Application of CsPPC3 gene in regulation and control of carbon and nitrogen metabolism of cucumber fruits

Abstract

The invention provides an application of a CsPPC3 gene in regulation and control of carbon and nitrogen metabolism of cucumber fruits, a major gene CsPPC3 for coding phosphoenolpyruvate carboxylase (PEPC) in carbon fixation of the cucumber fruits is taken as a research target, an overexpression and gene knockout transgenic plant is constructed, the effect of the CsPPC3 gene in carbon fixation and carbon and nitrogen metabolism of photosynthesis of the fruits is researched, and the CsPPC3 gene is applied to regulation and control of carbon and nitrogen metabolism of the cucumber fruits. It is found that the amount of CO2 released by respiration of a transgenic plant overexpressed by the CsPPC3 gene is reduced, the CO2 refixation capacity is enhanced, the single fruit weight of the fruit is increased, the content of malic acid, soluble sugar and starch is increased, and the content of amino acid is reduced, while the amount of CO2 released by respiration of a transgenic plant knocked out by the CsPPC3 gene is increased, and the single fruit weight of the fruit is reduced. Meanwhile, the contents of malic acid, soluble sugar and amino acid are reduced, the starch content is increased, and the CO2 refixing capacity is reduced. The method disclosed by the invention has practical guiding significance for cultivating transgenic plants with high CO2 fixing efficiency.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to application of CsPPC3 gene in the regulation of carbon and nitrogen metabolism in cucumber fruit. Background Art

[0002] Cucumber (Cucumis sativus L.) is an important fruit and vegetable crop widely grown in the world, and its fruit is an important economic organ. The internal respiration of cucumber fruit releases a large amount of CO2, of which about 88% can be captured and fixed again to generate photosynthetic products for the growth of the fruit itself. Among them, the contribution rate of photosynthesis of cucumber fruit exocarp to its own carbon accumulation is 9.4%, which is an important contribution to fruit growth. Plants need to maintain a balance between carbon and nitrogen metabolism in order to grow and develop normally. Both carbon and nitrogen are essential elements for plant growth, and an imbalance in their metabolism will lead to decreased growth. In most non-photosynthetic tissues and photosynthetic tissues of C3 plants, non-photosynthetic PEPC plays an important role in the metabolic process, and its basic function is to continuously replenish tricarboxylic acid cycle intermediates.

[0003] Phosphoenolpyruvate carboxylase (PEPC) is a functional enzyme of C4 photosynthesis. Currently, the known PEPC family genes in plants are divided into two categories, plant-type PEPC) and bacterial-type PEPC. Guo Fang's study on the tissue expression analysis of cucumber Cs-ppc gene and the effect of light intensity on its transcription level in leaves pointed out that the expression levels of Cs-ppcl and Cs-ppc3 were high in multiple tissues, and the tissue expression of Cs-ppc2 gene was more different, with high expression in flowers and very low expression in other tissues; in response to light intensity, the expression level and biological cycle of Cs-ppcl were more significantly affected by light intensity than the other two Cs-ppc genes, and the tissue expression of Cs-ppc2 gene was more different, which may play an important role in the process of flower development. It is speculated that Cs-ppcl plays an important role in the process of adapting to different light intensity regulation (Journal of North China Agricultural University, 2011, 26(5):21-24). However, there is currently no research on the role of the major gene CsPPC3 encoding phosphoenolpyruvate carboxylase (PEPC) in photosynthetic carbon fixation and carbon and nitrogen metabolism in cucumber fruit, and its function and application in carbon and nitrogen metabolism in cucumber fruit have not been reported. Summary of the invention

[0004] The technical problem to be solved by the present invention is to provide an application of the CsPPC3 gene in the regulation of carbon and nitrogen metabolism in cucumber fruit in view of the deficiencies of the above-mentioned prior art. The major gene CsPPC3 encoding phosphoenolpyruvate carboxylase (PEPC) in carbon fixation in cucumber fruit is taken as the research target. By constructing overexpression and gene knockout transgenic plants, the role of the CsPPC3 gene in fruit photosynthetic carbon fixation and carbon and nitrogen metabolism is studied, which has practical guiding significance for the cultivation of transgenic plants with high CO2 fixation efficiency.

[0005] In order to solve the above technical problems, the technical solution adopted by the present invention is:

[0006] A use of a CsPPC3 gene in regulating carbon and nitrogen metabolism in cucumber fruit, wherein the nucleotide sequence of the CsPPC3 gene is shown in SEQ ID NO.1, and the amino acid sequence encoded by the CsPPC3 gene is shown in SEQ ID NO.2. The use comprises: overexpressing or knocking out the CsPPC3 gene by biological techniques to obtain transgenic plants.

[0007] Preferably, the method for constructing the CsPPC3 gene overexpressing transgenic plants is as follows: constructing a Super-1300-CsPPC3 overexpression vector, infecting cucumber cotyledons with Agrobacterium for genetic transformation, overexpressing the CsPPC3 gene in cucumber fruits, screening positive buds, and obtaining transgenic plants with stable inheritance. The amount of CO2 released by the transgenic plants overexpressing the CsPPC3 gene during respiration is reduced, the CO2 re-fixation capacity is enhanced, the single fruit weight is increased, and the content of malic acid, soluble sugar and starch is increased, while the amino acid content is reduced, indicating that more carbon sources flow to the carbon cycle in carbon and nitrogen metabolism.

[0008] Preferably, the method for constructing the transgenic plant with CsPPC3 gene knockout is as follows: constructing a CRISPR-Cas9 gene editing vector, using gene editing technology, genetic transformation by agrobacterium infection of cucumber cotyledons, inhibiting the expression of CsPPC3 gene in cucumber fruit, screening positive buds, and obtaining transgenic plants with stable inheritance. The transgenic plant with CsPPC3 gene knockout has an increased CO2 release by respiration, a reduced single fruit weight, a reduced malic acid, soluble sugar and amino acid content, and an increased starch content, indicating a reduced CO2 re-fixation capacity and a reduced carbon source, thereby reducing the carbon source material used in carbon and nitrogen metabolism.

[0009] The present invention has the following significant technical effects:

[0010] 1. The present invention provides an application of the CsPPC3 gene in the regulation of carbon and nitrogen metabolism in cucumber fruit. The major gene CsPPC3 encoding phosphoenolpyruvate carboxylase (PEPC) in carbon fixation in cucumber fruit is taken as the research target. By constructing overexpression and gene knockout transgenic plants, the role of the CsPPC3 gene in fruit photosynthetic carbon fixation and carbon and nitrogen metabolism is studied, which has practical guiding significance for cultivating transgenic plants with high CO2 fixation efficiency.

[0011] 2. The amount of CO2 released by fruit respiration in transgenic plants with overexpression of CsPPC3 gene decreased, the CO2 re-fixation capacity was enhanced, the single fruit weight increased, and the malic acid, soluble sugar and starch content increased, while the amino acid content decreased, indicating that more carbon sources flowed to the carbon cycle in carbon and nitrogen metabolism. The amount of CO2 released by fruit respiration in transgenic plants with knockout of CsPPC3 gene increased, the single fruit weight decreased, while the malic acid, soluble sugar and amino acid content decreased, while the starch content increased, indicating that the CO2 re-fixation capacity decreased, the carbon source decreased, and thus the utilization of carbon source materials in carbon and nitrogen metabolism decreased.

[0012] The present invention is further described in detail below with reference to the accompanying drawings and embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 This is a diagram of the protein sequence analysis of the CsPPC3 gene.

[0014] Figure 2 This is the expression analysis of CsPPC3 gene in cucumber, A is the expression pattern of CsPPC3 gene in different organs of cucumber, and B is the expression pattern of CsPPC3 gene in different tissues of cucumber fruit. R: root, S: stem, L: leaf, MF: male flower, FF: female flower, DAA: days after anthesis, Ex: exocarp, Me: mesocarp, MVB: primary vascular bundle, Pl: placenta.

[0015] Figure 3 This is the identification picture of CsPPC3 overexpressing transgenic plants.

[0016] Figure 4 This is the editing site analysis of CsPPC3 gene knockout plants. The target sequence is located below the black line, the nucleotide mutation site is marked with a red box, and the stop codon is marked with a red box *.

[0017] Figure 5 This is a diagram of protein level identification in CsPPC3 transgenic plants.

[0018] Figure 6This is the fruit phenotype analysis of cucumber CsPPC3 transgenic plants. A is the ovary / fruit phenotype of cucumber CsPPC3 transgenic plants on the day of flowering, B is the ovary / fruit phenotype of cucumber CsPPC3 transgenic plants 9 days after flowering, and C is the statistics of single fruit weight of cucumber CsPPC3 transgenic plants 9 days after flowering. Different letters represent significant differences (n≥5).

[0019] Figure 7 This is an analysis of the photosynthesis characteristics of cucumber CsPPC3 transgenic plants fruit. A is the CO2 release rate of cucumber fruit 9 days after flowering (n≥5), * indicates P<0.05; ** indicates P<0.01; B is the CO2 re-fixation rate, and different letters represent significant differences.

[0020] Figure 8 The contents of carbon and nitrogen compounds in cucumber fruits of wild type (WT), CsPPC3 overexpression plants (OE) and CsPPC3 knockout plants (ppc3), A: malic acid, B: soluble sugar, C: starch, D: amino acids.

[0021] Fig. 9 This is a speculated model of the function of CsPPC3 in cucumber fruit. A: The speculated model of the function of CsPPC3 in the fruit of plants with overexpression of the CsPPC3 gene; B: The speculated model of the function of CsPPC3 in the fruit of plants with knockout of the CsPPC3 gene. DETAILED DESCRIPTION

[0022] Example 1

[0023] This example is about the cloning / isolation and identification of the CsPPC3 gene.

[0024] The CsPPC3 (Csa5G577360) gene sequence was obtained using the Cucurbitaceae genome database (http: / / cucurbitgenomics.org / organism / 2). Based on the gene sequence information, full-length gene cloning primers (F: ATGACGGACACTACTGACGATATC; R: TTAACCTGTGTTCCTCATTCCA) were designed and PCR amplification was performed to obtain the target fragment.

[0025] The nucleotide sequence of the CsPPC3 gene is shown as SEQ ID NO.1, and the amino acid sequence encoded by the CsPPC3 gene is shown as SEQ ID NO.2.

[0026] Phylogenetic tree analysis showed that cucumber CsPPC1 and CsPPC2 genes belong to plant-type PEPC, and CsPPC3 gene is highly homologous to Arabidopsis Atppc4, maize Zmppc4, rice Osppc4 and other genes, all of which are bacterial-type PEPC. Cucumber CsPPC3 gene has 3187 bases, encoding 1061 amino acids. Amino acid sequence alignment also showed that the N-terminal lacks a Ser site ( Figure 1 ).

[0027] Example 2

[0028] This example is the expression analysis of CsPPC3 gene in cucumber.

[0029] The qRT-PCR method was used to detect the expression of the gene in different organs (roots, stems, leaves, male flowers, female flowers and ovaries) and different tissues of the fruit (exocarp, mesocarp, placenta, main vascular bundle) of cucumber. The qRT-PCR results showed that the cucumber CsPPC3 gene was expressed in all organs and tissues tested, and the expression level gradually increased with the development of the fruit until it reached a peak 6 days after flowering. Its expression level was higher than that in leaves, stems and other organs ( Figure 2 A). The expression pattern of CsPPC3 gene in the exocarp, mesocarp, primary vascular bundle and placenta of cucumber fruit was further analyzed. Figure 2 As shown in B, the expression level of CsPPC3 in the fruit placenta tissue (Pl) is the highest among all parts, followed by the main vascular bundle (MVB), then the mesocarp (Me) and the exocarp (Ex). It can be seen that CsPPC3 is highly expressed mainly in the mesocarp and placenta tissue and the main vascular bundle inside the cucumber fruit.

[0030] Example 3

[0031] This example is the construction of CsPPC3 gene overexpressing transgenic plants.

[0032] 1. Select the Super-1300 overexpression vector, select the two restriction sites of SalⅠ and KpnⅠ for double enzyme digestion (the reaction system is shown in Table 1, and the reaction conditions are: 37℃, 3h), and recover the target fragment by agarose gel electrophoresis. Design primers F:ATGACGGACACTACTGACGATA TC, R:TTAACCTGTGTTCCTCATTCCA, connect the full-length clone of the CsPPC3 gene CDS with the Super-1300 expression vector after double enzyme recovery through homologous recombination technology, and transfer it into the Escherichia coli Dh5α strain, pick a monoclonal plaque, and verify the test. The sequencing was successful. The bacterial solution was propagated in large quantities, and the plasmid was extracted using the Tiangen Plasmid Mini-Extraction Kit (Beijing) and stored at -20℃.

[0033] Table 1 Double enzyme digestion reaction system

[0034] Reagent name Usage Plasmids 1 μg SalⅠ 1μL KpnⅠ 1μL 10×Buffer 2μL <![CDATA[ddH2O]]> 15μL Total volume 20μL

[0035] 2. Use the heat shock transformation method to transfer the constructed plasmid into Agrobacterium, and culture it upside down in a 28℃ incubator for 36-48h; pick a single clone colony for bacterial liquid PCR identification, add an equal volume of 50% glycerol to the bacterial liquid with the target band, and preserve the bacteria at -80℃.

[0036] 3. Genetic transformation of cucumber cotyledons infected with Agrobacterium

[0037] (1) Seed disinfection and germination

[0038] Prepare 800 mL of SGM solid medium (seed germination): containing 3.544 g of MS519 medium powder, 3% sucrose, 400 ng of 6-BA, adjust the medium pH to 5.6-5.8 after the solid is dissolved, add 2 g of plant gel, and sterilize at 121°C for 20 min.

[0039] Sowing: Select full Xintai spiny cucumber seeds, soak them in deionized water for more than half an hour to ensure that the seeds have swollen, peel off the seed coat, and be careful not to damage the seeds. In the clean bench, use 75% ethanol (30s, wash twice with sterile water) and 3% NaClO solution (shake gently for 12 minutes, rinse with sterile water 3 times) for disinfection. After disinfection, transfer to SGM solid culture medium, sow about 30 seeds per dish, and culture in a dark incubator at 28°C for 24-40h (based on the appearance of 3-5 obvious vascular bundle ridges on the cotyledons as the judgment standard), and then cut the explants.

[0040] (2) Agrobacterium infection of cucumber cotyledons

[0041] Prepare 800mL of IMS medium (cotyledon differentiation): containing 3.544g of MS519 medium powder, 3% sucrose, 400ng of 6-BA solid, adjust the medium pH to 5.6-5.8 after dissolving, and add 2g of plant gel. Sterilize at 121℃ for 20min. After sterilization, add 800ng of ABA solution, 160ng of AS solution, and 4mL of MES solution (0.5M) when the temperature reaches about 60℃. No gel is added when sterilizing IM liquid medium.

[0042] Preparation of Agrobacterium infection solution: Prepare 40 mL of bacterial solution in advance according to the amount of cotyledons to be infected. When the OD600 of the Agrobacterium bacterial solution reaches 0.6-0.8, centrifuge at 6000 rpm for 8 min at room temperature, collect the bacteria, and resuspend the bacteria in IM liquid culture medium. Centrifuge again at 6000 rpm for 8 min, resuspend the bacteria in IM liquid culture medium again and adjust the OD600 value to 0.2-0.3, and place in a 28°C incubator away from light for later use.

[0043] Preparation of cucumber cotyledon explants: In a clean bench, remove the seeds with vascular ridges, remove the hypocotyl and roots, and be careful not to touch the root hairs. Cut off the distal 1 / 3 cotyledon, gently push the two cotyledons apart, and carefully peel off the hypocotyl. A U-shaped opening will appear at the proximal end of the cotyledon. Place it in IM liquid culture medium for later use. All healthy cotyledons should be treated in this way. The whole process should be completed within 1 hour.

[0044] Agrobacterium infection: Use a 20mL syringe to transfer the cotyledon explant into the syringe barrel, plug the syringe head with a stopper cap, pour in 10mL of Agrobacterium infection solution, gently expel the air until only 10mL of infection solution is left, seal the needle hole of the syringe head with a syringe seal plug, gently and slowly pull the piston core rod, and the cotyledon can be seen floating up and down while releasing bubbles inside. When it is pulled to the 20mL mark, it will stop. This process lasts for 30s and is maintained at the 20mL mark for 1.5min. During this period, gently shake the syringe to complete the vacuum negative pressure infection. After the time is up, gently release your hands, and when it returns to the 10mL mark, open the seal head, replace the new infection solution and repeat the above operation once.

[0045] Co-culture of cotyledons and Agrobacterium: After infection, spread the cotyledons on filter paper to absorb the Agrobacterium infection solution on the surface. Place each cotyledon with the inside facing up on the IMS differentiation medium, seal it, and place it in a 28°C incubator for about 3 days in the dark until the cotyledons grow and turn yellow.

[0046] (3) Explant differentiation culture

[0047] Prepare 800mL of SRM solid medium (resistance differentiation medium): containing 3.544g of MS519 medium powder, 3% sucrose, 400ng of 6-BA solid, adjust the medium pH to 5.6-5.8 after dissolving, and add 2g of plant gel. Sterilize at 121℃ for 20min. After sterilization, add 800ng of ABA solution and 1.6mg of antibiotic Tim when the temperature reaches about 60℃.

[0048] Explant (cucumber cotyledon) differentiation culture: Transfer the differentiated cucumber cotyledons to the SRM solid culture medium with resistance. Place the cotyledons with the inner side facing downwards, insert the U-shaped opening into the culture medium, and place them in the tissue culture room for culture.

[0049] (4) Obtaining and cultivating positive plants

[0050] RM medium preparation (rooting medium): contains 3.544g MS519 medium powder, 3% sucrose, 400ng 6-BA solid, adjust the medium pH to 5.6-5.8 after dissolving, add 2g plant gel. Sterilize at 121℃ for 20min. After sterilization, add 1.6mg of antibiotic Tim after letting it cool to room temperature.

[0051] Rooting culture: After the explants have differentiated into buds after 20 days of culture, they are cut into independent individuals and transferred to rooting medium.

[0052] Transplanting and acclimatization: Transplant the rooted individual plants into the sterilized substrate, and harden and grow the seedlings in a light incubator.

[0053] RNA was extracted from the fruit placenta tissue of the T1 generation of CsPPC3 overexpression (OE) positive strains 9 days after anthesis and reverse transcribed into cDNA templates. The mRNA level was identified using qRT-PCR technology. Figure 3 It can be seen that the relative expression levels of each strain were increased, among which the expression levels of overexpressing OE#3 and OE#57 strains were 2 times and 6 times that of wild-type (WT) plants. They were selected as CsPPC3 gene overexpressing transgenic plants for further research.

[0054] Example 4

[0055] This example is the construction of CsPPC3 gene knockout transgenic plants.

[0056] A CRISPR-Cas9 gene editing vector was constructed, and CsPPC3 gene knockout plants were constructed using CRISPR-Cas9 gene editing technology. CRISPR-Cas9 vector dual-target construction was performed, and the target of the target gene was screened on the target design website CRISPR RGEN Tools (http: / / www.rgenome.net / cas-designer / ). The target design was: CAGGCAGAGCTTGGCTTCC and GATCTTCAGGACTAAGGTC. The construction of cucumber transgenic plants was the same as in Example 3.

[0057] The T1 generation plants (ppc3#1 and ppc3#2) of the obtained CsPPC3 edited strains were tested, and primers were designed for PCR and sequencing about 150bp before the target site. The sequencing results were compared with those of the WT plants, and it was found that each mutant had a T base insertion at the first target site. The ppc3#2 strain also had a second target site deletion, but the insertion was a frameshift mutation, causing the CsPPC3 protein translation to terminate at the 550th base. In addition, the ppc3#2 strain also had a single base mutation at the target site, causing the edited amino acid at this site to mutate from asparagine to histidine ( Figure 4 ).

[0058] Protein levels of transgenic plants were identified by western blotting using CsPPC3 protein-specific antibodies. Fruit proteins were extracted from wild-type plants (WT), overexpression lines (OE#3, OE#57) and knockout lines (ppc3#1 and ppc3#2), and protein concentrations were determined using the Bradford method. The protein content on the samples was adjusted to be consistent, and electrophoresis and protein immunoblotting were performed, and quantitative analysis was performed using anti-Actin as a control. Figure 5 It can be seen that when the colors of the Actin protein bands are close, the colors of the target protein bands of OE#3 and OE#57 strains are darker than those of WT, indicating that the PEPC protein content of the overexpression strains is higher than that of WT. In addition, there is no signal in the protein lanes of the Csa9 edited strains (ppc3#1 and ppc3#2), indicating that the knockout strains do not contain target proteins that can bind to the CsPPC3-specific antibody, and ppc3#1 and ppc3#2 are effective editing strains.

[0059] Effects of overexpression and knockout of CsPPC3 gene on cucumber fruit morphology, photosynthetic carbon fixation, and carbon and nitrogen metabolism in transgenic plants.

[0060] 1. Cucumber fruit shape

[0061] Figure 6 A is the ovary / fruit on the day of flowering, and there is no significant difference in fruit size. Observation of mature cucumber fruits 9 days after flowering revealed that the fruit size of the strain overexpressing the CsPPC3 gene was larger, while the fruit size of the knockout strain was slightly smaller ( Figure 6 B); Statistics show that the single fruit weight of the overexpression plants reached 404.67-356.97g, which was higher than the fruit weight of the wild-type plants (335.11g), while the single fruit weight of the knockout plants (245.25-260.04g) was significantly lower than that of the wild-type plants ( Figure 6 C), indicating that the CsPPC3 gene had a certain effect on cucumber fruit development.

[0062] 2. Photosynthetic carbon fixation

[0063] Cucumber fruits maintain a high respiration rate and release a large amount of CO2 when ripe. Since the CsPPC3 gene is mainly located inside the cucumber fruit, especially in the placenta, the infrared CO2 analysis method was used to measure the CO2 release rate of the fruit to explore the differences in the respiration rate of the fruit.

[0064] The CO2 refixation rate is calculated as:

[0065] CO2 re-fixation rate under light conditions (%) = [(R S +R P –R I ) / (R S +R P)]×100,

[0066] CO2 refixation rate under dark conditions (%) = [(R S' +R P' –R I' ) / (R S' +R P' )]×100.

[0067] Among them, R S and R S' are the internal (peel removed) CO2 release rates under light and dark conditions, R p and R p' are the CO2 release rate of the fruit exocarp under light and dark conditions, R I and R I' are the CO2 release rates of the whole fruit under light and dark conditions, respectively.

[0068] Depend on Figure 7 It can be seen that the whole fruit, skin and internal tissue of wild-type cucumber fruit released a large amount of CO2 under dark conditions, with release rates of 1.46 μmol m -2 s -1 , 1.74 μmol m -2 s -1 , 1.41 μmol m -2 s -1 In contrast, the CO2 release rate decreased after illumination ( Figure 7 A), indicating that part of the CO2 released by cucumber fruit respiration under light conditions is refixed, so the measured apparent CO2 release rate decreases. The CO2 refixation rate of cucumber fruit in wild-type plants is 26.80% higher under light conditions than in the dark ( Figure 7 B). The respiration release rate of the whole fruit and internal tissues of the overexpressing cucumber plants was lower than that of the wild-type plants, and the CO2 fixation ability was significantly stronger than that of the wild-type plants. Compared with the wild-type, the CO2 release rate of the knockout strains increased significantly in the dark, but the CO2 release rate did not change significantly in the light, and there was no significant difference in its CO2 re-fixation rate compared with the wild-type.

[0069] 3. Carbon and nitrogen metabolism

[0070] The malic acid content, soluble sugar content, starch content and amino acid content of the transgenic and wild-type cucumber fruits were determined. Figure 8 The results showed that overexpression of the CsPPC3 gene significantly promoted the accumulation of malic acid, with its content increasing by 17.16%, while the malic acid content of the knockout strain decreased significantly by 10.85% ( Figure 8A). Compared with the sugar in the wild-type ripe fruit, the soluble sugar content in the CsPPC3 overexpression strain increased significantly, by 12.86% compared with the wild-type; the soluble sugar content in the knockout strain decreased significantly by 30.29% ( Figure 8 B). Compared with the wild-type plants, the starch content in the fruits of both the overexpression strain and the knockout strain increased ( Figure 8 C). The amino acid content of cucumber fruit decreased significantly in both the plants overexpressing the CsPPC3 gene and the plants knocked out ( Figure 8 D).

[0071] Table 2 lists the effects of overexpression and knockout of the CsPPC3 gene on cucumber fruit.

[0072] Table 2 Effects of overexpression and knockout of CsPPC3 gene on cucumber fruit

[0073]

[0074] Fig. 9 A speculative model for the function of CsPPC3 in the carbon and nitrogen metabolism process of cucumber fruit in CsPPC3 gene overexpression plants and CsPPC3 gene knockout plants was developed. The role and active sites of PEPC-mediated carbon fixation cycle and TCA cycle in cucumber fruit were inferred through gene expression, tissue-specific localization, enzyme activity determination and related physiological and metabolic pathways. Among them, PEPC: phosphoenolpyruvate carboxylase, PEP: phosphoenolpyruvate, OAA: oxaloacetate, Mal: ​​malate, Pyr: pyruvate, α-KG, α-ketoglutarate. The CO2 captured in the plant body is converted into oxaloacetate (OAA) by PEPC catalysis phosphoenolpyruvate (PEP), and oxaloacetate produces malic acid (Mal) through the dehydrogenation reaction catalyzed by MDH. Malic acid can not only enter the decarboxylation reaction (NADP-ME) to release CO2 and be fixed again by the C3 pathway, but also enter the tricarboxylic acid cycle (TCA). As an intermediate product of the TCA cycle, it replenishes the carbon skeleton lost due to amino acid synthesis, promotes the strengthening of the four-carbon dicarboxylic acid pathway cycle in cucumber fruits, weakens the respiration under light, consumes a large amount of CO2 for photosynthesis, and also reduces the loss of CO2 in the dark, and more is fixed. Overexpression of CsPPC3 will lead to the accumulation of malic acid, the downstream product of its catalytic reaction, increase sugar content, and decrease amino acid content. After knocking out the CsPPC3 gene, the PEPC enzyme activity in cucumber fruits is reduced. Since the CO2 released by respiration in the fruit cannot be effectively captured and fixed, carbon loss occurs, which ultimately leads to a decrease in the content of malic acid, sugar and total free amino acids in the fruit.

[0075] The above is only a preferred embodiment of the present invention and does not limit the present invention in any way. Any simple modification, change and equivalent change made to the above embodiment according to the technical essence of the invention still falls within the protection scope of the technical solution of the present invention.

Claims

1. Application of CsPPC3 gene in the regulation of carbon and nitrogen metabolism in cucumber fruit, characterized in that: The nucleotide sequence of the CsPPC3 gene is shown in SEQ ID NO.1, and the amino acid sequence encoded by the CsPPC3 gene is shown in SEQ ID NO.

2. The application includes: using biological technology to overexpress or knock out the CsPPC3 gene to obtain transgenic plants.

2. The use according to claim 1, characterized in that: The method for constructing the CsPPC3 gene overexpressing transgenic plant is as follows: constructing a Super-1300-CsPPC3 overexpression vector, infecting cucumber cotyledons with Agrobacterium for genetic transformation, overexpressing the CsPPC3 gene in cucumber fruits, screening positive buds, and obtaining stably inherited transgenic plants.

3. The use according to claim 1 or 2, characterized in that: The transgenic cucumber fruit of the CsPPC3 gene-overexpressing plant has a reduced amount of CO2 released during respiration, an enhanced CO2 refixation capacity, an increased single fruit weight, an increased content of malic acid, soluble sugars and starch, and a reduced amino acid content, indicating that more carbon sources flow to the carbon cycle in carbon-nitrogen metabolism.

4. The use according to claim 1, characterized in that: The method for constructing the CsPPC3 gene knockout transgenic plant is as follows: constructing a CRISPR-Cas9 gene editing vector, using gene editing technology, performing genetic transformation by infecting cucumber cotyledons with Agrobacterium, inhibiting the expression of the CsPPC3 gene in cucumber fruits, screening positive buds, and obtaining a stably inherited transgenic plant.

5. The use according to claim 1 or 4, characterized in that: The amount of CO2 released by respiration of cucumber fruits of the transgenic plants with the CsPPC3 gene knocked out increased, the weight of each fruit decreased, and the content of malic acid, soluble sugars and amino acids decreased, while the starch content increased, indicating that the CO2 re-fixation capacity decreased and the carbon source decreased, thereby reducing the utilization of carbon source materials in carbon and nitrogen metabolism.

Images