Protein mutant encoded by ncgl0216 and application of biological material thereof in production of l-isoleucine
By constructing protein mutants with specific amino acid sequences and expressing them in host cells or increasing their content, the problem of low isoleucine production was solved, and efficient production of isoleucine was achieved.
Patent Information
- Application Number
- CN202411981173.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-31
- Publication Date
- 2026-06-05
- Estimated Expiration
- 2044-12-31
AI Technical Summary
The yield of isoleucine in existing technologies is low and difficult to meet demand.
Isoleucine production is achieved by designing and constructing protein mutants containing specific amino acid sequences and expressing them by fusing them with tags, or by expressing or increasing their content or activity in host cells using recombinant vectors and microorganisms.
It significantly increased the yield of isoleucine, meeting production needs.
Smart Images

Figure BDA0005221587940000121
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to the application of NCgl0216 encoded protein mutants and their biomaterials in the production of L-isoleucine. Background Technology
[0002] L-Isoleucine is one of the eight essential amino acids for the human body. Due to its unique structure and function, it plays a particularly important role in human metabolism. Besides being used in general nutritional compound amino acid infusions and elemental diets, L-isoleucine is also used in special amino acid infusions such as liver-protecting and kidney-protecting amino acid infusions. In particular, high-branched-chain amino acid infusions and liver-protecting syrups produced with L-isoleucine as the main raw material have selective therapeutic effects on various liver diseases. L-isoleucine deficiency in the human body can lead to loss of appetite, decreased physical strength, anemia, and other functional disorders.
[0003] Isoleucine is a branched-chain amino acid containing three carbon atoms. Branched-chain amino acids play important roles in living organisms, participating not only in protein synthesis but also in physiological processes such as energy metabolism and signal transduction. The biosynthesis of isoleucine occurs through the organism's own metabolic pathways, primarily involving key enzymes in glycolysis, the citric acid cycle, and cholesterol synthesis. Summary of the Invention
[0004] The technical problem to be solved by this invention is how to increase the yield of isoleucine.
[0005] To solve the above-mentioned technical problems, the present invention first provides a protein, wherein the protein comprises the following A1), A2), or A3):
[0006] A1) A protein containing the amino acid sequence shown in SEQ ID No. 4;
[0007] A2) A protein whose amino acid sequence of the protein described in A1) is replaced and / or deleted and / or added with one or more amino acid residues and has more than 98% identity with the protein described in A1) and has the same function.
[0008] A3) is a fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of A1) or A2).
[0009] The protein in A2) above is a protein that shares more than 98% amino acid sequence identity with the protein shown in SEQ ID No. 4 and has the same function. Identity refers to the similarity of the amino acid sequences. The identity of amino acid sequences can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing a search for the identity of a pair of amino acid sequences to calculate the identity value (%), then the identity value can be obtained. The statement "more than 98% identity" means 98% or 99% identity.
[0010] The protein in A2) above may specifically be the protein shown in SEQ ID No. 2.
[0011] The proteins mentioned in A2 above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.
[0012] The gene encoding the protein in A2) above can be obtained by deleting one or more amino acid residues from the DNA sequence shown in SEQ ID No. 3, and / or by performing a missense mutation on one or more nucleotide pairs, and / or by attaching a tagging sequence to its 5′ and / or 3′ ends, as shown in SEQ ID No. 1. The DNA molecule shown in SEQ ID No. 3 encodes the protein shown in SEQ ID No. 4, and the DNA molecule shown in SEQ ID No. 1 encodes the protein shown in SEQ ID No. 2.
[0013] The tag described in A3) can be a polypeptide or protein fused with the target protein using in vitro DNA recombination technology, to facilitate the expression, detection, tracing, and / or purification of the target protein. The tag can be Poly-Arg, Poly-His, FLAG, Strep-tag II, c-myc, MBP tag, HA tag, GST tag, and / or SUMO tag, etc.
[0014] In one embodiment of the present invention, the protein is the protein shown in SEQ ID No. 4.
[0015] In another embodiment of the present invention, the protein is the protein shown in SEQ ID No. 2.
[0016] The protein shown in SEQ ID No. 4 was obtained by mutating the alanine residue at position 38 of SEQ ID No. 2 to a threonine residue.
[0017] The present invention also provides biomaterials related to said protein, said biomaterials comprising any one of the following B1) to B4):
[0018] B1) The nucleic acid molecule that encodes the protein;
[0019] B2) An expression cassette containing the nucleic acid molecule described in B1);
[0020] B3) A recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2);
[0021] B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3).
[0022] The nucleic acid molecule can be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA or hnRNA.
[0023] Those skilled in the art can readily mutate the nucleotide sequence encoding the protein of the present invention using known methods, such as directed evolution and point mutation. Artificially modified nucleotides that have 75% or higher identity with the nucleotide sequence of the protein of the present invention, as long as they encode the protein and have the same protein function, are derived from and equivalent to the nucleotide sequence of the present invention.
[0024] In the above-mentioned biological materials, the nucleic acid molecule described in B1) may be as follows: b11) or b12):
[0025] b11) A DNA molecule containing the coding sequence shown in SEQ ID No. 3;
[0026] The nucleotide sequences defined by b12) and b11) have 75% or more identity and encode the DNA molecule of the protein.
[0027] b11) may contain the DNA molecule shown in SEQ ID No. 3. Specifically, b11) may be the DNA molecule shown in SEQ ID No. 3.
[0028] As used herein, the term "identity" refers to sequence similarity to a natural nucleic acid sequence. "Identity" includes nucleotide sequences that have 75% or higher, 85% or higher, 90% or higher, or 95% or higher identity with the nucleotide sequence encoding the amino acid sequence shown in SEQ ID No. 4 of this invention. Identity can be evaluated visually or using computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.
[0029] The aforementioned 75% or higher identity can be 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%.
[0030] b12) can be the DNA molecule shown in SEQ ID No. 1.
[0031] B1) The nucleic acid molecule may be the DNA molecule shown in SEQ ID No. 3 or the DNA molecule shown in SEQ ID No. 1.
[0032] In the aforementioned biological materials, the expression cassette (gene expression cassette of the protein) containing a nucleic acid molecule encoding the protein described in B2) refers to DNA capable of expressing the protein in a host cell. This DNA may include not only a promoter to initiate gene transcription of the protein but also a terminator to terminate gene transcription of the protein. Furthermore, the expression cassette may also include an enhancer sequence.
[0033] B2) The promoter in the expression box may contain, or may be, as follows: b21) or b22):
[0034] b21) The DNA molecule shown in positions 21-120 of SEQ ID No. 7 in the sequence listing;
[0035] DNA molecules that have 75% or more identity with the nucleotide sequences defined by b22) and b21) and have promoter function.
[0036] In one embodiment of the present invention, the expression box B2) may be as shown in bits 21-1029 of SEQ ID No. 7 or bits 21-1029 of SEQ ID No. 8.
[0037] Recombinant vectors containing the protein expression cassette can be constructed using existing expression vectors.
[0038] In the aforementioned biological materials, the vector can be a plasmid, granule, bacteriophage, or viral vector. Specifically, the plasmid can be the pK18mobsacB vector or the pXMJ19 vector.
[0039] B3) The recombinant vector may be pK18-NCgl0216. A38T pK18-NCgl0216 A38T The recombinant vector is obtained by replacing the fragment (small fragment) between the Xbal I and BamH I recognition sites of the pK18mobsacB vector with the DNA fragment shown in positions 37-1467 of SEQ ID No. 5 in the sequence listing, while keeping the other sequences of the pK18mobsacB vector unchanged.
[0040] B3) The recombinant vector may be pXMJ19-NCgl0216 or pXMJ19-NCgl0216. A38T pXMJ19-NCgl0216 is a recombinant vector obtained by inserting the gene expression cassette of the protein shown in positions 37-1045 of SEQ ID No. 10 into the pXMJ19 vector. A38T A recombinant vector obtained by inserting the gene expression cassette of the protein shown in positions 37-1045 of SEQ ID No. 11 into the pXMJ19 vector.
[0041] In the aforementioned biological materials, the microorganisms may be bacteria, yeast, algae, or fungi. Specifically, the bacteria may be at least *Corynebacterium glutamicum*. The bacteria may also be *Escherichia coli*, *Pantoea ananatis*, *Bacillus brevis*, or *Brevislactobacillus*.
[0042] In one embodiment of the present invention, the Corynebacterium glutamicum is Corynebacterium glutamicum CGMCC 20437 or Corynebacterium glutamicum ATCC13032.
[0043] B4) The recombinant microorganism may be a recombinant microorganism obtained by replacing the coding gene of the protein shown in SEQ ID No. 4 (such as the gene shown in SEQ ID No. 3) in the starting microorganism with the coding gene of the protein shown in SEQ ID No. 2 (such as the gene shown in SEQ ID No. 1), or it may be a recombinant microorganism obtained by expressing the protein in the starting microorganism, or by increasing the content or activity of the protein in the starting microorganism.
[0044] In embodiments of the present invention, the recombinant microorganisms are recombinant bacteria YPI-0216-1, YPI-0216-2, YPI-0216-3, YPI-0216-4, YPI-0216-5, YPI-0216-6, YPI-0216-7, YPI-0216-8, YPI-0216-9, and YPI-0216-10.
[0045] The recombinant strain YPI-0216-1 is a strain obtained by replacing the gene shown in SEQ ID No. 1 of Corynebacterium glutamicum CGMCC20437 with the gene shown in SEQ ID No. 3.
[0046] The recombinant strain YPI-0216-2 is a strain obtained by replacing the gene shown in SEQ ID No. 1 of Corynebacterium glutamicum ATCC13032 with the gene shown in SEQ ID No. 3.
[0047] The recombinant strain YPI-0216-3 was obtained by inserting the gene expression cassette shown in positions 21-1029 of SEQ ID No. 7 into the poxB site of the genome of Corynebacterium glutamicum CGMCC20437.
[0048] The recombinant strain YPI-0216-4 was obtained by inserting the gene expression cassette shown in positions 21-1029 of SEQ ID No. 8 into the poxB site of the genome of Corynebacterium glutamicum CGMCC20437.
[0049] The recombinant strain YPI-0216-5 was obtained by inserting the gene expression cassette shown in positions 21-1029 of SEQ ID No. 7 into the poxB site of the genome of Corynebacterium glutamicum ATCC13032.
[0050] The recombinant strain YPI-0216-6 was obtained by inserting the gene expression cassette shown in positions 21-1029 of SEQ ID No. 8 into the poxB site of the genome of Corynebacterium glutamicum ATCC13032.
[0051] The recombinant strain YPI-0216-7 is a recombinant strain obtained by introducing the recombinant vector pXMJ19-NCgl0216 into Corynebacterium glutamicum CGMCC 20437.
[0052] The recombinant strain YPI-0216-8 is derived from the recombinant vector pXMJ19-NCgl0216. A38T Recombinant bacteria obtained by introducing Corynebacterium glutamicum CGMCC 20437.
[0053] The recombinant strain YPI-0216-9 is a recombinant strain obtained by introducing the recombinant vector pXMJ19-NCgl0216 into Corynebacterium glutamicum ATCC13032.
[0054] The recombinant strain YPI-0216-10 is derived from the recombinant vector pXMJ19-NCgl0216. A38T Recombinant bacteria obtained by introducing Corynebacterium glutamicum ATCC13032.
[0055] The present invention also provides a method for producing isoleucine (such as L-isoleucine), the method comprising X1) or X2):
[0056] X1) Replace the coding gene of the protein shown in SEQ ID No. 2 in the starting bacteria with the coding gene of the protein shown in SEQ ID No. 4 to obtain recombinant bacteria; culture the recombinant bacteria to obtain isoleucine;
[0057] X2) Express the protein in the starting organism cells, or increase the content or activity of the protein in the starting organism cells to obtain recombinant organism cells; culture the recombinant organism cells to obtain isoleucine;
[0058] The starting organism cell is at least a bacterium, yeast, algae, fungus, plant cell, or animal cell capable of synthesizing isoleucine.
[0059] The originating bacteria contain the coding gene for the protein shown in SEQ ID No. 2, or the DNA molecule shown in SEQ ID No. 1.
[0060] The originating bacteria can be at least bacteria. The bacteria can be at least Corynebacterium glutamicum, such as Corynebacterium glutamicum CGMCC 20437 or Corynebacterium glutamicum ATCC13032.
[0061] The bacteria of this invention include, but are not limited to, Corynebacterium glutamicum. Any bacterium containing the isoleucine synthesis pathway can utilize the proteins and related biological materials of this invention to produce isoleucine. The bacteria can be at least Corynebacterium glutamicum. The bacteria can also be Escherichia coli, Pantoea ananatis, Bacillus brevis, or Brevis lactobacillus.
[0062] The method described above (X2) can be achieved by introducing the gene encoding the protein into the starting organism's cells and allowing it to be expressed.
[0063] In the above method, the recombinant biological cells (or recombinant bacteria) can be cultured using a culture medium that enables the recombinant biological cells (or recombinant bacteria) to grow;
[0064] And / or, the recombinant biological cells (or the recombinant bacteria) are cultured under conditions that enable the recombinant biological cells (or the recombinant bacteria) to grow.
[0065] The recombinant biological cells may be the recombinant microorganisms described above. The recombinant bacteria may also be the recombinant microorganisms described above.
[0066] The application of the protein or the biomaterial in the production of isoleucine (such as L-isoleucine), or in the preparation of products for the production of isoleucine (such as L-isoleucine), is also within the scope of protection of this invention.
[0067] The protein or biomaterial of this invention can be used to produce a variety of products, including but not limited to isoleucine in the examples. The amino acids produced may also include glutamic acid, valine, glycine, alanine, leucine, lysine, methionine, proline, tryptophan, serine, tyrosine, cysteine, phenylalanine, asparagine, glutamine, threonine, aspartic acid, arginine, histidine, shikimic acid, protocatechuic acid, succinic acid, α-ketoglutarate, citric acid, ornithine, and citrulline. The production of various target products can be achieved by placing the protein of this invention into the target product synthesis pathway.
[0068] The proteins and their biomaterials of the present invention can be used to produce isoleucine. Replacing the coding gene of the protein shown in SEQ ID No. 2 in the starting organism cell with the coding gene of the protein shown in SEQ ID No. 4, or increasing the content or activity of the protein shown in SEQ ID No. 2 or SEQ ID No. 4 in the starting organism cell, can increase the yield of isoleucine.
[0069] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0070] Instructions for the Preservation of Biological Materials
[0071] Classification and nomenclature: Corynebacterium glutamicum
[0072] Strain number: YPILE001
[0073] Name of depositary institution: China General Microbiological Culture Collection Center, China Microbiological Culture Collection Committee
[0074] Abbreviation of depositary institution: CGMCC
[0075] Address of the depository: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Postcode: 100101
[0076] Date of preservation: August 17, 2020
[0077] CGMCC Registration Number: CGMCC No. 20437 Detailed Implementation
[0078] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials, reagents, instruments, etc., used in the following examples are commercially available. SPSS 11.5 statistical software was used to process the data in the following examples. Experimental results are expressed as averages and analyzed using one-way ANOVA.
[0079] The *Corynebacterium glutamicum* CGMCC 20437 described in the following examples was deposited on August 17, 2020, at the China General Microbiological Culture Collection Center (CGMCC, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences), with accession number CGMCC No. 20437, and classified as *Corynebacterium glutamicum*. *Corynebacterium glutamicum* CGMCC20437 contains an L-isoleucine synthesis pathway.
[0080] In Examples 1-5, Corynebacterium glutamicum was cultured at 32°C.
[0081] Example 1: Construction of a recombinant vector containing a point-mutated NCgl0216 gene coding region fragment
[0082] Based on the genome sequence of Corynebacterium glutamicum ATCC13032 published by NCBI, a pair of primers for amplifying the coding region of the NCgl0216 gene were designed and synthesized. A point mutation was introduced into the coding region (SEQ ID No. 1) of the NCgl0216 gene of Corynebacterium glutamicum CGMCC 20437 (which was confirmed by sequencing to retain the wild-type NCgl0216 gene on its chromosome) by allele substitution. The point mutation was to change guanine (G) to adenine (A) at position 112 of the nucleotide sequence (SEQ ID No. 1) of the NCgl0216 gene.
[0083] The DNA molecule shown in SEQ ID No. 1 encodes a protein with the amino acid sequence of SEQ ID No. 2 (this protein is a wild-type protein, denoted as protein NCgl0216).
[0084] The DNA molecule shown in SEQ ID No. 3 encodes a mutant protein with the amino acid sequence of SEQ ID No. 4 (this mutant protein is designated NCgl0216). A38TThe mutant protein NCgl0216 A38T The threonine (T) at position 38 in (SEQ ID No.4) is derived from alanine (A) by mutation.
[0085] Vectors were constructed using NEBuilder recombination technology. Primers were designed as follows (synthesized by Invitrogen Shanghai). Nucleotides in bold red indicate mutation sites:
[0086] P1: 5′- CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAG ATGATTTACA CAGTACTAGC-3′,
[0087] P2:
[0088] P3:
[0089] P4: 5'- CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCC GTCGATTTCT CTTTAATATG-3′.
[0090] Construction method: Using the genome of Corynebacterium glutamicum ATCC13032 as a template, PCR amplification was performed using primers P1 and P2, P3 and P4, respectively, to obtain two DNA fragments (NCgl0216 Up and NCgl0216 Down) containing mutated nucleotides and with sizes of 796bp and 758bp, respectively, of the NCgl0216 gene coding region.
[0091] The two DNA fragments (NCgl0216 Up and NCgl0216 Down) were separated and purified by agarose gel electrophoresis. They were then ligated with the pK18mobsacB vector (BioVector, containing a kanamycin resistance marker) purified after enzyme digestion (Xbal I / BamHI) using NEBuilder enzyme (NEB) at 50°C for 30 min. The ligation product was transformed into DH5α, and the resulting single clones were identified by PCR using M13 primers (M13F: 5′-TGT AAA ACG ACG GCC AGT-3′, M13R: 5′-CAG GAA ACA GCTATG ACC-3′) to obtain the positive recombinant vector pK18-NCgl0216. A38T The recombinant vector pK18-NCgl0216 was digested with the correct enzymes. A38T The sample was sent to a sequencing company for sequencing and identification, and the recombinant vector pK18-NCgl0216 containing the correct point mutation (GA) was selected. A38T Save for future use.
[0092] Recombinant vector pK18-NCgl0216 A38TThe recombinant vector contains the DNA fragment shown in SEQ ID No. 5, which is obtained by replacing the fragment (small fragment) between the Xbal I and BamHI recognition sites of the pK18mobsacB vector with the DNA fragment shown in positions 37-1467 of SEQ ID No. 5 in the sequence listing, while keeping the other sequences of the pK18mobsacB vector unchanged.
[0093] Recombinant vector pK18-NCgl0216 A38T Contains the mutant gene NCgl0216 shown in SEQ ID No. 3 A38T .
[0094] Example 2: Constructing a structure containing the gene NCgl0216 A38T engineered strains
[0095] Construction method: The allelic substitution vector (pK18-NCgl0216) from Example 1 was used. A38T After being electroporated into *Corynebacterium glutamicum* CGMCC 20437 and *Corynebacterium glutamicum* ATCC13032, the bacteria were cultured in culture media (see Table 1 for composition). Single colonies were picked and cultured on a medium containing 15% sucrose (sucrose concentration 15 g / L, other components and concentrations are shown in Table 1). These single colonies were then cultured on media containing and without kanamycin. Strains that grew on the kanamycin-free medium but not on the kanamycin-containing medium were further identified by PCR using the following primers (synthesized by Invitrogen Shanghai):
[0096] P5: 5′-GGGGAATTTTGCTTCTGGGT-3′,
[0097] P6: 5′-GAAAGAGGTC GGCTCCTTTC-3′.
[0098] The obtained PCR amplification product (240bp) was sequenced. Through sequence alignment, the strain with a mutation (GA) at nucleotide position 112 of the NCgl0216 gene was identified as a positive strain with successful allelic substitution. The mutant strain obtained from Corynebacterium glutamicum CGMCC 20437 was named YPI-0216-1, and the mutant strain obtained from Corynebacterium glutamicum ATCC13032 was named YPI-0216-2.
[0099] The recombinant bacteria YPI-0216-1 and YPI-0216-2 respectively replaced the wild-type NCgl0216 gene in Corynebacterium glutamicum CGMCC 20437 and Corynebacterium glutamicum ATCC13032 strains with the NCgl0216 gene shown in SEQ ID No. 3. A38T Strains obtained from mutated genes.
[0100] Table 1. Composition of the culture medium (the remainder is water)
[0101] Element formula sucrose 10g / L Polypeptone 10g / L Beef extract 10g / L yeast powder 5g / L urea 2g / L Sodium chloride 2.5g / L Agar powder 20g / L pH 7.0
[0102] Example 3: Constructing a genome overexpressing the NCgl0216 gene and NCgl0216 A38T engineered strains of genes
[0103] Vectors were constructed using NEBuilder recombination technology. Based on the genome sequence of Corynebacterium glutamicum ATCC13032 published by NCBI, three pairs of amplified upstream and downstream homologous arm fragments and NCgl0216 or NCgl0216 were designed and synthesized. A38T Primers for the gene coding region and promoter region were used to introduce NCgl0216 or NCgl0216 into Corynebacterium glutamicum CGMCC 20437 via homologous recombination. A38T Gene expression cassette.
[0104] The primers were designed as follows (synthesized by Invitrogen Shanghai):
[0105] P7:
[0106] P8:
[0107] P9:
[0108] P10:
[0109] P11:
[0110] P12:
[0111] Construction method: Using the genomes of Corynebacterium glutamicum ATCC13032 or YPI-0216-1 from Example 1 as templates, PCR amplification was performed using primers P7 / P8, P9 / P10, and P11 / P12, respectively, to obtain a 791bp upstream homologous arm fragment (sequence shown in SEQ ID No. 6), a 1049bp fragment containing the NCgl0216 gene and its promoter (sequence shown in SEQ ID No. 7, where positions 21-120 of SEQ ID No. 7 represent the promoter, positions 121-1029 represent the NCgl0216 gene, and positions 21-1029 represent the NCgl0216 gene expression cassette), or a fragment containing NCgl0216. A38T The gene and its promoter fragment of 1049 bp (sequence shown in SEQ ID No. 8, where positions 21-120 of SEQ ID No. 8 represent the promoter, positions 121-1029 represent the NCgl0216 gene, and positions 21-1029 represent the NCgl0216 gene expression cassette) and downstream homologous arm fragment of 817 bp (sequence shown in SEQ ID No. 9).
[0112] After the PCR reaction, the three fragments amplified from each template were recovered by electrophoresis using a column DNA gel extraction kit. The three recovered fragments were ligated with the pK18mobsacB vector (containing kanamycin resistance as a selection marker) purified by Xbal I / BamHI digestion using NEBuilder enzyme (NEB) at 50°C for 30 min. The ligation products, after transformation into DH5α, produced single clones that were then identified by PCR using M13 primers (M13F: 5′-TGT AAA ACG ACG GCC AGT-3′, M13R: 5′-CAG GAA ACA GCT ATG ACC-3′) to obtain positive integrating vectors (recombinant vectors), namely pK18-NCgl0216OE and pK18-NCgl0216. A38T OE, the positive integration vector, contains a kanamycin resistance marker, and recombinants integrated into the genome can be obtained through kanamycin screening.
[0113] The correctly sequenced integration vectors (pK18-NCgl0216OE, pK18-NCgl0216) were used. A38TOE) was used to electroporate *Corynebacterium glutamicum* CGMCC 20437 and ATCC13032, respectively, and cultured in culture media (see Table 1 for culture medium composition). Single colonies were identified by PCR using primers P13 / P14. Strains amplified with a 1393 bp fragment were considered positive strains; those without amplification were considered the original strains. Positive strains were cultured on 15% sucrose medium, and single colonies were further identified by PCR using primers P15 / P16. Strains amplified with a 1816 bp fragment were identified as NCgl0216 or NCgl0216. A38T Positive strains whose genes were integrated into the genome of the target strain were named YPI-0216-3 (without mutation point) and YPI-0216-4 (with mutation point) as the starting strain of Corynebacterium glutamicum CGMCC 20437, respectively; and YPI-0216-5 (without mutation point) and YPI-0216-6 (with mutation point) as the starting strain of Corynebacterium glutamicum ATCC13032, respectively.
[0114] Recombinant bacteria YPI-0216-3 and YPI-0216-5 contain double copies of the NCgl0216 gene expression cassette. Specifically, recombinant bacteria YPI-0216-3 and YPI-0216-5 were obtained by inserting the NCgl0216 gene expression cassette (positions 21-1029 of SEQ ID No. 7) into the upper poxB site of the genomes of Corynebacterium glutamicum CGMCC 20437 and ATCC13032, respectively, while keeping other nucleotides in the genomes of Corynebacterium glutamicum CGMCC 20437 and ATCC13032 unchanged. Recombinant bacteria containing double copies of the NCgl0216 gene can significantly and stably increase the expression level of the NCgl0216 gene.
[0115] The recombinant strains YPI-0216-4 and YPI-0216-6 contain the mutated NCgl0216 shown in SEQ ID No. 3. A38T Specifically, the recombinant bacteria YPI-0216-4 and YPI-0216-6 are formed by inserting the NCgl0216 gene into the poxB site in the genomes of Corynebacterium glutamicum CGMCC 20437 and ATCC13032. A38T The recombinant bacteria were obtained by keeping other nucleotides in the genomes of Corynebacterium glutamicum CGMCC 20437 and ATCC13032 unchanged (SEQ ID No. 8, positions 21-1029).
[0116] The PCR identification primers are shown below:
[0117] P13: 5′-GCCAGAAAT GGTTGCGTGA-3′,
[0118] P14: 5′-GAGACGATTG AGTGTCTCAC-3′,
[0119] P15: 5′-GTGCATTAAG TACGGGCTTT-3′,
[0120] P16: 5′-TCAAACGTAA TGCGGATCA-3′.
[0121] Example 4: Constructing a vector to overexpress the NCgl0216 gene or NCgl0216 A38T engineered strains of genes
[0122] Vectors were constructed using NEBuilder recombination technology. Based on the genome sequence of Corynebacterium glutamicum ATCC13032 published by NCBI, a pair of amplified NCgl0216 and NCgl0216 vectors were designed and synthesized. A38T Primers for the gene coding region and promoter region were designed as follows (synthesized by Invitrogen Shanghai):
[0123] P17: 5′- GCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCC TATTTTAATA GGTGGAAG CG-3′ (The underlined nucleotide sequence is the sequence on pXMJ19)
[0124] P18: 5′- ATCAGGCTGAAAATCTTCTCTCATCCGCCAAAAC CTAACGAGAG TTTGCCCTG-3′ (The underlined nucleotide sequence is the sequence on pXMJ19).
[0125] Construction method: Using the genomes of Corynebacterium glutamicum ATCC13032 and YPI-0216-1 from Example 1 as templates, PCR amplification was performed using primers P17 / P18 to obtain fragments containing the NCgl0216 gene and its promoter (sequence shown in SEQ ID No. 10) and fragments containing NCgl0216. A38TThe gene and its promoter fragment (sequence shown in SEQ ID No. 11) was 1079 bp. The amplified product was subjected to electrophoresis and purified using a column DNA gel extraction kit. The recovered DNA fragment was ligated with the shuttle vector pXMJ19 (BioVector, which contains chloramphenicol resistance as a selection marker) recovered by EcoRI / KpnI digestion using NEBuilder enzyme (NEB) at 50℃ for 30 min. The ligation product was transformed into DH5α and the resulting single clones were identified by PCR using M13R(-48)(5′-AGCGGATAAC AATTTCACAC AGGA-3′) / P18 primers to obtain the correct positive overexpression vectors pXMJ19-NCgl0216 (containing the NCgl0216 gene) and pXMJ19-NCgl0216. A38T (Contains NCgl0216) A38T The vector (containing a chloramphenicol resistance marker) was sent for sequencing. Because the vector contains a chloramphenicol resistance marker, chloramphenicol can be used to screen whether the vector has been transformed into a bacterial strain. pXMJ19-NCgl0216 is a recombinant vector obtained by inserting the NCgl0216 gene expression cassette shown in positions 37-1045 of SEQ ID No. 10 into the pXMJ19 vector. A38T To insert NCgl0216, represented by positions 37-1045 of SEQ ID No. 11, into the pXMJ19 vector. A38T Recombinant vectors obtained from gene expression cassettes.
[0126] pXMJ19-NCgl0216 and pXMJ19-NCgl0216 were correctly sequenced. A38T The vectors were electroporated into Corynebacterium glutamicum CGMCC 20437 and ATCC13032, respectively, and cultured in culture media (the composition of which is shown in Table 1). Single colonies produced by culture were identified by PCR using primers M13R(-48)(5′-AGCGGATAAC AATTTCACAC AGGA-3′) / P18. Strains amplified by PCR containing a 593bp fragment were considered positive strains. The modified strains obtained from Corynebacterium glutamicum CGMCC 20437 were named YPI-0216-7 (without mutation point) and YPI-0216-8 (with mutation point); the modified strains obtained from Corynebacterium glutamicum ATCC13032 were named YPI-0216-9 (without mutation point) and YPI-0216-10 (with mutation point).
[0127] The recombinant bacteria YPI-0216-7 and YPI-0216-9 were obtained by introducing the recombinant vector pXMJ19-NCgl0216 into Corynebacterium glutamicum CGMCC 20437 and ATCC13032, respectively. Both contain the NCgl0216 gene and its promoter (i.e., the NCgl0216 gene expression cassette).
[0128] Recombinant bacteria YPI-0216-8 and YPI-0216-10 are respectively derived from the recombinant vector pXMJ19-NCgl0216. A38T The recombinant bacteria obtained by introducing Corynebacterium glutamicum CGMCC 20437 and ATCC13032 both contained NCgl0216. A38T Gene and its promoter (i.e., NCgl0216) A38T Gene expression cassettes.
[0129] Example 5: Constructing an engineered strain with the NCgl0216 gene deleted from its genome.
[0130] Vectors were constructed using NEBuilder recombination technology. Based on the genome sequence of Corynebacterium glutamicum ATCC13032 published by NCBI, two pairs of primers were synthesized to amplify the segments at both ends of the coding region of the NCgl0216 gene, serving as upstream and downstream homologous arms. The primers were designed as follows (synthesized by Invitrogen Shanghai):
[0131] P19: 5′- CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAG CATA TCCGGGTACC GATTAG-3′,
[0132] P20:
[0133] P21:
[0134] P22: 5′- CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCC GGAAATCTTC TACGAAGCAG-3′.
[0135] Construction method: Using the genome of Corynebacterium glutamicum ATCC13032 as a template, PCR amplification was performed using primers P19 / P20 and P21 / P22, respectively, to obtain an 848bp upstream homologous arm fragment of NCgl0216 and a 658bp downstream homologous arm fragment of NCgl0216.
[0136] The amplified products were subjected to electrophoresis and purified using a column-based DNA gel extraction kit. The recovered DNA fragments were ligated with the pK18mobsacB vector (containing kanamycin resistance as a selection marker) purified by Xbal I / BamHI digestion using NEBuilder enzyme (NEB) at 50°C for 30 min. The single clones grown after transformation were identified by PCR using M13 primers to obtain the positive knockout vector pK18-ΔNCgl0216. This recombinant vector pK18-ΔNCgl0216 contains 1564 bp of up-down DNA of ΔNCgl0216 (sequence shown in SEQ ID No. 12).
[0137] The vector was sent for sequencing. The correctly sequenced knockout vector pK18-ΔNCgl0216 was electroporated into Corynebacterium glutamicum CGMCC 20437 and Corynebacterium glutamicum ATCC 13032, respectively, and cultured in culture medium (the composition of which is shown in Table 1). Single colonies produced were identified by PCR using the following primers (synthesized by Invitrogen Shanghai):
[0138] P23: 5′-CATA TCCGGGTACC GATTAG-3′,
[0139] P24: 5′-GGAAATCTTCTACGAAGCAG-3′.
[0140] The strains that simultaneously amplified bands of 1392 bp and 2401 bp were identified as positive strains by the PCR, while the strains that amplified only the 2401 bp band were identified as the original strain. After screening on 15% sucrose medium, the positive strains were cultured on media containing and without kanamycin. Strains that grew on the kanamycin-free medium but not on the kanamycin-containing medium were further identified by PCR using primers P23 / P24. Strains amplifying a 1392 bp band were identified as positive strains with the NCgl0216 gene coding region knocked out. The NCgl0216 fragment of the positive strain was amplified again by PCR using primers P23 / P24 and sequenced. The strains with correct sequencing were named YPI-0216-011 (NCgl0216 gene knocked out in the genome of Corynebacterium glutamicum CGMCC20437) and YPI-0216-012 (NCgl0216 gene knocked out in the genome of Corynebacterium glutamicum ATCC 13032).
[0141] Example 6: L-Isoleucine Fermentation Experiment
[0142] The strains constructed in the above examples, along with the original strains *Corynebacterium glutamicum* CGMCC 20437 and *Corynebacterium glutamicum* ATCC 13032, were validated using shake-flask fermentation. The specific culture media are shown below, and each strain was replicated three times. The results are shown in Table 3.
[0143] Slant culture: The -80℃ preserved strain was streaked onto the activated slant (see Table 1 for culture medium composition), incubated at 30℃ for 24 h, and passaged once;
[0144] Shake flask seed culture: Use an inoculation loop to scrape a loop of slanted seeds and inoculate them into a 500 mL Erlenmeyer flask containing 30 mL of seed culture medium (see Table 1 for the composition of the culture medium, excluding agar powder). Seal the flask with nine layers of gauze and incubate at 37℃ and 200 rpm for 7-10 h.
[0145] Shake-flask fermentation: Inoculate 10-15% of the seed culture volume into a 500mL Erlenmeyer flask containing fermentation medium (final volume 30mL), seal with nine layers of gauze, and culture at 37℃ with shaking at 200r / min. During fermentation, maintain pH at 7.0-7.2 by adding ammonia water; add 60% (m / v) glucose solution to maintain fermentation; fermentation cycle 24h.
[0146] Table 2. Shake flask fermentation medium formulation (the rest is water)
[0147] Reagent Name Concentration (g / L) glucose 30 yeast powder 15 Polypeptone 15 ammonium sulfate 5 urea 3 <![CDATA[KH2P04]]> 6 <![CDATA[K2HPO4]]> 5 Magnesium sulfate 0.2 Calcium pantothenate 0.6 Biotin 0.5 VB1 0.5 pH 6.8-7.2
[0148] The results are shown in Table 3. The NCgl0216 gene was mutated to NCgl0216. A38T The gene can increase the production of L-isoleucine. In Corynebacterium glutamicum, the NCgl0216 gene and NCgl0216... A38T Gene overexpression also helps increase L-isoleucine production, while knocking out the NCgl0216 gene is not conducive to the accumulation of L-isoleucine.
[0149] Table 3. Results of L-Isoleucine Fermentation Experiment
[0150]
[0151] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.
Claims
1. Protein, as shown in A1) or A2): A1) A protein with the amino acid sequence shown in SEQ ID No. 4; A2) is a fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of A1).
2. Biological materials, comprising any one of the following: B1) to B4): B1) A nucleic acid molecule encoding the protein of claim 1; B2) An expression cassette containing the nucleic acid molecule described in B1); B3) A recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3).
3. The biomaterial according to claim 2, characterized in that: B1) The nucleic acid molecule described herein contains the following b11) or b12): b11) A DNA molecule containing the coding sequence shown in SEQ ID No. 3; The nucleotide sequences defined by b12) and b11) have 75% or more identity and encode the DNA molecule of the protein.
4. The biomaterial according to claim 3, characterized in that: b11) contains the DNA molecule shown in SEQ ID No.
3.
5. The biomaterial according to any one of claims 2-4, characterized in that: The microorganisms mentioned are bacteria.
6. The biomaterial according to claim 5, characterized in that, The bacteria in question is Corynebacterium glutamicum.
7. A method for producing isoleucine, including X1) or X2): X1) Replace the coding gene of the protein shown in SEQ ID No. 2 in the starting bacteria with the coding gene of the protein shown in SEQ ID No. 4 to obtain recombinant bacteria; culture the recombinant bacteria to obtain isoleucine; X2) Express the protein of claim 1 in the starting organism cells, or increase the content or activity of the protein of claim 1 in the starting organism cells to obtain recombinant organism cells; culture the recombinant organism cells to obtain isoleucine; The starting biological cells are bacteria, algae, fungi, plant cells, or animal cells that can synthesize isoleucine.
8. The method according to claim 7, characterized in that: The fungus is yeast.
9. The method according to claim 7, characterized in that: The originating bacteria are bacteria.
10. The method according to claim 7 or 9, characterized in that: The bacteria in question is Corynebacterium glutamicum.
11. The use of the protein of claim 1 or any of the biomaterials of claims 2-6 in the production of isoleucine, or in the preparation of products for the production of isoleucine.
Citation Information
Patent Citations
L-isoleucine producing recombinant strain modified by geneYH66_10325 as well as construction method and application of L-isoleucine producing recombinant strain
CN112592924A
Escherichia coli flagellum specific ATP synthetase gene fliI and application of mutant thereof in production of L-amino acid
CN115975957A