Construction method and application of globin gene humanized mouse beta-thalassemia CD17 point mutation animal model

Abstract

The invention discloses a construction method and application of a globin gene humanized mouse beta-thalassemia CD17 point mutation animal model, by utilizing a guide editing technology, an epegRNA sequence (independently designed sequences mainly comprise spacer, PBS, RT and 1inner sequences) of a targeted HBB gene CD17 site, a candidate ngRNA sequence and an mRNA combination of an enzyme of PE are autonomously constructed, and by utilizing a micro-injection mode, a CD17 point mutation animal model of the HBB gene humanized mouse beta-thalassemia CD17 point mutation animal model is constructed. Injecting the combined system to 1-2 cell stage fertilized eggs of Townes mice, transplanting the fertilized eggs to receptor pseudopregnant mice, after the mice are delivered to F0-generation mice, quantitatively analyzing targeted site point mutation mice by using an NGS sequencing technology, and hybridizing to obtain hybrid site mutation F1-generation mice from CD17AAG to TAG. The mouse is used as a classical animal model for in-depth study of a beta-thalassemia pathogenic mechanism, beta-thalassemia targeted drug screening and gene therapy study of point mutation precise repair.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine and relates to a method for constructing a β-thalassemia CD17 point mutation animal model of humanized globin gene mice and its application. Background Art

[0002] CD17 is a hotspot mutation in Southeast Asian β-thalassemia and is the most common β-thalassemia in the population. 0 Thalassemia genotype. It is the preferred site for precision repair gene therapy. In order to further promote the clinical transformation of gene therapy technology that repairs β-thalassemia point mutations to wild type, in-depth research on CD17 point mutation thalassemia animal models is needed.

[0003] The mutant gene HBB of human β-thalassemia is quite different from the globin gene of rodent experimental animals such as mice. When conducting gene repair therapy research, there is still a lack of animal models that simulate the point mutation of the human HBB gene. There are currently humanized mice with globin genes, but β-thalassemia is a disease with great genetic heterogeneity, and more than 300 pathogenic point mutations have been verified. Future gene therapy tends to be a precise repair editing strategy, which requires the provision of suitable animal models consistent with human point mutations for in vivo gene therapy research. Summary of the invention

[0004] To achieve the above objectives, the present application provides a method for constructing a globin gene humanized mouse β-thalassemia CD17 point mutation animal model and its application. The specific technical scheme is as follows:

[0005] A method for constructing a β-thalassemia CD17 point mutation animal model of humanized globin gene mice, which uses the lead editing technology, takes the Townes model mouse as the base mouse, and site-specifically knocks in the Yunnan population hotspot β-thalassemia mutation CD17 AAG>TAG to construct a CD17 point mutation animal model, specifically comprising the following steps:

[0006] Step 1: PE6c mRNA or PEmax mRNA and nickRNA are obtained by in vitro transcription, and pegRNA targeting the CD17 site of the HBB gene is synthesized to form a PE point mutation editing system. The PE point mutation editing system is delivered into the pronucleus of mouse fertilized eggs by embryo microinjection to obtain a CD17 gene point mutation mouse model;

[0007] Step 2: Perform genotyping on the CD17 gene point mutation mouse animal model.

[0008] Furthermore, the step 1 includes the following steps:

[0009] 1) Obtain PE6c enzyme mRNA by in vitro transcription;

[0010] 2) constructing pegRNA and nickRNA targeting CD17 site, wherein the nickRNA is a single-stranded guided nick-RNA;

[0011] 3) First, use the above-mentioned nickRNA to screen out efficient pegRNA, and then use the screened efficient pegRNA to screen nick-RNA. In the electroporated human 293T cell screening system, select the screened pegRNA with high editing efficiency and nickRNA sequence to synthesize the PE point mutation editing system;

[0012] 4) The globin gene humanized mouse Townes model mouse was used as the starting mouse. This mouse carries human α, β and γ globin genes knocked in to replace the endogenous mouse genes. The adult mouse can normally express adult hemoglobin. Female mice aged 3-4 weeks were superovulated, fertilized in vitro, and the fertilized eggs were microinjected with the editing system (RNA) and transplanted into pseudopregnant recipient mice to obtain F0 generation mice with precise point mutations. After male and female mice were caged together, F1 generation heterozygous or homozygous CD17 point mutation mice were obtained. After expansion, a globin gene humanized mouse model that simulates the human CD17 point mutation was obtained.

[0013] Furthermore, the step 2 includes the following steps:

[0014] S1, DNA from the tail of F0 mice was extracted and confirmed by PCR and DNA sequencing;

[0015] S2, extract DNA from the tail of F1 mice, and confirm the genotype by PCR and DNA sequencing according to the identification strategy diagram.

[0016] Further, in step 1 (2), the sequence of the pegRNA is: SEQ ID NO.1: GTCTGCCGTTACTGCCCTGTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCA ACTTGAAAAAGTGGCACCGAGTCGGTGCGTTCACCTaGCCCCACAGGGCAGTAACGGCAGTGGAAAGAAATAAATTCGCGGTTCTATCTAGTTACGCGTTAAACCAACTAGAA;

[0017] The nick-RNA includes nick-RNA1, nick-RNA2 and nick-RNA3;

[0018] The nick-RNA1 sequence is SEQ ID NO.2: TCAGGAGTCAGGTGCACCA

[0019] The nick-RNA2 sequence is SEQ ID NO.3: AAGGAGACCAATAGAAACT

[0020] The nick-RNA3 sequence is SEQ ID NO.4: CTGTGGGGCAAGGTGAACG.

[0021] Furthermore, in step 1) of step 1, the in vitro transcription template sequence of the PE6c mRNA is SEQ ID NO.5 or SEQ ID NO.6.

[0022] A method for constructing an animal model of β-thalassemia CD17 point mutation in humanized globin gene mice and application of the constructed animal model in screening drugs for the treatment of β-thalassemia.

[0023] Compared with the prior art, the present invention has the following beneficial effects: providing a new method for constructing a β-thalassemia CD17 point mutation model of humanized globin gene mice and a new animal model, and applying them to the screening of β-thalassemia targeted drugs. It provides a suitable animal model consistent with human point mutations for future gene therapy tending towards precise repair editing strategies. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 This is Example 1 of the sequencing peak graph of CD17A>T for a heterozygous mutation carrier of CD17 of the present invention (Figure Note: The red arrow points to the sequencing peak graph of CD17A>T, and both models are heterozygous mutation carriers of CD17).

[0025] Figure 2 This is Example 2 of the sequencing peak graph of CD17A>T for a heterozygous mutation carrier of CD17 of the present invention (Figure Note: The red arrow points to the sequencing peak graph of CD17A>T, and both models are heterozygous mutation carriers of CD17).

[0026] Figure 3 These are the results of routine blood tests of the animal model in Example 1.

[0027] Figure 4 This is the reticulocyte of the animal model of Example 1.

[0028] Figure 5 These are the results of routine blood tests of the animal model in Example 2.

[0029] Figure 6 This is the reticulocyte of the animal model of Example 2.

[0030] Figure 7Schematic diagram of blood smears of the animal model of the present invention; A is the smear result of Example 1, and B is the smear result of Example 2 (note: arrows indicate red blood cell fragments, and circles indicate target red blood cells). DETAILED DESCRIPTION

[0031] In order to make the purpose, technical scheme and advantages of the present invention clearer, the present invention is further described in detail below in conjunction with specific embodiments and with reference to the accompanying drawings. It should be understood that these descriptions are only exemplary and are not intended to limit the scope of the present invention. In addition, in the following invention, the description of well-known structures and technologies is omitted to avoid unnecessary confusion of the concept of the present invention.

[0032] Example 1: A method for constructing a β-thalassemia CD17 point mutation animal model of humanized globin gene mice, which uses the lead editing technology, takes Townes model mice as the base mouse, and site-specifically knocks in the β-thalassemia hotspot CD17 of the Yunnan population to construct a CD17 point mutation animal model, specifically comprising the following steps:

[0033] Step 1: obtain PEmax mRNA or PE6c mRNA and nick-RNA by in vitro transcription, and synthesize epeg-RNA, and construct a PE point mutation editing system at the same time, and deliver the PE point mutation RNA editing system into mouse fertilized eggs by embryo microinjection transplantation to obtain a CD17 gene point mutation mouse model;

[0034] Construct a pegRNA sequence targeting the CD17 site of the HBB gene (the independently designed sequence mainly includes spacer, PBS, RT and 1inker sequences), a candidate nickRNA sequence and an mRNA combination of the PE enzyme.

[0035] NGS sequencing technology was used to quantitatively analyze mice with targeted site mutations, and hybridization was performed to obtain F1 mice with heterozygous point mutations from CD17AAG to TAG.

[0036] 1) Obtaining PE6c enzyme mRNA (SEQ ID NO.6) or PE6c enzyme mRNA (SEQ ID NO.5) by in vitro transcription;

[0037] Important elements such as the cleavage enzyme and reverse transcriptase of the primary editor are included in the transcription template; the template is then amplified by PCR, the DNA template is fully purified using a purification column method, and then in vitro transcription is performed using a T7 promoter in vitro transcription kit.

[0038] 2) construct pegRNA and nickRNA targeting CD17 locus;

[0039] The sequence of the pegRNA is SEQ ID NO.1:

[0040] GTCTGCCGTTACTGCCCTGTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCA

[0041] ACTTGAAAAAGTGGCACCGAGTCGGTGCGTTCACCTaGCCCCACAG GGCAGTAACGGCAGTGGAAAGA AATAAATTCGCGGTTCTATCTAGTTAC GCGTTAAAACCAACTAGAA;

[0042] The candidate nickRNA sequences include nick-RNA1, nick-RNA2 and nick-RNA3;

[0043] The nick-RNA1 sequence is SEQ ID NO.2: TCAGGAGTCAGGTGCACCA;

[0044] The nick-RNA2 sequence is SEQ ID NO.3: AAGGAGACCAATAGAAACT;

[0045] The nick-RNA3 sequence is SEQ ID NO.4: CTGTGGGGCAAGGTGAACG;

[0046] Screen out sgRNA with higher editing efficiency through plasmid transfection, and design corresponding primers for in vitro transcription synthesis based on sgRNA, and add scaffold at the end, as shown in Table 1.1 below:

[0047] Table 1.1 sgRNA sequences transcribed in vitro

[0048]

[0049] 3) First use the fixed nickRNA to screen pegRNA, then select a high-efficiency pegRNA to screen nick-RNA, and then electroporate 293T cells to obtain nickRNA and pegRNA sequences with high editing efficiency through the above screening, and select the nickRNA and pegRNA sequences with high editing efficiency to synthesize the PE point mutation editing system (including nick RNA2, peg RNA and PE6c mRNA PE point mutation editing system);

[0050] 4) Perform microinjection at the fertilized egg level, inject the combined CD17-targeting PE system into the 1-2 cell stage fertilized eggs of Townes mice, use a microinjection needle to deliver the PE point mutation editing system to the fertilized eggs, and transplant the fertilized eggs into recipient pseudo-pregnant mice. After the mice give birth to F0 generation mice, obtain F0 generation mice with precise point mutations, and after male and female mice are caged together, obtain F1 generation heterozygous or homozygous CD17 point mutation mice, and after expansion, obtain a globin gene humanized mouse model that simulates the human CD17 point mutation;

[0051] Step 2: Identify the genotype of the CD17 gene point mutation mouse model:

[0052] The genotype was verified by PCR gene identification and sequencing to confirm whether the mutation was successfully introduced, and the phenotype was verified by routine blood tests and blood smears.

[0053] S1, DNA from the tail of F0 mice was extracted and confirmed by PCR and DNA sequencing;

[0054] S2, extract DNA from the tail of F1 mice, and confirm the genotype by PCR and DNA sequencing according to the identification strategy diagram.

[0055] Example 2: Validation of β-thalassemia CD17 point mutation animal model

[0056] The F1 generation mice with heterozygous point mutation from CD17 AAG to TAG obtained after hybridization were subjected to ddPCR combined with fastNGS sequencing analysis to clarify the genotype, and red blood cell Regis staining, blood routine and reticulocyte testing, hemoglobin electrophoresis and other tests were performed.

[0057] Blood sequencing analysis showed that in Townes model mice, the HBB gene where CD17 is located is located in the first exon region, and its original sequence is:

[0058] A TGGTGCATCCGACTCCTGA1 GGAGAAGTCTGCCGTTACTGCC CTGTGGG GCAAGGTGAACG3 TGGATGAAGTTGGTGGTGAGGCCC TGGGCAGGTTG GTATCAAGG TTACAAGACAGGTTT AAGGAGACCAATAGAAACT2

[0059] The mouse model was constructed by precise point mutation of mice through the PE point mutation editing system including nick RNA, peg RNA and PEmax mRNA. The sequence after point mutation is:

[0060] ATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGG

[0061] CTAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGGTTGGTA

[0062] TCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACT

[0063] The PE point mutation editing system of this embodiment includes PE6c mRNA, peg RNA and nick-RNA2. The system is delivered into fertilized eggs, and the edited fertilized eggs / embryos are transplanted to surrogate recipient mice to obtain F0 generation mice with precise point mutations. After the males and females are caged together, F1 generation heterozygous or homozygous CD17 point mutation mice are obtained.

[0064] Two of the samples that completed mutation editing were tested, and the results are as follows:

[0065] (1) Genotype verification by sequencing: ① Genomic DNA extraction: Extract genomic DNA from the tail tip tissue of the rat. ② PCR amplification: Use specific primers to amplify the target gene region. ③ Sequencing: Use Sanger sequencing. ④ Analyze the sequencing results to confirm whether the mutation has been successfully introduced. The specific results are as follows: Figure 1 As shown, the red arrow points to the sequencing peak of CD17A>T, proving that the above-mentioned PE point mutation editing system can make both normal models mutate into heterozygous mutation carriers of CD17.

[0066] (2) Perform phenotypic analysis on the edited individuals, including routine blood test and reticulocyte analysis. The results of routine blood test are as follows: Figure 3 and Figure 5 As shown in the figure, the blood routine test of the model mice showed microcytic hypochromic anemia, and the hemoglobin, average hemoglobin content and concentration were significantly lower than those of other normal mice. Figure 4 and Figure 6 The reticulocyte test results showed that the reticulocyte value and immature reticulocyte count of the model mice were significantly increased.

[0067] In summary, by microinjection transplantation into the embryos of Townes model mice and delivering the PE point mutation editing system (including nick RNA2, peg RNA and PEmax mRNA PE point mutation editing system) into the fertilized eggs of mice, the phenotype of the CD17 gene point mutation mouse model obtained was microcytic hypochromic β-thalassemia symptoms, and it can be used as a β-thalassemia CD17 point mutation animal model of humanized globin gene mice for screening β-thalassemia targeted drugs and gene therapy research on precise repair of point mutations.

[0068] It should be understood that the above specific embodiments of the present invention are only used for illustrative inventions or to explain the principles of the present invention, and do not constitute limitations on the present invention. Therefore, any modifications, equivalent substitutions, improvements, etc. made without departing from the spirit and scope of the present invention should be included in the protection scope of the present invention. In addition, the appended claims of the present invention are intended to cover all changes and modifications that fall within the scope and boundaries of the appended claims, or the equivalent forms of such scope and boundaries.

Claims

1. A method for constructing a β-thalassemia CD17 point mutation animal model of humanized globin gene mice, characterized in that: This method uses the lead editing technology, takes the Townes model mouse as the base mouse, and knocks in the CD17AAG>TAG of the Yunnan population hotspot β-thalassemia mutation to construct a CD17 point mutation animal model, which specifically includes the following steps: Step 1: PE6c mRNA or PEmax mRNA and nickRNA are obtained by in vitro transcription, and pegRNA targeting the CD17 site of the HBB gene is synthesized to form a PE point mutation editing system. The PE point mutation editing system is delivered into the pronucleus of mouse fertilized eggs by embryo microinjection to obtain a CD17 gene point mutation mouse model; Step 2: Perform genotyping on the CD17 gene point mutation mouse animal model.

2. The method for constructing a globin gene humanized mouse β-thalassemia CD17 point mutation animal model according to claim 1, characterized in that: The step 1 comprises the following steps: 1) Obtain PE6c enzyme mRNA by in vitro transcription; 2) constructing pegRNA and nickRNA targeting CD17 site, wherein the nickRNA is a single-stranded guided nick-RNA; 3) First, use the above-mentioned nickRNA to screen out efficient pegRNA, and then use the screened efficient pegRNA to screen nick-RNA. In the electroporated human 293T cell screening system, select the screened pegRNA with high editing efficiency and nickRNA sequence to synthesize the PE point mutation editing system; 4) The globin gene humanized mouse Townes model mouse was used as the starting mouse. This mouse carries human α, β and γ globin genes knocked in to replace the endogenous mouse genes. The adult mouse can normally express adult hemoglobin. Female mice aged 3-4 weeks were superovulated, fertilized in vitro, and the fertilized eggs were microinjected with the editing system (RNA) and transplanted into pseudopregnant recipient mice to obtain F0 generation mice with precise point mutations. After male and female mice were caged together, F1 generation heterozygous or homozygous CD17 point mutation mice were obtained. After expansion, a globin gene humanized mouse model that simulates the human CD17 point mutation was obtained.

3. The method for constructing a β-thalassemia CD17 point mutation animal model according to claim 1, characterized in that: Step 2 includes the following steps: S1, DNA from the tail of F0 mice was extracted and confirmed by PCR and DNA sequencing; S2, extract DNA from the tail of F1 mice, and confirm the genotype by PCR and DNA sequencing according to the identification strategy diagram.

4. The method for constructing a β-thalassemia CD17 point mutation animal model according to claim 2, characterized in that: In step 1 (2), the sequence of the pegRNA is: SEQ ID NO.1: GTCTGCCGTTACTGCCCTGTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCGTTCACCTaGCCCCACAGGGCAGTAACGGCAGTGGAAAGAAATAAATTCGCGGTTCTATCTAGTTAC GCGTTAAAACCAACTAGAA; The nick-RNA includes nick-RNA1, nick-RNA2 and nick-RNA3; The nick-RNA1 sequence is SEQ ID NO.2: TCAGGAGTCAGGTGCACCA The nick-RNA2 sequence is SEQ ID NO.3: AAGGAGACCAATAGAAACT The nick-RNA3 sequence is SEQ ID NO.4: CTGTGGGGCAAGGTGAACG.

5. The method for constructing a β-thalassemia CD17 point mutation animal model according to claim 2, characterized in that: In step 1) of step 1, the in vitro transcription template sequence of the PE6c mRNA is SEQ ID NO.

5.

6. Use of the sgRNA as claimed in claim 2 in constructing a globin gene humanized mouse β-thalassemia CD17 point mutation animal model.

Images