Application of cotton GbbHLH35 gene in plant verticillium wilt resistance

Abstract

The invention discloses application of a cotton GbbHLH35 gene in improving the disease resistance of plant verticillium wilt, the nucleotide sequence of the gene is shown as SEQ ID NO: 1, and the amino acid sequence is shown as SEQ ID NO: 2. The gene is remarkably and highly expressed in cotton roots and is remarkably up-regulated under the induction of verticillium wilt, and the sequence of the gene contains a conserved motif related to disease resistance. The sensitivity of the plant to verticillium wilt is enhanced by silencing the expression of the GbbHLH35 gene in the sea island cotton. The overexpressed GbbHLH35 gene arabidopsis thaliana homozygous line is obtained through a transgenic technology, and after the overexpressed GbbHLH35 gene arabidopsis thaliana homozygous line is infected with verticillium The invention has important significance in improvement of cotton verticillium wilt resistance breeding and research, and can be applied to breeding of resistant cotton varieties.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering, and in particular, relates to cotton GbbHLH35 Application of genes in plant resistance to Verticillium wilt. Background Art

[0002] Plant Verticillium wilt is a typical soil-borne fungal vascular disease caused by infection with Verticillium dahliae. Infected plants usually show leaf chlorosis, large-scale shedding and necrosis of stem vascular tissue, which eventually causes the plant to wilt and die. Symptoms vary due to the different pathogenicity of the pathogen. Verticillium dahliae has a very wide host range and can harm 660 plant species in 38 families. The pathogen has many physiological types and mutates quickly. It can survive in the soil for several years and can germinate repeatedly, making it difficult to completely prevent and control, which seriously endangers crop production and development. China is one of the countries with the longest cotton planting history in the world, with a vast cotton-friendly area. As of 2023, my country's cotton cultivation area is about 50 million mu, and its output accounts for 22.4% of the world's total output. Cotton Verticillium wilt caused by Verticillium dahliae has exacerbated the imbalance of cotton supply. In China, the area of ​​cotton fields affected by Verticillium wilt exceeds 20 million mu each year. Long-term plant production practice has shown that chemical control and tillage cultivation measures in the field are difficult to achieve thorough and long-term effective control effects, and the selection and planting of disease-resistant varieties are the most economical and effective measures to control Verticillium wilt.

[0003] Basic / Helix-Loop-Helix (bHLH) transcription factors are the most common transcription factor family in plants. They have a large number of members and diverse functions, playing multiple roles in plant growth and development, stress response, and defense response. bHLH transcription factors usually participate in multiple hormone pathways to mediate plant defense responses. AtbHLH17 , AtbHLH14 , AtbHLH13 , AtbHLH3 The expression level of the gene can significantly improve the resistance of plants to gray mold. Further studies have found that it mainly regulates plant resistance by inhibiting the damage response genes in the jasmonic acid metabolic pathway. In related cotton research, bHLH family genes can participate in improving cotton's resistance to Verticillium wilt by mediating the response of the jasmonic acid metabolic pathway. Other reports have also found that it may improve cotton's disease resistance by participating in ethylene signal response and cell wall biosynthesis pathways. In the study, the present invention cloned and identified a cotton GbbHLH35 Through sequence structure, function analysis and expression pattern analysis, it was found that the gene would be expressed in large quantities in the roots when infected by Verticillium wilt. Subsequently, transgenic plants were created using gene silencing and overexpression methods, verifying its important role in resisting Verticillium wilt. Summary of the invention

[0004] The object of the present invention is to provide cotton GbbHLH35 New applications of genes in improving plant disease resistance.

[0005] A first aspect of the present invention provides a GbbHLH35 Gene, application of the gene in regulating disease resistance of target plants; GbbHLH35 The nucleotide sequence encoded by the gene is shown in SEQ ID NO.1, and the encoded amino acid sequence is shown in SEQ ID NO.2.

[0006] Furthermore, the disease resistance is Verticillium wilt resistance, and the target plant is cotton or Arabidopsis thaliana.

[0007] Furthermore, the application is to overexpress cotton genes in plants GbbHLH35 , thereby improving the plant's resistance to Verticillium wilt.

[0008] The second aspect of the present invention provides a GbbHLH35 Application of genes in improving plant resistance to Verticillium wilt, introduction of cotton genes into the model organism Arabidopsis GbbHLH35 , obtaining transgenic plants with stronger resistance to Verticillium wilt than the model organism.

[0009] This study identifies for the first time a novel gene that can improve plant disease resistance GbbHLH35 Gene. GbbHLH35 Silencing the gene expression level in sea island cotton H3-79 increased cotton's susceptibility to Verticillium wilt, while overexpression in Arabidopsis thaliana improved resistance to Verticillium wilt.

[0010] The advantages and positive effects of the present invention are:

[0011] (1) Yes GbbHLH35 Genes were systematically analyzed for their evolutionary relationships, sequence structures, and expression patterns to clarify GbbHLH35 The important role of genes in plant disease resistance.

[0012] (2) Obtained through genetic modification technology GbbHLH35 When gene-silenced cotton plants were infected with Verticillium wilt, the number of disease fingers increased significantly and the number of pathogens colonizing the stems increased, indicating that the gene positively regulates the disease resistance of cotton.

[0013] (3) Obtained through genetic modification technology GbbHLH35 In the homozygous Arabidopsis line overexpressing the gene, after infection with Verticillium dahliae, it was found that its disease index was significantly reduced, the number of colonized pathogens was less, and the degree of cell damage was lighter.

[0014] Therefore, the present invention has important significance in breeding and research for improving the resistance of cotton to Verticillium wilt, and can be applied to breeding disease-resistant cotton varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 cotton GbbHLH35 Analysis of the evolutionary relationship and expression pattern of genes; among which: (A) bHH35 Sequence alignment of the conserved bHLH domain of genes in Arabidopsis, Gossypium barbadense, Gossypium hirsutum, Gossypium asiatica and Gossypium raimondii. (B) bHH35 Phylogenetic relationships of genes in dicots and monocots. (C) GbbHLH35 Analysis of gene expression patterns in different tissues and organs of cotton. (D) After infection with Verticillium dahliae, GbbHLH35 Analysis of gene expression patterns.

[0016] Figure 2 cotton GbbHLH35 Analysis of gene protein structure and function; including: (A) GbbHLH35 Schematic diagram of gene structure. (B) GbbHLH35 Schematic diagram of the distribution of potential gene motif sites. (C) GbbHLH35 Schematic diagram of the distribution of cis-acting elements in gene promoter regions. (D) GbbHLH35 Gene protein secondary structure analysis. (E) GbbHLH35 Analysis of the hydrophilicity of gene proteins. (F) GbbHLH35 Schematic diagram of the tertiary structure of gene protein.

[0017] Figure 3 cotton GbbHLH35 Phenotypic analysis after gene silencing; (A) Albino phenotype after PDS gene silencing. (B) Phenotypic images of silenced plants and control plants 25 days after infection with Verticillium wilt. (C) GbbHLH35 Analysis of gene silencing efficiency. (D) Browning phenotype of the stems of silenced plants and control plants 15 days after infection with Verticillium dahliae. (E) Statistical analysis of disease index of silenced plants and control plants 25 days after infection with Verticillium dahliae. (F) Pathogen recovery culture of stems of silenced plants and control plants 15 days after infection with Verticillium dahliae. (G) Analysis of fungal biomass of stems of silenced plants and control plants 15 days after infection with Verticillium dahliae.

[0018] Figure 4 Arabidopsis overexpression GbbHLH35 Screening of transgenic lines; (A) Screening of positive seedlings in the T0 generation. (B) PCR detection of transgenic lines in the T1 generation, wells 1-6 are transgenic lines, well 7 is a blank control (water), and well 8 is a wild-type control (WT). (C) qRT-PCR detection of transgenic lines in the T2 generation GbbHLH35 expression level.

[0019] Figure 5 Arabidopsis overexpression GbbHLH35Phenotypic analysis of genetic strains; including: (A) Phenotypic diagram of wild-type plants and transgenic strains 30 days after infection with Verticillium dahliae. (B) Statistical analysis of disease index of wild-type plants and transgenic strains 30 days after infection with Verticillium dahliae. (C) Analysis of leaf fungal biomass of wild-type plants and transgenic strains 30 days after infection with Verticillium dahliae. (D) Statistical analysis of disease level of wild-type plants and transgenic strains 30 days after infection with Verticillium dahliae. (E) Analysis of chlorophyll content of wild-type plants and transgenic strains 25 days after infection with Verticillium dahliae.

[0020] Figure 6 Arabidopsis overexpression GbbHLH35 Analysis of biochemical traits of transgenic strains after infection with Verticillium wilt; including: (A) Schematic diagram of DAB staining results of rosette leaves of wild-type plants and transgenic strains. (B) Schematic diagram of trypan blue staining results of rosette leaves of wild-type plants and transgenic strains. (C) Determination of hydrogen peroxide content in wild-type plants and transgenic strains.

[0021] Figure 7 Schematic diagram of inoculating the back of Arabidopsis leaves with Verticillium wilt. DETAILED DESCRIPTION

[0022] In order to better explain the present invention, the scheme of the present invention will be described in detail below in conjunction with the embodiments. The methods used in the following embodiments are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following embodiments are all commercially available unless otherwise specified.

[0023] Example 1 Cotton GbbHLH35 Analysis of evolutionary relationships and expression patterns of genes.

[0024] In the long process of biological evolution, interspecific hybridization between diploid wild cotton formed the allotetraploid cotton genus that is currently widely cultivated. GbbHLH35 The full-length sequence of the gene is 738 bp, encoding a protein consisting of 245 amino acid residues. Gossypium hirsutum )、Asian cotton( G. arboreum )、Raymond cotton( G. raimondii ) and Arabidopsis genome files, and obtained protein sequences containing 245, 242, 245 and 264 amino acid residues, respectively, which all contain a conserved bHLH domain, including a typical basic region, two α-helical regions, and a loop region ( Figure 1 A). Then GbbHLH35 The evolutionary relationship of genes in dicots and monocots was analyzed using GbbHLH35The protein sequence of the gene was compared with the plant genome database (https: / / phytozome-next.jgi.doe.gov) to obtain homologous genes in two wild cottons (long-calyx cotton and Australian cotton), monocots (corn, rice, wheat, sorghum) and dicots (peanut, soybean, cocoa tree). A phylogenetic tree was constructed using MEGA software, and the results showed that in the same cotton genus GbbHLH35 The gene is more closely related to G. raimondii and G. longiflora, and the gene may have originated from G. raimondii and G. longiflora. The gene is also widely distributed in different angiosperms ( Figure 1 B). To understand GbbHLH35 Expression patterns in tissues and organs: Under normal growth conditions, when the sea island cotton H3-79 grew to the three-leaf and one-heart stage, appropriate amounts of samples were taken from the roots, stems, leaves, flowers, anthers and ovules of the seedlings, and RNA was extracted after quick freezing in liquid nitrogen, reverse transcribed into cDNA, and detected by qRT-PCR. GbbHLH35 The expression of genes in different organs. The results show: GbbHLH35 The expression level in roots was significantly higher than that in other organs ( Figure 1 C). Combined with the expression pattern analysis of the root tissue of Sea Island Cotton H3-79 infected by Verticillium wilt ( Figure 1 D), its expression level was rapidly upregulated after infection by Verticillium wilt, especially during the 24h-48h period of infection, indicating that GbbHLH35 may play a role in the early stage of resistance to Verticillium wilt.

[0025] Example 2 Cotton GbbHLH35 Protein structure and function analysis of genes.

[0026] Using the annotation file of the sea island cotton genome, TBTools was used to draw GbbHLH35 The gene structure showed that it contained 5 exons and 4 introns ( Figure 2 A). Identification through the MEME website (https: / / meme-suite.org / ) GbbHLH35 The potential conserved motifs in the gene protein sequence showed that it contained 10 motif potential binding sites, among which motif7 contained functions related to disease resistance ( Figure 2 B) To understand regulation GbbHLH35 We obtained potential elements of gene expression GbbHLH35 The 2000 bp sequence upstream of the gene was predicted and analyzed using the PlantCare website (http: / / bioinformatics.psb.ugent.be / webtools / plantcare / html / ), and the results showed that ( Figure 2 C), in GbbHLH35The promoter region of the gene contains not only a large number of cis-acting elements related to light response, but also cis-acting elements related to abscisic acid and methyl jasmonate hormone response, which indicates that GbbHLH35 These plant hormones may play a potential role in resistance to Verticillium wilt. The structure and function of proteins are closely related, and the online websites (SOPMA: https: / / npsa-prabi.ibcp.fr / cgi-bin / , SWISS: https: / / swissmodel.expasy.org / ) GbbHLH35 The protein structure of the gene was analyzed and the results showed that its secondary structure was mainly composed of α-helix, β-fold and random coil ( Figure 2 D), with a typical dimer tertiary structure ( Figure 2 F), most amino acids are hydrophilic ( Figure 2 E).

[0027] Example 3 Preliminary identification of VIGS technology GbbHLH35 Role of genes in cotton resistance to Verticillium wilt.

[0028] Construction of TRV2:GbbHLH35 VIGS genetic transformation vector. Extraction of RNA from the root tissue of G. barbadense H3-79 was reverse transcribed into cDNA as a template. GbbHLH35 Specific primers of the gene silencing fragment (forward primer: ATGGAGAATATTGAGAATATTGG; reverse primer: GTGCAATTCTTGGATGTAATC) were used for PCR amplification using high-fidelity DNA polymerase, and the target band was recovered after agarose gel electrophoresis. The TRV2 vector was double-digested with EcoRI and BamHI, and the specific silencing fragment of the GbbHLH35 gene was connected to the TRV2 vector after digestion through homologous recombination. It was then transformed into Escherichia coli DH5α and the positive strains were detected and sequenced. The positive strains with consistent sequencing results were transformed into Agrobacterium GV3101.

[0029] Conversion GbbHLH35Gene silenced plants. Sea island cotton H3-79 was used as the experimental material, and the susceptible variety Hebei cotton 11 was used as the control material. After the seeds germinated, seeds with consistent growth were selected and transplanted into nutrient soil for growth. The growth conditions were 28℃ / 16h / light and 25℃ / 8h / dark. Wait until all the cotyledons of the plants are flattened for injection. The constructed TRV2:GbbHLH35 Agrobacterium was activated, with TRV2:00 as the negative control and TRV2:PDS as the positive control. Use a 1 mL syringe to inject the bacterial solution from the back of the cotyledon to fill the entire cotyledon, then place it in the dark for 24 hours, and then transfer it to normal growth conditions for culture. Two weeks later, the plants injected with TRV2:PDS showed an albino phenotype ( Figure 3 A), indicating that the gene silencing system is effective. To determine the silencing efficiency, qRT-PCR was used to detect GbbHLH35 The expression levels of the gene in the control and silenced plants. The results showed that: GbbHLH35 The gene expression level was significantly lower than that of the control plants ( Figure 3 C), demonstrating that the gene was successfully silenced.

[0030] Disease resistance identification of silent plants. When the plants grow to the two-leaf and one-heart stage, use Cha's medium to activate the Verticillium wilt pathogen V991 and adjust the spore suspension concentration to 1×10 7 spores / mL, and the silent plants and control plants were inoculated with root wound bacteria. The inoculation volume was 2 mL / plant, and 30 plants were inoculated in each treatment, with three replicates in total. 25 days after inoculation, the TRV2:GbbHLH35 plants showed obvious yellowing phenotype ( Figure 3 B), the disease index reached 68.9 ( Figure 3 E), the number of TRV2:00 yellowing plants in the control empty-loaded plants was less, and the disease index was significantly lower than that of the silent plants, only 25.0 ( Figure 3 E). At the early stage of pathogen infection, the stems were cut open 15 days after inoculation and observed. The vascular tissue of TRV2:GbbHLH35 plants was severely browned, which was the same as the browning degree of the control susceptible variety Jimian 11, while the browning degree of the control empty-load plant TRV2:00 was lighter ( Figure 3 D). At the same time, the fungal biomass in the tissue was detected. The tissue 4 cm below the cotyledon node was taken and ground with liquid nitrogen to extract genomic DNA. The qRT-PCR detection was performed using primers specific to Verticillium dahliae (forward primer ITS1: AAAGTTTTAATGGTTCGCTAAGA; reverse primer ST-Ve1: CTTGGTCATTTAGAGGAAGTAA). The results showed that the fungal content in the silenced plant TRV2:GbbHLH35 was significantly higher than that in the control empty-load plant TRV2:00 ( Figure 3G). Subsequently, the colonization of Verticillium wilt was observed by pathogen recovery culture. The stem tissues at the same position were disinfected with sodium hypochlorite on the epidermis and then placed in PDA medium for dark culture at 25°C. After one week of culture, the silent plants TRV2:GbbHLH35 and the control susceptible plants JIMIAN11 produced a large amount of white hyphae, while the untreated plants TRV2:00 did not produce hyphae ( Figure 3 F).

[0031] These results indicate that GbbHLH35 The decrease in expression level significantly reduced cotton resistance to Verticillium dahliae.

[0032] Example 4 Overexpression GbbHLH35 Role of genes in resistance to Verticillium wilt in Arabidopsis thaliana.

[0033] pCMBIA2300: Overexpression vector of GbbHLH35 was constructed according to GbbHLH35 The specific primers for full-length cloning were designed based on the CDS coding region sequence of the gene (forward primer: ATTTGGAGAGGACAGGGTACCATGCTTGCCATGGAGAATATTG; reverse primer: CTAGGTTAACCATGTGGTACCTCACATACTCATTGGACTTTGTGG), and the cDNA of sea island cotton H3-79 was used as a template to amplify and clone the gene. GbbHLH35 The full-length sequence fragment was then recovered by agarose gel electrophoresis and ligated to the pCMBIA2300 vector after KpnI digestion. The ligation product was transformed into Escherichia coli DH5α and the positive strain was detected. The positive strain with consistent sequencing results was transformed into Agrobacterium GV3101.

[0034] Arabidopsis overexpression GbbHLH35 Screening of gene strains. Wild-type Arabidopsis Col-0 was sown in nutrient soil under the growth conditions of 20°C and 16 h / 8 h of light. When it grew to the flowering stage, it was infected by the flower dipping method, and T0 generation seeds were collected after maturity. T0 generation seeds were spread on 1 / 2MS solid medium containing Kana (50 mg / mL) for positive seedling screening. Non-positive seedlings will show albino phenotype, and positive seedlings will show normal growth green ( Figure 4 A). Transplant the normally growing green positive seedlings into nutrient soil, and harvest the seeds of individual plants when they are mature and record them as T1 seeds. Sow the T1 seeds on 1 / 2MS solid medium containing Kana (50 mg / mL), count the ratio of positive seedlings to non-positive seedlings, and keep the single copy lines that meet the separation ratio of 3:1. At the same time, extract the DNA of the seedling leaves of each single line for PCR detection, and detect it through agarose gel electrophoresis, and keep the lines containing the target gene bands ( Figure 4 B) After the culture matured, T2 seeds were obtained. T2 seeds were sown on 1 / 2MS solid medium containing Kana (50 mg / mL), and the lines containing only positive seedlings were transplanted to nutrient soil for cultivation. During this period, RNA was extracted from the leaves of seedlings of each single line and tested by qRT-PCR. GbbHLH35 Among them, OE119 and OE120 have the highest expression levels ( Figure 4 C), as an overexpression GbbHLH35 The transgenic strains of the gene were used to obtain T3 seeds after they matured for the next experiment.

[0035] Overexpression GbbHLH35 Identification of Arabidopsis resistance to Verticillium wilt. Transgenic lines OE119, OE120 and wild-type Col-0 (WT) Arabidopsis were sown in nutrient soil. When they grew to four weeks old, the Verticillium wilt strain V991 was activated and the spore suspension concentration was adjusted to 1×10 6 spores / mL, watered from the roots, and the inoculation volume was 10 mL / plant. Each treatment was inoculated with 30 plants, with three replicates in total, and the water treatment was used as a control (Mock). After 30 days of inoculation, the leaves of the wild-type Col-0 showed obvious yellowing phenotype ( Figure 5 A), the disease index reached 85.4 ( Figure 5 B), the incidence of grade 3 and 4 reached 94% ( Figure 5 D), while the transgenic line OE119 showed a small amount of leaf yellowing phenotype ( Figure 5 A), the disease index was significantly lower than that of the wild type (WT) with only 35.0 ( Figure 5 B), among which the incidence of grade 0-2 is 24%-34%, the incidence of grade 3 is only 16%, and the incidence of grade 4 is 0 ( Figure 5 D), the leaves of another transgenic line OE120 also showed only a small amount of yellowing phenotype, and the disease index was significantly lower than that of the wild type Col-0, which was only 36.9 ( Figure 5 B), among which the incidence of grade 0-2 is 21%-48%, and the incidence of grade 3 and grade 4 is only 26% and 21% ( Figure 5 D). The colonization of Verticillium dahliae was observed by detecting the fungal biomass in Arabidopsis leaves. The Arabidopsis leaves were taken 30 days after inoculation, ground with liquid nitrogen, and then the genomic DNA was extracted. The qRT-PCR detection was performed using Verticillium dahliae-specific primers. The results showed that the fungal content of transgenic lines OE119 and OE120 was significantly lower than that of wild-type Col-0 plants ( Figure 5C). At 0d and 25d after inoculation, take about 0.01g of Arabidopsis leaves, add 95% ethanol and place in a 50℃ water bath in dark water bath for 4-5h to fully dissolve the chlorophyll. Then take 200 μL of solution and measure its absorbance at 649 nm and 665 nm. At the same time, use 95% ethanol as blank control for calibration and calculate the chlorophyll content of the sample. Calculation formula: Content of Chlorophyll (mg / g) = 0.003[(13.95A 665 -6.88A 649 ) +(24.96A 649 -7.32A 665 )] / sample fresh weight

[0036] The results showed that there was no significant difference in chlorophyll content between the transgenic lines OE119, OE120 and the wild type Col-0 before inoculation. After 25 days of inoculation with Verticillium dahliae, the chlorophyll content of the transgenic lines OE119 and OE120 was significantly higher than that of the wild type Col-0 plants ( Figure 5 E). Overexpression of the GbbHLH35 gene significantly enhanced resistance to Verticillium wilt in Arabidopsis.

[0037] Overexpression GbbHLH35 Analysis of biochemical traits of Arabidopsis after infection with Verticillium wilt. Transgenic lines OE119, OE120 and wild-type Col-0 Arabidopsis were sown in nutrient soil. When they grew to five weeks old, leaves with a leaf width of 1.5-2.0 cm were selected and cut from the petiole. Two filter papers moistened with sterile water were placed in a culture dish. The cut Arabidopsis leaves were placed with the back facing up and the petiole covered with sterile filter paper to keep the leaves moist. The Verticillium wilt strain V991 was activated and the concentration of the spore suspension was adjusted to 5×10 6 spores / mL, take 4-5 μL and evenly drop it on the back of the leaf, then place it at 25℃ and incubate it in the dark ( Figure 7 ). Thirty leaves were used for each treatment, and the results were repeated three times. Samples were taken at 0h, 12h, 24h, 48h, and 72h after inoculation for DAB staining and trypan blue-lactate phenol staining to observe the degree of cell damage and fungal colonization.

[0038] DAB staining: DAB staining experiments used a DAB colorimetric kit (Solarbio, Beijing, China, DA1016), and the working solution was prepared according to the instructions. Take the Arabidopsis leaves of the control group and the treatment group and put them into a 10mL centrifuge tube, add the working solution to ensure that the leaves are completely covered, and stain for 20-30 minutes in the dark. Pour out the staining solution, add 95% ethanol, boil in a boiling water bath until decolorized, and take pictures for observation. The results showed that in the early stage of Verticillium wilt infection, the brown area of ​​the transgenic lines OE119 and OE120 was significantly smaller than that of the wild-type Col-0 leaves, and the staining depth was lighter. After 72 hours of Verticillium wilt infection, the transgenic lines OE119 and OE120 showed obvious brown damage, but the wild-type Col-0 showed obvious brown damage at 48 hours ( Figure 6 A). This indicates that at the early stage of Verticillium wilt infection, the transgenic lines OE119 and OE120 showed less cell damage and longer resistance compared with the wild type Col-0.

[0039] Trypan blue-lactic acid phenol staining: Trypan blue can enter dead cells to stain damaged cells, and lactic acid phenol can fix the fungal morphology to observe the colonization degree of Verticillium wilt. Staining solution configuration: 10 g / mL phenol, 10 g / mL lactic acid, 20 g / mL glycerol, 0.8 mg / mL trypan blue, 2 times the volume of anhydrous ethanol, decolorization solution configuration: 2.5 g / mL chloral hydrate. Take the Arabidopsis leaves of the control group and the treatment group and put them into a 10 mL centrifuge tube, add the staining solution to ensure that the leaves are completely covered, heat in a boiling water bath for 5 minutes, then leave it at room temperature for 12 hours, pour out the staining solution, add the decolorization solution to soak and decolorize, replace the decolorization solution every 12 hours until the liquid is clear and the leaves are transparent, and take pictures for observation. The results showed that the blue-stained area of ​​the transgenic lines OE119 and OE120 was significantly smaller than that of the wild type Col-0, the coloring was lighter, and the infection time with obvious damage was later ( Figure 6 B). After 72 hours of infection with Verticillium wilt, the epidermis of the damaged leaves was observed under a 20X microscope. The wild-type Col-0 leaf epidermis was colonized with more Verticillium wilt spores, and conidiophores and hyphae had grown. Compared with the wild-type Col-0, the transgenic lines OE119 and OE120 had fewer Verticillium wilt spores, conidiophores and hyphae colonized on the leaf epidermis. This indicates that in the early stage of Verticillium wilt infection, due to GbbHLH35 Overexpression of the gene significantly inhibited the growth and spread of spores in the transgenic lines OE119 and OE120, showing stronger disease resistance than the wild type Col-0.

[0040] Dynamic changes in hydrogen peroxide (H2O2) content: In plant disease resistance, hydrogen peroxide is a common reactive oxygen molecule that usually causes plants to develop varying degrees of tolerance when subjected to stress. The hydrogen peroxide content was detected using an activity detection kit (Solarbio, Beijing, China, BC3595). For specific operation steps, please refer to the instruction manual. The results showed that before infection with Verticillium dahliae, there was no significant difference in the H2O2 content between the transgenic lines OE119, OE120 and the wild type Col-0. After infection with Verticillium dahliae, the H2O2 content in the transgenic lines OE119 and OE120 was significantly lower than that in the wild type Col-0. Compared with the control at 0h, the H2O2 content gradually increased after infection with Verticillium dahliae, and the rate of increase in the H2O2 content in the wild type Col-0 was significantly higher than that in the transgenic lines OE119 and OE120 ( Figure 6 C). This indicates that the transgenic GbbHLH35 Arabidopsis thaliana, during the infection of pathogens, enhances its resistance to Verticillium dahliae by inhibiting the rate of increase of hydrogen peroxide content.

[0041] The present invention analyzes cotton GbbHLH35 Gene sequence structure, evolutionary relationships and expression patterns were found to be GbbHLH35 The expression level in the root was significantly upregulated, and its protein sequence was subsequently identified to contain conserved motifs associated with disease resistance. GbbHLH35 Gene, significantly enhanced its sensitivity to Verticillium wilt, overexpressed by transgenic technology GbbHLH35 When the homozygous Arabidopsis thaliana line was infected with Verticillium wilt, it was found that it had significantly enhanced resistance to Verticillium wilt. GbbHLH35 Genetically modified cotton materials introduce target genes into the currently widely planted upland cotton promotion varieties to create new high-quality upland cotton strains with high disease resistance.

Claims

1. Cotton GbbHLH35 The application of the gene in improving the resistance of plants to Verticillium wilt is characterized in that: The cotton GbbHLH35 The nucleotide sequence of the gene is shown in SEQ ID No.1, and the amino acid sequence is shown in SEQ ID No.

2.

2. The cotton according to claim 1 GbbHLH35 The application of the gene in improving the resistance of plants to Verticillium wilt is characterized in that: The plant is cotton or Arabidopsis thaliana.

3. The cotton according to claim 1 GbbHLH35 The application of the gene in improving the resistance of plants to Verticillium wilt is characterized in that: By overexpressing the cotton GbbHLH35 Genes that improve plant resistance to Verticillium wilt.

4. A method for improving plant resistance to Verticillium wilt, characterized in that: Overexpression of the nucleotide sequence shown in SEQ ID NO: 1 in plants GbbHLH35 Gene.

5. A method for improving plant resistance to Verticillium wilt according to claim 4, characterized in that: The plant is cotton or Arabidopsis thaliana.

6. A method for improving plant resistance to Verticillium wilt according to claim 4, characterized in that: The build contains the GbbHLH35 Recombinant vector, expression cassette or recombinant bacteria of the gene.

Images