Application of mulberry flavonol extract in preparation of hypoglycemic drugs

Abstract

The invention discloses an application of a mulberry flavonol extract in preparation of a hypoglycemic drug, and belongs to the technical field of biology. According to the application of the mulberry flavonol extract in the preparation of the hypoglycemic drug, an insulin resistance model is established by utilizing HepG2 cells, and the mulberry flavonol extract acts on IR-HepG2 cells; the influence of the mulberry flavonol extract on cell glucose consumption, glycogen synthesis, glycometabolism, lipid metabolism, oxidative stress and glycolysis key enzyme gene expression quantity is analyzed, and the insulin resistance improving effect of the mulberry flavonol extract is verified from the cell level.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and more particularly to an application of a mulberry flavonoid alcohol extract in the preparation of a blood sugar-lowering drug. Background Art

[0002] Insulin resistance (IR) is the reduced ability of insulin-mediated glucose transport to muscle and adipose tissue. It is clinically characterized by glucose and lipid metabolism disorders, including obesity, hyperinsulinemia, hyperglycemia and hyperlipidemia, and is affected by both genetic and environmental factors. IR is the main pathogenic factor of type 2 diabetes mellitus (T2DM) and is closely related to the disease process. HepG2 cells are human liver cancer cell lines with the characteristics of long life, easy handling and high practicality. At present, the main method used by researchers to study IR is the in vitro IR-HepG2 model. The IR-HepG2 model constructed by HepG2 cells through insulin concentration induction can better simulate the pathogenesis and biochemical state of patients with hyperglycemia, thereby providing a theoretical basis for the prevention of diabetes. Yang et al. found that the use of IR-HepG2 cell model to study total flavonoids and saponins of chrysanthemum can promote glucose uptake and glycogen synthesis in IR-HepG2 cells, reduce lipid accumulation, improve mitochondrial function, and reduce reactive oxygen species (ROS) generation. Ma et al. found that stilbene compounds can significantly inhibit the expression of lipid metabolism-related proteins such as peroxisome proliferators-activated receptor (PPARγ) in IR-HepG2 cells, and at the same time upregulate the expression of sugar metabolism-related proteins such as phosphorylated phosphatidylinositol kinase (PI3K). Wang et al. studied the effect of lemon peel polyphenols on sugar metabolism in the IR-HepG2 model, and the results showed that it alleviated the insulin resistance of IR-HepG2 cells and regulated the sugar metabolism level by promoting glycogen synthesis, increasing the activity of key enzymes in glycolysis, and reducing the activity of gluconeogenesis enzymes. Yang et al. found that nettle polysaccharides can reduce insulin resistance by affecting the glucose consumption of IR-HepG2 cells and increase the activity of key glycolytic enzymes such as hexokinase (HK), pyruvate kinase (PK), phosphoenolpyruvate carboxykinase (PEPCK), and glucose-6-phosphatase (G6Pase).

[0003] Mulberry is the fruit of the plant of the genus Morus (Morus L.) of the Moraceae family. It is also a traditional Chinese medicine in my country. The former Ministry of Health listed it in the list of "medicine and food of the same origin". In addition, mulberry extract has the effect of lowering blood sugar. Mulberry anthocyanin extract significantly improves the steady-state index of insulin resistance in diabetic db / db mice, and reduces fasting blood sugar and glycosylated hemoglobin. The purified anthocyanin extract of mulberry reduces the activity of phosphoenolpyruvate carboxykinase (PEPCK) and glucose-6-phosphatase (G6Pase), the key enzymes of gluconeogenesis in HepG2 cells, and increases the glucose consumption activity and glycogen level of HepG2 cells. At present, there is no research report using the IR-HepG2 cell model to study the effect of mulberry flavonols on IR.

[0004] Therefore, providing an application of mulberry flavonoid alcohol extract in the preparation of hypoglycemic drugs is an urgent problem to be solved by those skilled in the art. Summary of the invention

[0005] In view of this, the present invention provides an application of a mulberry flavonoid alcohol extract in the preparation of a blood sugar-lowering drug.

[0006] The present invention adopts the IR-HepG2 cell model constructed by insulin concentration induction to analyze the effect of mulberry flavonoids extract on cellular glucose consumption, glycogen synthesis, sugar metabolism, lipid metabolism, oxidative stress and the expression of key enzyme genes in glycolysis, verify its efficacy in improving insulin resistance at the cellular level, and explore the mechanism of mulberry flavonoids extract in lowering blood sugar in IR-HepG2 cells.

[0007] In order to achieve the above object, the present invention adopts the following technical solution:

[0008] Application of a mulberry flavonoid alcohol extract in the preparation of a blood sugar-lowering drug.

[0009] Furthermore, a mulberry flavonoid alcohol extract is used in the preparation of a hypoglycemic drug based on regulating glycolysis in insulin-resistant HepG2 cells.

[0010] Furthermore, the preparation method of the mulberry flavonoid alcohol extract is as follows:

[0011] (1) Take frozen mulberries and dry them in a 60°C constant temperature drying oven for 48 hours until they are dried to a constant weight; weigh the dried mulberries and crush them, and pass them through a 50-mesh sieve to obtain mulberry powder; add petroleum ether to the mulberry powder at a ratio of 1:10 (g:mL), reflux in a 75°C water bath, filter, and recover the filter residue. After the petroleum ether is fully volatilized, place the residue in a 60°C constant temperature drying oven to dry, and obtain defatted mulberry powder, which is refrigerated at 4°C for use;

[0012] (2) Take defatted mulberry powder, extract it at a solid-liquid ratio of 1:40 (g:mL), ultrasonic time of 60 min, and ultrasonic temperature of 70°C, repeat the above extraction operation twice, centrifuge at 8000 r / min for 5 min, combine the supernatants, evaporate the combined supernatants to dryness using a rotary evaporator, dissolve them in hot deionized water, and extract them with ethyl acetate to obtain a lighter-colored organic phase flavonol crude extract; rotary evaporate the organic phase flavonol crude extract to obtain concentrated flavonol compounds;

[0013] (3) The concentrated flavonol compounds were re-dissolved with hot deionized water, and loaded onto an AB-8 macroporous adsorption resin column using a distilled water wet method, eluted with 40% ethanol, concentrated the ethanol under reduced pressure, and finally freeze-dried to obtain a mulberry flavonol extract.

[0014] It can be seen from the above technical scheme that compared with the prior art, the present invention discloses an application of mulberry flavonoid alcohol extract in the preparation of hypoglycemic drugs. An insulin resistance model is established using HepG2 cells, and 0.08 mg / mL of mulberry flavonoid alcohol extract is applied to IR-HepG2 cells to evaluate their glucose consumption, glycogen synthesis content, sugar metabolism, lipid metabolism, and oxidative stress levels. Real-time PCR is used to detect the expression of glycolysis key enzyme genes HK, PK and their family genes, and the efficacy of mulberry flavonoid alcohol extract in improving insulin resistance and the mechanism of lowering blood sugar are explored at the cellular level. The efficacy of improving insulin resistance is further verified at the cellular level, and the mechanism of mulberry flavonoid alcohol extract in lowering blood sugar in IR-HepG2 cells is explored. Mulberry flavonoid alcohol extract can promote glucose consumption and glycogen synthesis in IR-HepG2 cells, increase the activity of HK (hexokinase), PK (pyruvate kinase), GSH (glutathionease), CAT (catalase), SOD (superoxide dismutase), and reduce the activity of PEPCK (phosphoenolpyruvate kinase), TC (total cholesterol), and triglycerides (TG), thereby promoting glycolysis, inhibiting gluconeogenesis, regulating oxidative stress, and reducing lipid accumulation. It plays a hypoglycemic effect by increasing the expression of key glycolytic enzyme genes HK1, HK2, HK3, HK4, PKL, PKR, PKM1, and PKM2. Mulberry flavonoid alcohol extract achieves the purpose of lowering blood sugar by promoting the expression of key glycolytic enzyme genes in IR-HepG2 cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0016] Figure 1 The attached figure is a gradient elution curve of the flavonol extract of the macroporous adsorption resin of the present invention;

[0017] Among them, No. 1-5 is distilled water eluent, No. 6-10 is 30% ethanol eluent, No. 11-15 is 40% ethanol eluent, No. 16-20 is 50% ethanol eluent, No. 21-25 is 60% ethanol eluent, and No. 26-30 is 70% ethanol eluent;

[0018] Figure 2 The accompanying drawings show the effects of the concentration of the mulberry flavonoid alcohol extract (A) and the insulin concentration (B) on the viability of HepG2 cells, and the establishment of the IR-HepG2 cell model induced by different concentrations of insulin (C) and different action times (D);

[0019] Among them, a, b, and c represent significant differences between the values ​​of the same indicator (P < 0.05);

[0020] Figure 3 The accompanying drawings show the effects of the mulberry flavonoid alcohol extract of the present invention on the glucose consumption activity (A), glycogen synthesis (B), glucose metabolism (C, D, E), oxidative stress level (F, G, H), and lipid metabolism (I, J) of IR-HepG2 cells, A3 represents the mulberry flavonoid alcohol extract; a, b, c, d in the figure represent the significant differences between the values ​​of the same index (P < 0.05);

[0021] Among them, A: glucose consumption activity; B: glycogen synthesis; C: HK; D: PK; E: PEPCK; F: GSH; G: CAT; H: SOD; I: TG; J: TC;

[0022] Figure 4 The attached figure shows the gene expression levels of the key enzymes of glycolysis in HepG2 cells of the present invention; a, b, c, and d in the figure represent significant differences (P < 0.05) between the values ​​of the same index;

[0023] Figure 5 The accompanying drawing shows the effect of the mulberry flavonoid alcohol extract of the present invention on the gene expression of key enzymes regulating glycolysis in IR-HepG2 cells, A3 represents the mulberry flavonoid alcohol extract; a, b, c, d in the figure represent the significant difference between the values ​​of the same index (P < 0.05);

[0024] Among them, A: HK1; B: HK2; C: HK3; D: HK4; E: PKL; F: PKR; G: PKM1; H: PKM2. DETAILED DESCRIPTION

[0025] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0026] Example 1 Preparation of mulberry flavonoid alcohol extract

[0027] Take an appropriate amount of frozen mulberries and dry them in a constant temperature drying oven at 60°C for 48 h until they are dried to constant weight; weigh the dried mulberries, crush them, and pass them through a 50-mesh sieve to obtain mulberry powder; add petroleum ether to the mulberry powder at a ratio of 1:10 (g:mL), reflux in a 75°C water bath, filter, recover the filter residue, and wait for the petroleum ether to fully evaporate, then place the remaining residue in a constant temperature drying oven at 60°C to dry, to obtain defatted mulberry powder, and refrigerate at 4°C for use. Take defatted mulberry powder, extract it at a solid-liquid ratio of 1:40 (g:mL), ultrasonic time of 60min, and ultrasonic temperature of 70°C, repeat the above extraction operation twice, centrifuge at 8000r / min for 5min, combine the supernatants, evaporate the combined supernatants continuously with a rotary evaporator, dissolve with hot deionized water, and extract with ethyl acetate to obtain a lighter-colored organic phase flavonol crude extract; rotary evaporate the organic phase flavonol crude extract to obtain concentrated flavonol compounds; re-dissolve with hot deionized water, wet-load AB-8 macroporous adsorption resin with distilled water, wash away fructose and protein with distilled water in turn, and then use 30% The crude extract was eluted with ethanol, 40% ethanol, 50% ethanol, 60% ethanol, and 70% ethanol to obtain distilled water eluates in 50 mL centrifuge tubes No. 1-5, 30% ethanol eluates in 50 mL centrifuge tubes No. 6-10, 40% ethanol eluates in 50 mL centrifuge tubes No. 11-15, 50% ethanol eluates in 50 mL centrifuge tubes No. 16-20, 60% ethanol eluates in 50 mL centrifuge tubes No. 21-25, and 70% ethanol eluates in 50 mL centrifuge tubes No. 26-30, the elution concentration of ethanol was determined, the ethanol was concentrated under reduced pressure, and finally freeze-dried to obtain the mulberry flavonoid alcohol extract. The content of mulberry flavonoid alcohol extract was determined by colorimetry, using the NaNO2-Al(NO3)3-NaOH method and the rutin standard curve y=10.023X+0.0038 (X represents the mass concentration of the flavonoid alcohol extract, and y represents the absorbance value) for calculation.

[0028] Purity formula of flavonol extract: =C×V×dilution factor / W;

[0029] Wherein, C: mass concentration of flavonol extract, mg / mL; V: volume of extract, mL; W: mass of paste after freezing of the liquid medicine, mg.

[0030] The elution curve of mulberry flavonoid alcohol extract is shown in Figure 1 ;Depend on Figure 1 It can be seen that the mulberry flavonoid alcohol extract eluted with 40% ethanol has the highest absorbance, reaching 0.8902, and the purity can reach 88.4% after calculation, which is used for subsequent experiments.

[0031] Example 2 Cell culture and establishment of IR-HepG2 cell model

[0032] 1) Cell culture

[0033] Cell recovery: Take out the HepG2 cell cryopreservation tube from the -80℃ refrigerator, place it in a 37℃ water bath to melt for about 2 minutes, transfer the cells to a 15mL sterile centrifuge tube and add 2mL of complete culture medium (5mL fetal bovine serum + 0.5mL blue chain double antibody + 44.5mL low-glucose DMEM culture medium), blow the cells evenly and place them in a 1000rpm centrifuge for centrifugation for 5 minutes, discard the old culture medium in the supernatant, add 2mL of complete culture medium to resuspend the cells (blow the cells evenly), transfer them to a T25 culture flask, and place them in a 37℃, 5% CO2 incubator for incubation.

[0034] Cell passaging: discard the old culture medium of the cells, add 2mL PBS to wash twice, add 1mL trypsin and control the digestion time to 6min. At the same time, after observing the cells in the culture bottle falling off, add 2mL complete culture medium to terminate the digestion (the ratio of trypsin to complete culture medium is 1:2), transfer to a 15mL centrifuge tube, centrifuge at 1000rpm for 5min, discard the old culture medium in the supernatant, add 3mL fresh complete culture medium (add a few milliliters for each generation), transfer to a T25 culture flask, add 3mL complete culture medium, and place incubator at 37℃, 5% CO2 for incubation.

[0035] Cell freezing: discard the old culture medium, add 2mL PBS to wash twice, add 1mL trypsin to digest, add 2mL complete culture medium to stop digestion after the cells fall off, transfer to a 15mL centrifuge tube, centrifuge at 1000rpm for 5min, discard the old culture medium in the supernatant, add 1mL freezing solution (purchased from MacLean), and store the cryotube directly in a -80℃ refrigerator overnight.

[0036] 2) Determination of cell viability

[0037] Add cell suspension containing complete culture medium to a 96-well plate (set up 5 replicate wells), 100 μL per well, and a cell density of 5×10 3Each well was placed in a 37°C, 5% CO2 incubator for incubation for 24 hours. After the cells adhered to the wall, the old culture medium was discarded, and the cells were washed twice with PBS buffer. 100 μL of flavonol extract solution and insulin solution of different concentrations were added respectively, and the cells were incubated in the incubator for 24 hours. The old solution was aspirated, and 100 μL of 10% CCK8 solution was added to each well. The cells were incubated in the incubator for 1 hour, and the absorbance was measured at 450 nm.

[0038] Cell activity (%) = (A experimental group - A blank group) / (A control group - A blank group) × 100%

[0039] The blank group contained only culture medium and CCK8 solution but no cells.

[0040] The effects of mulberry flavonoids extract and insulin concentration on HepG2 cell viability are shown in Figure 2 .

[0041] Depend on Figure 2 A shows that compared with the normal group (Normal, without adding flavonol extract), when the concentration of flavonol extract is above 1.28 mg / mL, the viability of HepG2 cells can be significantly inhibited (P < 0.05); when the concentration of flavonol extract is 0.02-0.64 mg / mL, the cell viability is not significant compared with the normal group (P > 0.05). This shows that the concentration of flavonol extract does not affect the viability of HepG2 cells within the concentration range of 0.02-0.64 mg / mL.

[0042] Depend on Figure 2 B shows that compared with the normal group (Normal, without insulin), the insulin concentration was 10 -1 , 10 -2 mg / mL, cell viability decreased to 10%, significantly inhibiting HepG2 cell viability (P < 0.05). -3 -10 -6 When the insulin concentration was 10 mg / mL, the cell viability in the insulin group was above 100%, so 10 -3 -10 -6 The concentration of mg / mL was used as the insulin concentration for constructing the IR-HepG2 cell model.

[0043] 3) Establishment of IR-HepG2 cell model

[0044] HepG2 cells were placed in each well at 5 × 10 3 Cells (100 μL / well) were inoculated into 96-well plates and cultured for 24 h until the cells adhered to the wall. Then, the serum-free culture medium (0.5 mL of blue chain double antibody + 49.5 mL of low-glucose DMEM culture medium) was replaced and cultured for 10 h. A blank group, a control group, and a model group were set up, with 5 replicates in each group. The model group was added with 10-3 -10 -6 The blank group was added with culture medium without insulin and cells, and the control group was added with culture medium containing only cells for 24 hours. The glucose consumption at different insulin concentrations at different action times was determined according to the method of the glucose determination kit, and the insulin concentration and time with the least glucose consumption were selected as the conditions for constructing the IR-HepG2 cell model.

[0045] Depend on Figure 2 C shows that when the insulin concentration is 10 -3 -10 -6 mg / mL, the glucose consumption of IR-HepG2 cells showed a V-shaped trend and was lower than that of the control group (Control). -5 The glucose consumption of IR-HepG2 cells decreased by 67.9% with the addition of 10 mg / mL insulin, and the difference was significant (P < 0.05). -5 mg / mL is the optimal concentration for IR-HepG2 cell model. -5 mg / mL optimal insulin concentration, the cells were treated for 24h and 48h respectively; the results are shown in Figure 2 D, found that at 24h, compared with the control group, 10 -5 When the glucose consumption was 10 mg / mL, it decreased by 72.7%, and there was a significant difference (P < 0.05). At the same time, the glucose consumption decrease rate was the highest. -5 The insulin resistance model was established by treating cells with insulin at a concentration of 100 mg / mL and acting on the cells for 24 h.

[0046] 4) Determination of glucose consumption of IR-HepG2 cells by mulberry flavonoid extract

[0047] HepG2 cells were plated at 5 × 10 3 Cells (100uL / well) were inoculated into 96-well plates and cultured for 24h until the cells attached to the wall. The serum-free medium was replaced and cultured for 10h. -5 After the IR-HepG2 cell model was established, a control group (Control: cells, culture medium), a model group (Model: cells, insulin, culture medium), a positive control group (MET: 0.08 mg / mL metformin, cells, insulin, culture medium), and a flavonol extract drug group (A3: cells, 0.08 mg / mL mulberry flavonol extract, culture medium, insulin) were set up for 24 hours, with 5 replicates in each group, and the glucose consumption was determined according to the method of the glucose determination kit.

[0048] Effects of mulberry flavonoids extract on glucose consumption activity of IR-HepG2 cells Figure 3 A; By Figure 3 A shows that after 10 -5 After induced by 100 mg / ml insulin, the glucose consumption of the model group was lower than that of the control group, and there was a significant difference (P < 0.05), showing low insulin sensitivity. Compared with the model group, A3 and the positive control metformin increased glucose consumption to a certain extent, indicating that the state of IR-HepG2 cells can be improved and repaired after drug intervention, and there is a significant difference (P < 0.05). The glucose consumption of A3 was higher than that of the model group, which was (3.22 ± 0.06) and (1.41 ± 0.7), respectively, and there was a significant difference (P < 0.05), and there was no significant difference with metformin (P > 0.05). Mulberry mature flavonoids extract can significantly improve insulin sensitivity.

[0049] 5) Determination of the effect of mulberry flavonoids extract on glycogen synthesis in IR-HepG2 cells

[0050] HepG2 cells were cultured at 1×10 6 Cells (2 mL / well) were inoculated into 6-well plates and cultured for 24 h until the cells adhered to the wall. The serum-free medium was replaced and cultured for 10 h. -5 mg / mL of insulin, act on cells for 24h to construct an insulin resistance model. After the IR-HepG2 cell model is built, the cells are grouped and processed according to the operation of step 4), the culture medium is discarded after processing, washed twice with PBS buffer, centrifuged and the supernatant is discarded, 0.225mL of alkaline solution is added to each tube, boiled in water bath for 20min, and 0.225mL of double distilled water is added to the glycogen detection solution. After mixing, boiled in water bath for 5min, and the absorbance was measured at 620nm after cooling. The glycogen content was measured according to the Nanjing Jiancheng Glycogen Assay Kit.

[0051] Glycogen is often stored in the liver and muscles in the form of sugar. It is used as a reserve energy source to synthesize or decompose glucose in the form of glycogen to replenish blood sugar and continuously maintain blood sugar levels in the body within a normal range. Due to cell resistance, the synthesis of glycogen is reduced.

[0052] Effects of mulberry flavonoids extract on glycogen synthesis in IR-HepG2 cells Figure 3 B; by Figure 3B shows that compared with the control group, the glycogen content of the model group decreased by 39.2%, and there was a significant difference (P < 0.05). Compared with the model group, the metformin group and the A3 group both increased the glycogen content, among which the glycogen content of A3 increased by 64.5%, and there was a significant difference (P < 0.05). It can be seen that A3 can alleviate the disorder of glucose metabolism in IR-HepG2 cells and reduce the decrease in glycogen content caused by insulin resistance.

[0053] 6) Determination of the effect of mulberry flavonoids extract on glucose metabolism in IR-HepG2 cells

[0054] The cell grouping and treatment methods are the same as step 5). After the treatment, discard the culture medium, wash the cells twice with PBS buffer, add 1 mL of cell lysis solution, and let it stand on ice for 5-10 minutes. To promote cell lysis, gently blow with a pipette tip, and then transfer it to a 2 mL centrifuge tube. Follow the instructions of the HK, PK, and PEPCK kits and calculate according to the sample protein concentration (BCA protein concentration determination kit).

[0055] Glycolysis is an oxidation reaction of sugar under anaerobic conditions and is a key pathway for glucose decomposition and metabolism in the body. A series of enzymes that catalyze glycolysis reactions are present in the cytoplasm. HK and PK are two key rate-limiting enzymes in glycolysis. Increasing the activity of HK and PK to improve glucose utilization can alleviate insulin resistance and play an important role in regulating blood sugar in the blood. Gluconeogenesis is a sugar-producing reaction in the body that can convert non-sugar substances such as lactic acid, pyruvic acid, amino acids and glycerol into sugar. It mainly occurs in the liver. Inhibiting the activity of the PEPCK enzyme can inhibit the conversion of non-sugar substances into glucose, thereby reducing blood sugar concentration and regulating blood sugar balance.

[0056] Effects of mulberry flavonoids extract on glucose metabolism in IR-HepG2 cells Figure 3 CE.

[0057] Depend on Figure 3 C and Figure 3 D shows that compared with the control group, the HK and PK activities of IR-HepG2 cells in the model group decreased significantly (P < 0.05); after A3 intervention, compared with the model group, the A3 group could increase the HK and PK activities of IR-HepG2 cells by 10.9% and 21.7%, respectively, and there was a significant difference (P < 0.05), which promoted the glycolysis process to a certain extent and thus promoted the absorption and metabolism of glucose. Compared with the metformin group, the HK activity of A3 increased but there was no significant difference (P > 0.05), and the PK activity also increased, and there was a significant difference (P < 0.05). Therefore, A3 promotes glucose metabolism by increasing the HK and PK activities in IR-HepG2 cells, thereby exerting a hypoglycemic effect.

[0058] Depend on Figure 3 E shows that compared with the control group, A3 group and metformin group, the PEPCK activity of IR-HepG2 cells in the model group was significantly increased (P < 0.05), accelerating the process of gluconeogenesis. Compared with metformin, the PEPCK activity of the A3 group was significantly different (P < 0.05); compared with the model group, the PEPCK activity of the A3 group was significantly reduced (P < 0.05), a decrease of 18.3%, indicating that A3 can inhibit the activity of key enzymes in gluconeogenesis, reduce the glucose reaction, and thus play a role in regulating glucose metabolism.

[0059] 7) Determination of the oxidative stress level of IR-HepG2 cells by mulberry flavonoids extract

[0060] The cell grouping and treatment methods are the same as step 5). After the treatment, the cells are lysed as in step 6) according to the instructions of the BCA kit, glutathione (GSH) kit, hydrogen peroxide (CAT) kit, and superoxide dismutase (SOD) kit.

[0061] Oxidative stress is an important cause of insulin resistance. Inhibiting oxidative stress can alleviate insulin resistance and thus reduce the oxidative damage to the body caused by diabetes.

[0062] Effects of mulberry flavonoids extract on oxidative stress level in IR-HepG2 cells Figure 3 FH.

[0063] Depend on Figure 3 FH showed that compared with the model group, both metformin and A3 groups increased the contents of GSH, CAT, and SOD in IR-HepG2 cells to a certain extent, indicating that the model group had an imbalance of oxidative stress. By studying the effect of GSH, it was found that there was no significant difference between metformin and A3 groups and the model group (P>0.05), but the level of GSH activity was increased to a certain extent, and it was higher than that of the model group; when studying CAT and SOD, it was found that the activity of A3 group was significantly higher than that of the model group (P<0.05), and there was no significant difference between A3 and metformin groups (P>0.05), but both could significantly increase the levels of CAT and SOD in IR-HepG2 cells. In summary, mulberry flavonoid alcohol extract can reduce oxidative stress caused by insulin resistance and increase the activity of GSH, CAT, and SOD to a certain extent.

[0064] 8) Determination of lipid metabolism of IR-HepG2 cells by mulberry flavonoids extract

[0065] The cell grouping and treatment method are the same as step 5). After the treatment, the cells are lysed as in step 6) according to the instructions of the BCA kit, total cholesterol (TC) kit, and triglyceride (TG) kit.

[0066] Excessive accumulation of lipids causes obesity and is a necessary factor in the formation of diabetes.

[0067] Effects of mulberry flavonoids extract on lipid metabolism in IR-HepG2 cells Figure 3 IJ.

[0068] Depend on Figure 3 IJ showed that the content of TG and TC in the model group increased significantly compared with the control group (P < 0.05). Compared with the model group, the content of TG and TC in the metformin group was significantly reduced. After A3 treatment, the content of TG and TC was reduced and was significantly lower than that in the model group (P < 0.05). The results showed that mulberry flavonoid alcohol extract can reverse the lipid accumulation of TG and TC in IR-HepG2 cells and regulate lipid metabolism.

[0069] 9) Quantitative RT-PCR analysis

[0070] The cell grouping and treatment method are the same as step 5). After the treatment, the cells are lysed as in step 6. After the cells are lysed, the cell RNA is extracted with Trizol reagent. The concentration and purity of the extracted RNA are measured using Nanodro P-100 micro-nucleic acid analyzer. The absorbance range of A260 / A280 is 1.8-2.0. The extracted RNA is reverse transcribed using the TAKARA reverse transcription kit (RR047A). Finally, the TAKARA TB Premix Ex Taq TM II. Perform RT-PCR on the obtained cDNA. β-actin is used as an internal reference; the primer sequences used for amplification are as follows:

[0071] β-actin-F: GAGCGGGAAATCGTGCGTGACATT; SEQ ID NO.1;

[0072] β-actin-R:GATGGAGTTGAAGGTAGTTTCGTG; SEQ ID NO.2;

[0073] HK1-F: CGTGTCCTTCCTCCTGTCTGAG; SEQ ID NO.3;

[0074] HK1-R: CTGCTTGCCTCTGTGCGTAAC; SEQ ID NO.4;

[0075] HK2-F: GCCAGAGCATCCTCCTCAAGT; SEQ ID NO.5;

[0076] HK2-R: TCACCACAGCAACCACATCCA; SEQ ID NO.6;

[0077] HK3-F: GCAGATCCAAGCCAGCCTCT; SEQ ID NO.7;

[0078] HK3-R: CCAGCACCACGAAGTCTCCTT; SEQ ID NO.8;

[0079] HK4-F: GCTGGTATCGGCTTCTGGAACA; SEQ ID NO.9;

[0080] HK4-R: CCTGTGGATGTGGTGGATGGT; SEQ ID NO.10;

[0081] PKL-F: GGAGGCAGAGGTTGTGGTGAA; SEQ ID NO.11;

[0082] PKL-R: TTCGTGGTCTTGCTGGCTCAT; SEQ ID NO.12;

[0083] PKR-F: TTCAAGCGATTCTCCTGCCTCA; SEQ ID NO.13;

[0084] PKR-R: TCAAGACCAGCCTGACCAACAT; SEQ ID NO.14;

[0085] PKM1-F: CGAGCCTCAAGTCACTCCAC; SEQ ID NO.15;

[0086] PKM1-R: GTGAGCAGACCTGCCAGACT; SEQ ID NO.16;

[0087] PKM2-F: ATTATT TGAGGAACTCCGCCGCCT; SEQ ID NO.17;

[0088] PKM2-R: ATTCCGGGTCACAGCAATGATGG; SEQ ID NO.18.

[0089] The gene expression results of key glycolytic enzymes in HepG2 cells are shown in Figure 4 ; from Figure 4It can be seen that HePG2 cells have gene expression levels in the key glycolysis genes HK1, HK2, HK3, HK4, PKL, PKR, PKM1, and PKM2, which proves that the next step can be carried out to verify the mechanism of action of the hypoglycemic activity of mulberry flavonoid alcohol extract in IR-HepG2 cells.

[0090] To further explore the mechanism of hypoglycemic activity of mulberry flavonoid alcohol extract in IR-HepG2 cells, RT-qPCR was used to detect the gene expression levels of key glycolysis genes HK1, HK2, HK3, HK4, PKL, PKR, PKM1, and PKM2. Insulin signal transduction disorders in IR-HePG2 cells are mainly related to IR. Glycolysis is divided into energy consumption stage and energy production stage, which is more suitable for the growth of IR-HepG2 cells and is also a key pathway for liver glycogen metabolism.

[0091] The results of mulberry flavonoid extract regulating the gene expression of key enzymes in glycolysis are shown in Figure 5 ;Depend on Figure 5 It can be seen that compared with the control group, the gene expression of the eight HK and PK family genes in the model group IR-HepG2 cells was significantly reduced (P < 0.05). Compared with the model group, the gene expression levels of the eight HK and PK family genes in the metformin group and the A3 group were significantly increased (P < 0.05). The results show that A3 can increase the gene expression of the eight HK and PK family genes, which are key genes in glycolysis, accelerate the utilization of glucose, increase the synthesis of glycogen, and achieve the effect of regulating glycolysis. During glycolysis, pyruvate is reduced to lactate, and the energy in the process is produced together with glycolysis metabolites, which are essential for the growth, survival and activity of IR-HepG2 cells.

[0092] 10) Statistical analysis

[0093] Data were collected using Excel 2016 and analyzed using SPSS 19.0. The results were expressed as "mean ± standard deviation". One-way analysis of variance was used to show the differences in the various indicators of the samples, and P < 0.05 indicated significant differences. Pearson was used to analyze the correlation between the indicators.

[0094] The present invention uses IR-HepG2 cells as a model to study the hypoglycemic activity and mechanism of mulberry flavonoid alcohol extract. Glycolysis, glycogen synthesis and decomposition in the liver play an important role in regulating glucose metabolism. Glucose and lipid metabolism are also metabolic modes of the liver. Glycogen is a polymer of glucose, which is mainly stored in the liver and skeletal muscle, and glycogenolysis is the main source of blood sugar, which promotes glycogen synthesis to allow blood sugar to enter the liver and muscle tissue. At the same time, free fatty acids are metabolized between the liver and peripheral tissues. When insulin resistance occurs, the body has glucose and lipid metabolism disorders. When HepG2 cells are in a state of insulin resistance, mulberry flavonoid alcohol extract increases IR-HepG2 cell glucose consumption and glycogen synthesis. Existing studies have also shown that high cholesterol will be oxidized on the blood vessel wall, leading to diseases such as coronary atherosclerosis. Insulin resistance can lead to lipid accumulation. After treatment with mulberry flavonoid alcohol extract, the condition of lipid metabolism disorders is improved. Previous studies have also shown that oxidative damage may also be a cause of insulin resistance. In order to protect cells from the influence of oxidative damage, the present invention uses GSH, CAT, SOD antioxidant enzymes to resist insulin resistance. The glycolysis pathway is the process of breaking down glucose into pyruvate in the cytoplasm. Hexokinase is the first key enzyme in the decomposition process. Under the action of hexokinase (HK), glucose consumes ATP and is converted into glucose-6-phosphate. HK has four family genes in mammals: HK1, HK2, HK3 and HK4. Pyruvate kinase (PK) is a rate-limiting enzyme in glycolysis. In the presence of adenosine diphosphate (ADP), it can catalyze phosphoenolpyruvate (PEP) to produce pyruvate, and pyruvate is then converted into lactate by lactate dehydrogenase (LDH). PK also has four family genes in mammals: PKL, PLR, PKM1, and PKM2. Fermenting mulberries can increase the protein content of glycolysis key enzymes HK and PK and promote glycolysis. In the present invention, the mulberry flavonoid alcohol extract plays an important role in sugar and lipid metabolism, and improves cellular insulin resistance through eight family genes of key glycolytic enzymes HK and PK.

[0095] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. Use of a mulberry flavonoid alcohol extract in the preparation of a hypoglycemic drug.

2. Application of a mulberry flavonoid alcohol extract in the preparation of a hypoglycemic drug based on regulating glycolysis in insulin-resistant HepG2 cells.

3. The use according to claim 1 or 2, characterized in that: The preparation method of the mulberry flavonoid alcohol extract is as follows: (1) Take frozen mulberries and dry them in a 60°C constant temperature drying oven for 48 hours until they are dried to a constant weight; weigh the dried mulberries and crush them, and pass them through a 50-mesh sieve to obtain mulberry powder; add petroleum ether to the mulberry powder at a ratio of 1:10 (g:mL), reflux in a 75°C water bath, filter, and recover the filter residue. After the petroleum ether is fully volatilized, place the residue in a 60°C constant temperature drying oven to dry, and obtain defatted mulberry powder, which is refrigerated at 4°C for use; (2) Take defatted mulberry powder, extract it at a solid-liquid ratio of 1:40 (g:mL), ultrasonic time of 60 min, and ultrasonic temperature of 70°C, repeat the above extraction operation twice, centrifuge at 8000 r / min for 5 min, combine the supernatants, evaporate the combined supernatants to dryness using a rotary evaporator, dissolve them in hot deionized water, and extract them with ethyl acetate to obtain a lighter-colored organic phase flavonol crude extract; rotary evaporate the organic phase flavonol crude extract to obtain concentrated flavonol compounds; (3) The concentrated flavonol compounds were re-dissolved with hot deionized water, and loaded onto an AB-8 macroporous adsorption resin column using a distilled water wet method, eluted with 40% ethanol, concentrated the ethanol under reduced pressure, and finally freeze-dried to obtain a mulberry flavonol extract.

Images