg / mL, PBS, Shanghai Qiangyao Biotechnology Co., Ltd., product number 04010066069) was added and incubated at 37°C for 24h to couple CTP with the NHS end on the NPs to obtain nanocarriers loaded with mitochondrial miR-3473b inhibitors, recorded as CTP-NPs (i.e., modified MT-miRNA-3473b inhibitors); then centrifuged, the CTP-NPs were suspended in deionized water, and the miRNA inhibitor concentration was 1nmol / mL. The size and zeta potential of CTP-NPs were detected by nanoparticle tracking analysis (NTA, Particle Metrix, Zetaview, Germany) and Hitachi HT7800 transmission electron microscopy, and their morphology was observed.

[0050] 1.17. Endosomal escape and mitochondrial targeting detection The preparation method of fluorescently labeled CTP-NPs (FITC-MT-Cy5-miRNA-3473b inhibitor) is basically the same as that in Section 1.16, except that it is prepared using a mixture of Cy5 fluorescently labeled Cy5-miRNA-3473b inhibitor (product model miR2CM001, Guangzhou Ruibo Biotechnology Co., Ltd.) and MMPA (C17H35-CONH-GRRRRRRGGGK(TPP) G-OH, 04010067387, Shanghai Qiangyao Biotechnology Co., Ltd., concentration in DMF is 5 mg / mL) and FITC-labeled cationic peptide (C17H35-CONH-GRRRRRRGGGK(FITC)G-OH, 04010084220, Shanghai Qiangyao Biotechnology Co., Ltd.), and then incubated with macrophages at a miRNA inhibitor concentration of 30 nM for 1 h or 4 h. After incubation, macrophages were stained with Lyso-Tracker Red (Biyuntian Biotechnology) and images were acquired using a confocal laser scanning microscope (ZEISS). To evaluate the mitochondrial targeting ability, macrophages were incubated with fluorescently labeled CTP-NPs (FITC-MT-Cy5-miRNA-3473b inhibitor) for 6 h, and then mitochondria were stained with Mito-Tracker Red CMXRos (Biyuntian Biotechnology) and images were acquired using a confocal laser scanning microscope (ZEISS).

[0051] 1.18 Biological distribution The preparation method of the FITC-MT-Cy5-NC inhibitor in the control group was the same as that of FITC-MT-Cy5-miRNA-3473b, except that the miRNA-3473b inhibitor was not added during the preparation. When investigating the biodistribution, BALB / c mice were randomly divided into two groups (3 mice in each group) and given the control group FITC-MT-Cy5-NC inhibitor or FITC-MT-Cy5-miRNA-3473b inhibitor by tail vein injection, with 2 nmol of miRNA inhibitor injected per mouse. Heart tissue was collected 24 hours after injection, and images of heart sections were observed using a ZEISS confocal laser scanning microscope.

[0052] 1.19. In vitro release of miRNA-3473b inhibitor In vitro, CTP-NPs (MT-Cy5-miRNA-3473b inhibitor) were mixed with 1 ml of PBS (pH 7.4) or PBS at pH 6.0 and incubated at 37°C. Then, the mixed NPs solution was diluted 20 times, that is, 5 μl of NPs solution was mixed with 95 μl of DMSO at the predetermined time point. The fluorescence intensity of Cy5-labeled miRNA-3473b inhibitor was detected using an Epoch2 microplate spectrophotometer produced by BioTek (Winooski, VT, USA).

[0053] 1.20. Blood analysis BALB / c mice were randomly divided into three groups (3 mice in each group) and injected with PBS, CTP-NPs without miRNA-3473b inhibitor (control group MT-NC), or CTP-NPs (MT-miRNA-3473b inhibitor) via tail vein for 3 days, with 2 nmol siRNA dose per mouse. Serum was separated from the blood, and liver and kidney functions (alanine aminotransferase, aspartate aminotransferase, urea, and creatinine) and representative blood parameters (erythrocytes, leukocytes, platelets, and hemoglobin) were tested.

[0054] 1.21. Gene silencing in vitro and in vivo Macrophages were incubated in CTP-NPs containing 30 nM miRNA inhibitor (MT-miRNA-3473b inhibitor) for 24 h. The macrophages were then transferred to fresh DMEM medium and treated with LPS and IFN-γ for 24 h. After incubation, macrophages were collected and total RNA was extracted for qRT-PCR.

[0055] BALB / c mice were randomly divided into two groups (12 mice in each group) and VM models were established by intraperitoneal injection. Two days later, CTP-NPs (MT-NC inhibitor) or CTP-NPs (MT-miRNA-3473b inhibitor) were injected through the tail vein at a dose of 2 nmol miRNA inhibitor per mouse for three consecutive days. On the 7th day, the mice were examined by ultrasound and tissues were collected for further study.

[0056] 1.22 Statistical Analysis Data are presented as mean ± standard deviation (SD). Statistical analysis was performed using two-tailed independent Student's t-test or ANOVA. The survival status of mice was assessed by Kaplan-Meier (KM) plots, and survival time was analyzed using the log-rank test. All analyses were performed using GraphPad Prism 5.0 (GraphPad Software). A p value of less than 0.05 was considered statistically significant.

[0057] The technical effects achieved by the present invention are described below in conjunction with specific test results.

[0058] 2.1 Expression of miRNAs in M1 macrophages In order to explore the miRNAs that regulate mitochondrial function and macrophage polarization, the present invention screened the differentially expressed miRNAs in undifferentiated M0 macrophages and differentiated M1 macrophages. The present invention uses anti-TOM22 magnetic labeling to enrich and purify mitochondrial components in macrophages. The operation process is as follows Figure 1 As shown in A. Figure 1 B is the result of validation of mitochondria purified from macrophages using the indicated protein markers (Tom20 for mitochondria). Figure 1 As shown in Figure B, the present invention further confirmed the purity of the mitochondrial component by detecting mitochondrial (Tom20) and whole cell (β-actin) protein markers. Then, the present invention analyzed the miRNA expression profile of macrophage mitochondria, such as Figure 1 As shown in C. Figure 1 The sequencing results of C showed that the abundance of miRNA was the highest among the known miRNA components, and it showed a decreasing trend during the transition from M0 to M1. A total of 415 miRNAs were identified in the two groups, of which 221 were identified in the M1 group and 65 were identified in the M0 group.

[0059] Figure 1 D is the Venn diagram of miRNAs in M0 and M1 macrophages; Figure 1 E is the volcano plot of differentially expressed mitochondrial miRNAs in M0 and M1 macrophages; Figure 1F is a heat map of differentially expressed mitochondrial miRNAs in M0 and M1 macrophages. Figure 1 D~ Figure 1 F shows that 70 miRNAs were upregulated and 60 miRNAs were downregulated in M1 cells. Figure 1 G is the top 20 test results of KEGG enrichment pathways of differentially expressed mitochondrial miRNA target genes. Figure 1 KEGG enrichment analysis of G showed that the MAPK signaling pathway was significantly enriched among the differentially expressed miRNAs target genes.

[0060] To verify the miRNA sequencing results, qRT-PCR was used to detect 12 differentially expressed miRNAs in the mitochondrial fraction of macrophages. Figure 2 As shown in A. Figure 2 A shows that, compared with M0 macrophages, the expression level of miRNA-3473b in the mitochondria of M1 macrophages is the most significantly upregulated miRNA. Figure 2 As shown in B, the present invention also detected the co-localization of miRNA-3473b and mitochondria by RNA FISH technology.

[0061] 2.2 Role of miRNA-3473b in the polarization of M1 and M2 macrophages In order to further clarify the role of miRNA-3473b in macrophage polarization, the present invention transfected miRNA-3473b mimics or inhibitors into macrophages to overexpress or inhibit miRNA-3473b expression. Figure 3 A and 3B. Figure 3 As shown in A and 3B, in the whole cells, miRNA-3473b expression was upregulated by about 20 times after transfection with miRNA-3473b mimics. In contrast, miRNA-3473b expression was significantly downregulated after transfection with miRNA-3473b inhibitor.

[0062] Furthermore, the effects of miR-3473b mimics or inhibitors on the expression of miRNA-3473b in macrophage mitochondria were investigated. Figure 3 C and 3D. Figure 3 As shown in C and 3D, miR-3473b mimics or inhibitors still have a significant effect on the expression of miRNA-3473b in macrophage mitochondria.

[0063] Furthermore, if Figure 4 A and Figure 4As shown in B, in M1 macrophages, qRT-PCR analysis showed that the expression of M1 markers (NOS2, TNF-α, and IL-12) increased after miRNA-3473b overexpression, while the expression was decreased after miRNA-3473b inhibition. Figure 4 C and Figure 4 As shown in D, the expression of M2 markers (Arg1, YM1, and FIZZ1) was reduced in M2 macrophages overexpressing miRNA-3473b, but was induced after inhibition of miRNA-3473b. Figure 4 E and Figure 4 As shown in F, in macrophages overexpressing or inhibiting miRNA-3473b, the changes in protein expression of iNOS2 and Arg1 were consistent with the mRNA expression results. These results together indicate that miRNA-3473b plays a key role in promoting M1 macrophage polarization.

[0064] 2.3. miRNA-3473b regulates its mitochondrial function The aforementioned RNA FISH or qRT-PCR technology confirmed that miRNA-3473b partially colocalized with mitochondria, indicating that it may be involved in mitochondrial-related cellular processes. The present invention further conducted relevant research on miR-3473b regulating mitochondrial function and cell apoptosis. Among them, Figure 5 A and 5B were tested by flow cytometry using MitoSOX™ red stain to detect ROS produced by M1 macrophages after treatment with miR-3473b mimics or miR-3473b inhibitors; Figure 5 C is the test results of ATP levels in M1 macrophages after treatment with miR-3473b mimics or miR-3473b inhibitor. Figure 5 D and Figure 5 E: The cell apoptosis of M1 macrophages after treatment with miR-3473b mimics or miR-3473b inhibitors was detected by flow cytometry using Annexin V-PI single staining method.

[0065] Depend on Figure 5 A. 5B combination Figure 5 C shows that upregulation of miRNA-3473b reduced ATP levels, while mitochondrial ROS levels were significantly increased in M1 macrophages. However, downregulation of miRNA-3473b expression restored ATP production and reduced mitochondrial ROS levels. Figure 5 As shown in Figures 5D and 5E, the present invention found that overexpression of miRNA-3473b increased the apoptosis of M1 macrophages, while inhibition of miRNA-3473b reduced the apoptosis of M1 macrophages.

[0066] like Figure 6 As shown, the present invention further found through Western blotting that after miRNA-3473b overexpression, the classic apoptosis indicators (cleaved-caspase 3 and Bax) were significantly increased in M1 macrophages; the expression of Bcl-2 (upstream factor of the apoptotic mitochondrial pathway) was significantly reduced. In addition, no significant changes in the expression level of Caspase-9 protein were detected in miRNA-3473b overexpression. However, Western blotting results showed that after miRNA-3473b inhibition, the expression levels of apoptosis indicators (cleaved-caspase3 and Bax) were not significantly downregulated, while the expression of Bcl-2 protein was upregulated. These results indicate that the effects of miRNA-3473b knockdown on ROS production, apoptosis, and apoptosis-related gene expression in M1 macrophages are milder than miRNA-3473b overexpression.

[0067] 2.4. miRNA-3473b mainly affects mitochondrial function by regulating the expression of mitochondrial mRNA.

[0068] To elucidate the role of miRNA-3473b in mitochondria, we analyzed the expression of 13 mitochondrial DNA-encoded mRNAs (mt-mRNAs), which are the main components of the mitochondrial respiratory chain. Figure 7 shown.

[0069] Depend on Figure 7 As shown in A and 7B, overexpression of miRNA-3473b significantly inhibited the expression levels of 13 mt-mRNAs. In contrast, all mt-mRNAs were not significantly upregulated after inhibition of microRNA-3473b ( Figure 7 A and 7B). Therefore, the present invention speculates that the potential mechanism by which miRNA-3473b regulates mitochondrial function may be due to its effect on mitochondrial gene transcription. Previous studies have shown that miRNA can participate in the transcriptional regulation of nuclear genes by complementing gene promoters. Therefore, the present invention speculates that miR-3473b may be responsible for regulating mitochondrial transcription.

[0070] To this end, the present invention used RNAhybrid (https: / / bibiserv.cebitec.uni-bielefeld.de / rnahybrid) to predict the potential binding sites between miR-3473b and the mitochondrial genome and found that there was a best matching region from 8898 to 8923 (e.g. Figure 7 C). In order to study which part of the complementary sequence plays a gene silencing role, Figure 7As shown in D, the present invention constructed three mutants of miR-3473b mimics, wherein the 3' region of miR-3473b contained four base mutations (3'-mut), the middle region contained one base mutation (mid-mut), and the 5' region contained seven base mutations (5-mut). Then, as Figure 7 As shown in E, the present invention detected the expression levels of 13 mt-mRNAs in macrophages treated with four different miR-3473b mimics. Only mutations in the 3' region of the miR-3473b mimics, but not mutations in other regions, lost the ability to inhibit the expression of ND1, ND3, ATP6 and CO2, indicating that the 3' region of the mitochondrial genome from 8898 to 8923 is essential for the binding of miR-3473b. The above results indicate that miR-3473b mediates mitochondrial transcriptional activity through a specific seed sequence.

[0071] Furthermore, the present invention uses the Seahorse XF cell mitochondrial stress test kit and the glycolysis stress test kit to determine the role of miR-3473b in regulating macrophage mitochondrial metabolism. Figure 8 The data from the mitochondrial stress test shown in A showed that miR-3473b overexpression (OE) suppressed the oxygen consumption rate (OCR). The maximal respiration and ATP production of miR-3473b–OE cells were significantly reduced. Figure 8 ECAR analysis of the glycolytic stress test shown in B showed that miR-3473b-OE significantly promoted the glycolytic capacity of macrophages. Figure 8 As shown in C, when miR-3473b was upregulated, the protein levels of glycolytic metabolic genes (PKM2 and HIF-1α) increased. These results indicate that miR-3473b plays an important role in regulating macrophage glucose metabolism.

[0072] 2.5 Knockdown of miRNA-3473b alleviates CVB3-induced inflammation and myocardial injury In order to determine the role of miRNA-3473b in macrophages in myocarditis caused by CVB3 infection, the present invention first detected the expression of miRNA-3473b in macrophages of CVB3-infected mice. Fig. 9 As shown in A and 9B, miRNA-3473b expression was significantly upregulated in CVB3-treated mice compared with PBS-treated mice. Meanwhile, 13 mitochondrial mRNAs (mt-mRNAs) showed a consistent downward trend in CVB3-infected mice ( Fig. 9 A and Fig. 9B). These results suggest that upregulated miRNA-3473b may aggravate VM by disrupting macrophage mitochondrial function. To verify this speculation, the present invention used AAV9-miRNA-3473b-sponge to inhibit miRNA-3473b expression and studied the role of miRNA-3473b in the M1 macrophage-associated CVB3-induced myocarditis mouse model. The operation process is as follows Fig. 9 C. The test results are shown in Fig. 9 D. Fig. 9 E. Compared with the hearts of the NC group, the inflammatory cell infiltration and necrotic focal areas in the hearts of the miRNA-3473b inhibitor group were reduced. In addition, the concentration of cTnI, a marker of myocardial injury, in the serum of miRNA-3473b knockdown mice was significantly reduced after CVB3 infection. Fig. 9 F and Fig. 9 The survival rate and body weight test results of G showed that, consistent with the above results, miRNA-3473b knockdown effectively improved the survival rate and weight loss of mice after CVB3 infection ( Fig. 9 F and 9G).

[0073] In addition, if Fig.10 As shown, when the present invention uses echocardiography to evaluate cardiac function, significant cardiac dysfunction is restored in the CVB3-infected miRNA-3473b inhibitor group mice, as shown by increased shortening fraction (FS) and ejection fraction (EF). In summary, the above test data of the present invention indicate that miRNA-3473b is a key regulator of myocardial inflammation in macrophages during CVB3-induced myocarditis.

[0074] 2.6. Knockdown of miRNA-3473b reduced the abundance of M1 macrophages but increased the abundance of M2 macrophages in the CVB3-induced viral myocarditis model Previous studies of the present invention have shown that macrophage polarization plays a key role in the inflammatory response of VM. Therefore, the present invention aims to study the important role of miRNA-3473b in viral myocarditis VM by regulating macrophage polarization. Fig.11 A qRT-PCR analysis showed that the expression levels of M1 marker genes (including enzyme NOS2, IL-12, and TNF-α) in the heart tissue of the miRNA-3473b inhibitor group were lower than those in the NC heart tissue after CVB3 infection. In addition, compared with the M1 marker genes, the M2 marker genes (including Arg1, FIZZ1, and YM1) in the mice of the miRNA-3473b inhibitor group showed opposite changes. Fig.11Western blotting experiments in B verified that the M1 marker iNOS was downregulated and the M2 marker Arg1 was upregulated in VM mice treated with the miRNA-3473b inhibitor group ( Fig.11 B). Fig.11 CAnalyze macrophage subsets by flow cytometry. The sorting steps are as follows: First, label individual cells as macrophages (CD11b+). Then, macrophages are classified into M1 type (CD86 + ) and M2 type (CD206 + In the CVB3-induced VM model, the expression of M1 macrophages (CD11b + CD86 + ) decreased, while the proportion of M2 macrophages (CD11b + Arg1 + ) ratio increased.

[0075] iNOS and Arg1 are associated with pro-inflammatory and repair-related processes, respectively, while F4 / 80 is a macrophage surface marker. Fig.12 The results of co-immunofluorescence staining of F4 / 80 / iNOS or F4 / 80 / Arg1 are shown. Fig.12 The staining results showed that compared with CVB3-infected heart tissue, the iNOS-positive M1 macrophage subset in the miRNA-3473b inhibitor group was reduced, while the Arg1-positive M2 macrophage subset was increased. These results indicate that miRNA-3473b knockdown promotes the M1-to-M2 phenotype transition of macrophages in VM.

[0076] 2.7. miRNA-3473b regulates mitochondrial function in a viral myocarditis model In order to clarify the relationship between miRNA-3473b and mitochondria in the regulation of viral myocarditis, the present invention studied the function of miRNA-3473b in vivo. Fig.13 As shown in A, the present invention found that in cardiac tissue, after treatment with miRNA-3473b inhibitor, the expression levels of multiple mt-mRNAs (ND1, ND3, ND4, ND4L, ND5, ND6 and ATP8) were significantly upregulated ( Fig.13 A). Accordingly, Fig.13 TUNEL staining in B showed that lower apoptosis levels were observed in mice treated with the inhibitor group ( Fig.13 B). Fig.13Western blot results of C showed that after miRNA-3473b silencing, the expression levels of Caspase-9, cleaved-caspase3, and Bax proteins were significantly decreased, while the expression level of Bcl-2 was expected to increase. Meanwhile, miRNA-3473b inhibitor reduced the expression levels of PKM2 and HIF-1α. These results suggest that inhibition of miRNA-3473b can inhibit apoptosis in vivo by partially regulating mitochondrial-encoded gene expression and glucose metabolism reprogramming.

[0077] 2.8. Characteristics of mitochondrial-targeted miRNA inhibitor nanoparticles In order to effectively deliver siRNA to mitochondria in vivo to treat myocarditis, the present invention prepared a mitochondrial-targeted miRNA inhibitor nanoplatform to more effectively regulate mitochondrial metabolism. The nanoplatform consists of a hydrophilic shell (polyethylene glycol, PEG), a hydrophobic core (poly (2-(diisopropylamino) ethyl methacrylate, PDPA) polymer), a mitochondrial-targeted and membrane-penetrating peptide amphiphilic molecule (MMPA), and siRNA encapsulated in the hydrophobic core. Finally, the cardiac targeting peptide (CTP) is loaded onto the surface of the nanoplatform through NHS membrane phospholipid anchoring. Fig.14 Transmission electron microscopy (TEM) and dynamic light scattering (NTA) shown in A and 14B showed that the NPs had a typical “round” morphology with a peak particle size of 142.4 nm and a surface charge of approximately 11 mV.

[0078] Then, the present invention evaluated the endosomal escape ability of NPs loaded with miRNA inhibitors and their ability to target mitochondria. BMDM cells were treated with NPs containing Cy5-labeled miRNA-3473b inhibitors. Fig.14 As shown in C, after 1 hour, orange (inhibitor) and red (endosome) fluorescence were significantly colocalized, indicating that the miRNA-3473b inhibitor was mainly localized in the endosome. When the incubation time was extended to 4 hours, the colocalization of orange (inhibitor) and red (endosome) fluorescence in the cells was significantly reduced, indicating that the miRNA-3473b inhibitor escaped from the endosome. Interestingly, these escaped miRNA-3473b inhibitor / MMPA complexes were efficiently and specifically delivered to the mitochondria, as shown by the colocalization of orange (inhibitor) and red (mitochondria) fluorescence ( Fig.14 C). These results indicate that the miRNA inhibitor-loaded NPs developed in the present invention can achieve the purpose of mitochondrial targeted miRNA inhibitor delivery by utilizing their endosomal pH response characteristics and mitochondrial targeting ability.

[0079] After confirming that nanoparticles can specifically deliver miRNA inhibitors to mitochondria, the present invention investigated whether nanoparticles loaded with miRNA inhibitors can be used to regulate the expression of miRNA-3473b and mt-RNAs. Fig.15 As shown. Fig.15 As shown, after co-incubation with CTP-loaded nanoparticles (MT-miRNA-3473b inhibitor), the expression level of miRNA-3473b was significantly reduced ( Fig.15 Left panel), and the expression of miRNA-3473b and NOS2 was decreased in M1 BMDMs, while the expression of four mt-RNAs (ND1, ND3, ND5, and ATP8) was upregulated ( Fig.15 right).

[0080] 2.9 In vivo therapeutic effect of CTP NP (MT-miRNA inhibitor) After confirming the function of NPs in M1 macrophages and mitochondria in vitro, the present invention then monitored the distribution of NPs in vivo. Fig.16 As shown in A, CTP-NPs (MT-NC inhibitor) or CTP-NPs (MT-miRNA-3473b inhibitor) were injected through the tail vein. After 24 hours, the sections showed that the Cy5-labeled miRNA inhibitor and FITC-labeled MMPA were significantly accumulated in the heart tissue. After confirming the accumulation of miRNA inhibitors in the heart, the present invention tested the therapeutic effect of MT-miRNA-3473b inhibitor (CTP-NPs) by injecting these NPs through the tail vein. The animal experiment operation process is as follows Fig.16 B, and the treatment effects are shown in 16C, 16D, and 16E. Compared with the NC treatment group, inflammatory cell infiltration and serum cTnI levels in the heart sections of CVB3-induced VM mice were reduced in the miRNA-3473b inhibitor treatment group ( Fig.16 C and Fig.16 D). In addition, CTP-NPs (MT-miRNA-3473b inhibitor) attenuated weight loss in VM mice ( Fig.16 E).

[0081] In addition, the left ventricular fractional shortening (FS) and ejection fraction (EF) test results of the miRNA-3473b inhibitor treatment group were Fig.17 As shown. Fig.17 It can be seen that the FS and EF of the miRNA-3473b inhibitor-treated group were significantly higher than those of the NC-treated group. These results indicate that the cardiac function of mice was significantly restored after CTP-NPs (MT-miRNA-3473b inhibitor) treatment.

[0082] In summary, the present invention studies the role of miRNA-3473b in macrophage polarization in viral myocarditis (VM) and finds that high expression of miR-3473b in macrophages can lead to mitochondrial dysfunction by regulating the transcription of mitochondrial DNA encoding genes, thereby exacerbating VM. Therefore, based on the important role of miR-3473b in macrophage mitochondria, the present invention develops a nanoplatform targeting myocardium and mitochondria and evaluates its potential for treating VM. Comprehensive experiments show that mitochondrial miR-3473b regulates CVB3-induced viral myocarditis by regulating macrophage metabolic reprogramming, and mitochondrial miR-3473b inhibitors have excellent application potential and development prospects in the treatment of viral myocarditis.

[0083] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Use of a mitochondrial miR-3473b inhibitor in the preparation of a therapeutic drug for viral myocarditis, characterized in that: The product name of the mitochondrial miR-3473b inhibitor is micrOFF mmu-miR-3473b inhibitor, and the product number is miR213427144630-1-5.

2. Use of the mitochondrial miR-3473b inhibitor according to claim 1 in the preparation of a therapeutic drug for viral myocarditis, characterized in that: The viral myocarditis is caused by Coxsackie virus B3 as the main pathogen.

3. A nanocarrier loaded with a mitochondrial miR-3473b inhibitor, characterized in that: It is mainly prepared from amphiphilic molecule MMPA, mitochondrial miR-3473b inhibitor, polymer NHS-PEG-PDPA, salicylic acid and CTP peptide; the product name of the mitochondrial miR-3473b inhibitor is micrOFF mmu-miR-3473b inhibitor, and the product number is miR213427144630-1-5.

4. The nanocarrier loaded with mitochondrial miR-3473b inhibitor according to claim 3, characterized in that: The preparation method of the nanocarrier loaded with mitochondrial miR-3473b inhibitor comprises the following steps: The amphiphilic molecule MMPA, the mitochondrial miR-3473b inhibitor, and the polymer NHS-PEG-PDPA are mixed in water, and then ultrasonically emulsified and centrifuged to obtain nanoparticles; the nanoparticles are dissolved in a solvent, and then salicylic acid is added for a first incubation, and then CTP peptide is added for a second incubation, and the nanocarrier loaded with the mitochondrial miR-3473b inhibitor is obtained after centrifugation.

5. The nanocarrier loaded with mitochondrial miR-3473b inhibitor according to claim 4, characterized in that: The dosage ratio of the amphiphilic molecule MMPA, the mitochondrial miR-3473b inhibitor, the polymer NHS-PEG-PDPA, salicylic acid, and the CTP peptide is 50 μg: 1 nmol: 4 mg: 20 μg: 30 μg.

6. The nanocarrier loaded with mitochondrial miR-3473b inhibitor according to claim 4, characterized in that: The solvent is dimethyl sulfoxide; the temperature of the first incubation is 36-38° C., and the time is 3-6 hours; the temperature of the second incubation is 36-38° C., and the time is 20-30 hours.

7. Use of the nanocarrier loaded with a mitochondrial miR-3473b inhibitor according to any one of claims 3 to 6, characterized in that: Application in the preparation of therapeutic drugs for viral myocarditis.

8. The use of the nanocarrier loaded with mitochondrial miR-3473b inhibitor according to claim 7, characterized in that: The viral myocarditis is caused by Coxsackie virus B3 as the main pathogen.

9. The use of the nanocarrier loaded with mitochondrial miR-3473b inhibitor according to claim 7, characterized in that: The therapeutic drug comprises the nanocarrier loaded with the mitochondrial miR-3473b inhibitor and a pharmaceutically acceptable excipient.

10. The use of the nanocarrier loaded with mitochondrial miR-3473b inhibitor according to claim 7, characterized in that: The therapeutic drug is administered orally or by injection; the injection is intravenous or intramuscular.

Images