A strain of Bacillus erythrophorus and its application in controlling apple continuous cropping obstacles
By using Bacillus erythropoietinus KF-B6 to rapidly and efficiently produce EPS and decompose macromolecules, the problems of soil improvement and disease control in apple continuous cropping obstacles have been solved, achieving a comprehensive effect of soil structure stability and plant growth promotion.
Patent Information
- Application Number
- CN202411939103.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-26
- Publication Date
- 2025-11-14
- Estimated Expiration
- 2044-12-26
AI Technical Summary
Existing technologies have limited effectiveness in controlling continuous cropping obstacles in apples. They cannot effectively inhibit fungal diseases, nor can they rapidly increase soil water-stable aggregates. They also cannot simultaneously improve soil structure and increase organic matter, and lack nutrient conversion functions.
Using Bacillus erythropoietinus KF-B6, soil structure is improved through rapid and high production of extracellular polysaccharides (EPS), water-soluble and volatile antibacterial substances are produced to inhibit pathogens, decompose macromolecular organic matter and produce chitinase to degrade the cell wall of pathogens, while promoting plant growth.
It achieved comprehensive prevention and control of continuous cropping obstacles in apple orchards, improved soil stability and organic matter content, enhanced plant growth, significantly reduced pathogen activity, and promoted the restoration of the soil microbial ecosystem in apple orchards.
Smart Images

Figure CN119709523B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of agricultural microbial technology, and in particular to a multifunctional strain of Bacillus erythropoietinus KF-B6 that combines soil improvement, multi-mechanism efficient biocontrol, and decomposition of macromolecular organic matter for nutrient conversion, and its application, especially in the control of continuous cropping obstacles in apples. Background Technology
[0002] With the overall restructuring of the apple industry, the rise of new apple varieties such as Ruixianghong, Ruiyang, and Ruixue has driven a new round of development in the industry. Therefore, replacing old orchards with new varieties has become a new opportunity. In my country's main apple-producing areas, especially Shandong, Shaanxi, and Gansu, most orchards are over 30 years old. However, due to limited land resources, the renovation and renewal of aging orchards can only be achieved through continuous cropping. This leads to abnormal root development, stunted growth, weakened growth, reduced resistance, shortened lifespan, and even death in replanted apple saplings. This phenomenon is called apple continuous cropping obstacle, also known as apple replanting disease.
[0003] Many factors contribute to continuous cropping obstacles in apple orchards, primarily including the deterioration of soil physical and chemical properties, resulting in damaged soil aggregate structure, soil compaction, and poor aeration, all of which negatively impact the root growth of newly planted saplings. Other contributing factors include soil microbial imbalance, reduced beneficial bacteria, limited decomposition of soil organic matter, and low soil organic matter content. Furthermore, an increase in the number of pathogenic fungi, especially *Fusarium oxysporum*, *Fusarium solani*, and *Fusarium moniliforme*, which infect roots, particularly apple seedlings, causing stem rot and other diseases, leading to low survival rates of newly planted saplings when replacing with new varieties. Therefore, the apple industry urgently needs to address the problems of low survival rates, weak growth, and severe continuous cropping obstacles in the transformation of aging orchards.
[0004] Chinese patent CN202011124878.8 discloses a strain of *Bacillus amyloliquefaciens* and its application in controlling apple replanting obstacles. This strain exhibits inhibitory effects against various pathogens, particularly showing strong antagonistic effects against *Fusarium oxysporum*, *Fusarium verticillatum*, *Fusarium solani*, and *Fusarium solani*, which cause apple replanting obstacles. This strain can also promote the growth of both the above-ground and underground parts of apple seedlings in replanted apple orchards; increase the bacterial content in the soil and the bacterial-to-fungal ratio; and increase the activities of soil urease, phosphatase, sucrase, and catalase in soils affected by apple replanting obstacles. Therefore, it can be used to control apple replanting obstacles. Chinese patent CN202310488273.4 discloses a strain of Bacillus polymyxa GRY-11, which has antagonistic effects on Fusarium oxysporum, Fusarium moniliforme, Fusarium flocculation, and Fusarium solani, which cause continuous cropping obstacles in apples. This strain can increase the number of soil bacteria, reduce the number of pathogens, and promote plant growth; increase the activity of soil enzymes and the protective enzyme activity of apple seedling roots in soils with continuous apple cropping; reduce the content of phenolic acid in the soil; and effectively alleviate continuous cropping obstacles in apples.
[0005] The aforementioned patents mainly address apple replanting obstacles by generating water-soluble antibacterial substances to antagonize the growth of pathogenic fungi, increase the bacterial content in the soil, degrade phenolic acid autotoxic substances, and enhance soil enzyme activity. However, the antibacterial mechanism and performance are limited, and the patents cannot achieve the effects of improving soil structure stability or increasing organic matter content.
[0006] Functional bacterial strains that only produce water-soluble antibacterial substances to inhibit the growth of pathogens generally have low antibacterial rates and unstable effects. Therefore, strains with multiple antibacterial mechanisms are the guarantee of preventive efficacy.
[0007] Soil with stable structure, looseness, good air permeability and water retention, and high organic matter and humus content is not only conducive to the reproduction of beneficial microorganisms but also promotes root growth. Therefore, while preventing and controlling apple continuous cropping obstacles and pathogenic fungi, it is also crucial to focus on orchard soil improvement.
[0008] It is a current research consensus that microorganisms producing extracellular polysaccharides (EPS) can improve soil, regulate plant growth, and induce plant stress resistance. Therefore, obtaining high-EPS-producing strains is an effective way to improve soil. However, the current problem is that the EPS yield of general strains is not high or the EPS production time is long. Soil water-stable aggregates form slowly and have unstable structures. Therefore, if strains that not only produce high EPS yields but also produce EPS rapidly can be obtained, the effect of soil improvement will be greatly improved.
[0009] In summary, there is an urgent need to screen functional bacterial strains and agents that can comprehensively and effectively prevent and control apple continuous cropping obstacles. Chinese Patent CN202011579100.6 discloses a Bacillus erythropoietin-producing strain HD and its applications. The antimicrobial peptides produced by the fermentation method of this invention have good stability and a broad antimicrobial spectrum. The resulting product is used in biological control fields such as food preservation and antibiotic-free livestock and poultry farming. Chinese Patent CN201810202641.3 discloses a bacteriocin-producing Bacillus erythropoietin strain NPUST-1, which can promote the growth and immune response of aquatic organisms.
[0010] The aforementioned inventions all demonstrate that *Bacillus erinaceus* exhibits strong antibacterial activity and can produce antimicrobial peptides, bacteriocins, and other antimicrobial substances. However, most existing technologies are geared towards aquaculture or livestock farming, and the disclosed strains have limited functions. They lack the ability to produce high levels of EPS (explosive peroxide), volatile antimicrobial substances, and chitinase to degrade pathogenic fungal hyphae. They also lack nutritional conversion functions such as decomposing macromolecular organic matter like cellulose, protein, and starch, as well as nitrogen-fixing and growth-promoting functions. Furthermore, they do not involve the agricultural field. Therefore, there are currently no reports on *Bacillus erinaceus* for controlling apple continuous cropping obstacles. Summary of the Invention
[0011] Therefore, the technical problem to be solved by the present invention is to overcome the shortcomings of existing agricultural functional strains, such as limited functions, inability to effectively inhibit fungal diseases through multiple mechanisms, inability to simultaneously increase soil water stability aggregates to improve soil and increase soil organic matter, and lack of nutrient conversion and growth promotion functions. The present invention provides a strain of Bacillus erythropoietinus with soil improvement, multi-mechanism efficient biocontrol, growth promotion and nutrient conversion functions, as well as its microbial agents and compound microbial fertilizers for the prevention and control of apple continuous cropping obstacles.
[0012] To achieve the above objectives, the present invention provides the following technical solution:
[0013] One of the technical solutions provided by this invention is a type of *Bacillus erythropoietinus*, specifically *Bacillus erythropoietinus* (…). Paenibacillus ehimensis KF-B6, with accession number CGMCC No.32131.
[0014] The Ehime-like Bacillus provided by this invention ( Paenibacillus ehimensis KF-B6 was deposited on September 30, 2024, at the China General Microbiological Culture Collection Center. Address of the depository: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.
[0015] The second technical solution provided by this invention is the application of Bacillus erythropoietinus KF-B6 as described in the first technical solution, particularly in the field of agricultural microbiology, and even more specifically in the prevention and control of continuous cropping obstacles in apples.
[0016] Furthermore, it is used in the suppression of pathogens; the pathogens include the main pathogens of apple continuous cropping obstacles and other pathogens of diseases, such as Fusarium oxysporum, Fusarium solani, Fusarium moniliforme, apple black rot, Alternaria alternata, Staphylococcus berengeri, Alternaria solanaceus, Pyrrosia lingua, and Helicobacter pylori, etc.
[0017] Furthermore, it is used in the production of chitinase; chitinase decomposes the hyphae of the original fungus, causing phenomena such as hyphae breakage, hollowing, and exudation in the cell wall, and also has a destructive effect on the spores of the pathogen, reducing or eliminating their activity.
[0018] Furthermore, it has applications in EPS production and promoting soil aggregate formation; KF-B6 bacteria can produce EPS and rapidly promote the formation of water-stable soil aggregates with strong stability.
[0019] Furthermore, it has applications in the decomposition of macromolecular organic matter; KF-B6 can decompose macromolecular organic matter such as starch, cellulose, protein and fat, balance the quantity and types of small molecule organic nutrients in the soil, facilitate plant absorption and utilization, and promote crop growth.
[0020] Furthermore, it has applications in producing IAA and promoting plant growth.
[0021] Beneficial effects:
[0022] The *Bacillus erythropoietinus* KF-B6 provided by this invention possesses rapid and high EPS (explosive permeable) production capabilities. It increases soil water-stable aggregates and reduces soil bulk density, thereby improving soil stability and structure, thus achieving soil improvement. It produces water-soluble and volatile antibacterial substances and produces high-yield chitinase to directly degrade chitin in fungal cell walls, causing mycelial stunting, breakage, hollowing, or even complete dissolution, rendering the pathogen inactive. These multiple biocontrol mechanisms ensure comprehensive biocontrol effects. This bacterium also possesses nutrient conversion functions such as decomposing cellulose, protein, starch, and fat, as well as growth-promoting functions, making it a multifunctional strain. The application of this bacterium and its microbial agents and compound microbial fertilizers can effectively increase the number of rhizosphere soil bacteria, reduce the number of pathogenic fungi, increase the ratio of bacteria to fungi, and promote the restoration of the soil microbial ecosystem in apple orchards with continuous cropping obstacles; increase the proportion of water-stable aggregates, increase soil organic matter content and increase soil enzyme activity, and improve the soil; improve the survival rate of saplings planted during the renewal of new varieties in old orchards with continuous cropping obstacles, promote root vitality and plant growth, and comprehensively alleviate and prevent apple continuous cropping obstacles, thus meeting the needs of the agricultural industry, especially the apple industry.
[0023] (1) The Bacillus erythropoietinus KF-B6 provided by this invention is a strain with high safety. It can rapidly produce extracellular polysaccharides (EPS). It can start producing EPS in 6 hours. The viscosity of the fermentation broth increases significantly after 16 hours, and the yield reaches 978.41 μg / mL. The highest yield of 4307.39 μg / mL can be reached after 24 hours. The yield is stable after 24 hours. It is the strain that produces EPS the fastest and with the highest yield reported so far.
[0024] Experiments on sandy loam soil treated with EPS-containing fermentation broth showed that after 10 days of cultivation, the proportion of water-stable aggregates (>0.25 mm) in sandy loam soil inoculated with KF-B6 fermentation broth containing EPS was 21.38%, which was 5.4 times that of the sterile water treatment group. After 20 days of cultivation, the proportion of water-stable aggregates reached its maximum, at 32.97%, which was 6.6 times that of the sterile water treatment group. The proportion of water-stable aggregates after 30 days of cultivation was not significantly different from that after 20 days, and the aggregate particle size remained stable between 0.25 and 3 mm. This indicates that KF-B6 bacteria and the EPS they produce can rapidly promote the formation of water-stable aggregates in the soil, and these aggregates exhibit strong stability.
[0025] (2) Bacillus erythropoietinus KF-B6 produces water-soluble antibacterial substances that inhibit the growth of pathogens. The antibacterial rate against Fusarium oxysporum, Fusarium solani, and Fusarium moniliforme, which cause continuous cropping obstacles in apples, is as high as 82.66%, 83.81%, and 78.49%, respectively. At the same time, KF-B6 also produces volatile antibacterial substances, with antibacterial rates against the above three pathogens of 91.11%, 87.78%, and 86.67%, respectively, showing extremely significant antibacterial effects.
[0026] Bacillus erythrophorus KF-B6 is a broad-spectrum biocontrol strain that exhibits good antagonistic effects against other apple pathogens such as *Alternaria lobata* (apple tree rot), *Alternaria alternata* (apple leaf spot), and *Botrytis cinerea* (apple ring rot), as well as pathogens of vegetables and field crops such as *Alternaria solanacea* (tomato early blight), *Pyrrosia oryzae* (rice blast), and *Helicobacter pylori* (corn leaf spot). The inhibition rate is 59.84%-82.54%.
[0027] (3) Bacillus erythrophylloides KF-B6 produces chitinase, which has a strong decomposing effect on the hyphae of the three pathogens. It can degrade the cell walls of the pathogens, causing hyphae to break, become hollow, and split. It can even destroy the spores of the pathogens, reducing or eliminating their activity. Among them, KF-B6 has the strongest decomposing effect on Fusarium oxysporum hyphae. It can completely inactivate the hyphae of the pathogen at 30℃ and 35℃. Compared with CK, KF-B6 can reduce the activity of Fusarium solani by 200-20000 times and Fusarium moniliforme by 1300-12000 times. This shows that KF-B6 not only inhibits the growth of the main pathogens of apple continuous cropping obstacles, Fusarium oxysporum, Fusarium solani, and Fusarium moniliforme, but also decomposes their hyphae and even spores, causing them to lose some or all of their activity, resulting in significant biocontrol effects.
[0028] Bacillus erythropoietinus KF-B6 is a high-yield chitinase-producing strain. Without exogenous chitin or pathogenic hyphae induction, it can produce chitinase at levels of 11.51-13.54 U / mL. Exogenous chitin or pathogenic hyphae can induce even higher chitinase activity. KF-B6 produces high levels of chitinase during the degradation of various pathogenic hyphae, with an enzyme activity as high as 17.88 U / mL during the degradation of Fusarium oxysporum, demonstrating its potential for strong biocontrol effects.
[0029] (4) Bacillus erythropoietinus KF-B6 has the ability to decompose macromolecular organic matter and transform it into nutrients. It can decompose macromolecular organic substances such as starch, cellulose, protein and fat, and convert them into small molecule organic nutrients such as sugars, amino acids, small peptides and fatty acids. This balances the quantity and type of small molecule organic nutrients in the soil, which is beneficial for plant absorption and utilization and promotes crop growth. At the same time, this bacterium has a certain nitrogen-fixing ability and the ability to produce IAA and other growth-promoting substances, which can increase the supply of nitrogen nutrition to plants and promote plant growth. Attached Figure Description
[0030] Figure 1 The inhibitory effect of KF-B6 on three pathogenic fungi causing apple continuous cropping obstacles was investigated.
[0031] Figure 2 This is the colony morphology of KF-B6.
[0032] Figure 3 It consists of KF-B6 cells and spores.
[0033] Figure 4 The KF-B6 hemolysis test was negative.
[0034] Figure 5 The images show the mycelia and spores of three pathogenic fungi, both normal and degraded by KF-B6 (35℃).
[0035] Figure 6Chitinous transparent rings were extracted from KF-B6.
[0036] Figure 7 Chitin removal effect of KF-B6 shake bottle (35℃).
[0037] Figure 8 This refers to the antibacterial ability of KF-B6 volatile antibacterial substance against pathogens.
[0038] Figure 9 The antibacterial effect of KF-B6 against different pathogens.
[0039] Figure 10 This is the standard curve for glucose.
[0040] Figure 11 EPS produced for KF-B6
[0041] Among them, A is EPS precipitated from 95% anhydrous ethanol, and B is EPS-containing bacterial solution produced by KF-B6.
[0042] Figure 12 This refers to the function of KF-B6 bacteria in the decomposition and transformation of macromolecular nutrients.
[0043] Figure 13 Nitrogen fixation by KF-B6 bacteria
[0044] Left: Assumption medium; Right: Silicate bacteria medium.
[0045] Figure 14 KF-B6 promotes the formation of soil water-stable aggregates.
[0046] Figure 15 The effects of KF-B6 compound microbial fertilizer and inoculant treatment on soil enzyme activity in apple-continuous cropping soil. Detailed Implementation
[0047] The following embodiments are provided to better understand the present invention and are not limited to the preferred embodiments described. They do not constitute a limitation on the content and scope of protection of the present invention. Any product that is the same as or similar to the present invention, derived by any person under the guidance of the present invention or by combining the features of the present invention with other prior art, falls within the protection scope of the present invention.
[0048] Where specific experimental steps or conditions are not specified in the embodiments, they can be performed according to the conventional experimental steps or conditions described in the literature in this field. All raw materials or instruments used are commercially available conventional products, including but not limited to those used in the embodiments of this application.
[0049] The following are some of the culture media involved in the embodiments of the present invention:
[0050] The liquid culture medium A for EPS production consists of: 20g sucrose, 2g corn steep liquor powder, 2g CaCO3, 1g K2HPO4·3H2O, 0.5g MgSO4·7H2O, 0.5g MnSO4·H2O, 1L distilled water, and pH 7.25.
[0051] Liquid culture medium B consists of: 5g yeast extract, 5g soybean meal powder, 1g K2HPO4·3H2O, and MnSO4. . 0.5g H2O, 0.6g NaCl, MgSO4 . 0.4g 7H2O, 0.2g KCl, 1L distilled water, pH at room temperature.
[0052] The liquid culture medium C consists of: 5g yeast extract, 5g soybean meal powder, 1g K2HPO4·3H2O, and MnSO4. . 0.5g H2O, 0.6g NaCl, MgSO4 . 0.4g 7H2O, 0.2g KCl, 1g sucrose, 2g CaCO3, 1L distilled water, pH natural.
[0053] The NA medium consisted of: 10.0g peptone, 3.0g beef meal, 5.0g NaCl, 1L distilled water, and pH 7.0-7.2.
[0054] The composition of Gao's No. 1 culture medium is: 20g soluble starch, 0.5g NaCl, 1g KNO3, and K2HPO4. . 0.5g of 3H₂O and MgSO₄ . 0.5g of 7H₂O and FeSO₄ . 0.01g 7H2O, 20g agar, 1L distilled water, pH 7.2-7.4.
[0055] The present invention will be further explained and illustrated below through specific embodiments.
[0056] Example 1 Screening of strains
[0057] 1. Primary screening: Screening of EPS-producing bacteria
[0058] Take a dry and clean 500mL Erlenmeyer flask, pour in 10.0g of accurately weighed rhizosphere soil from healthy apple orchards suffering from continuous cropping obstacles, add 100mL of ddH2O to prepare a bacterial suspension, mix well, add a small amount of glass beads and shake, and serially dilute 10 times. 2 10 3 10 4 10 5In addition, 100 μL of the above soil extracts were evenly spread on Gao's No. 1 medium plates, with 3 replicates for each gradient. The plates were incubated in a constant temperature incubator at 37℃ for 3-5 days. Single colonies were picked with sterile bamboo sticks, and strains with moist surfaces and high viscosity were selected. The strains that produced EPS were initially screened and numbered KF-B2, KF-B3, KF-B6, and KF-B10 (see Table 1). After purification, the glycerol tubes were stored.
[0059] Table 1 Different strains producing EPS
[0060]
[0061] Note: The more plus signs (+), the longer the string length and the higher the viscosity.
[0062] 2. Secondary screening: Bacteria that produce EPS and also have inhibitory effects on apple continuous cropping obstacle pathogens.
[0063] The antagonistic effects of four strains (KF-B2, KF-B3, KF-B6, and KF-B10) obtained from initial screening against the main pathogens causing continuous cropping obstacles in apples—*Fusarium oxysporum*, *Fusarium solani*, and *Fusarium moniliforme*—were determined using the plate confrontation method. The preserved strains were activated by incubating on NA medium at 37°C for 48 hours. Five-mm diameter mycelial cakes of the three pathogens were inoculated into the center of NA medium plates, with functional bacteria inoculated at three points 25mm from the center as the treatment group; plates inoculated only with pathogen mycelial cakes without functional bacteria served as the control group. All plates were incubated at 28°C for 7 days (results are shown below). Figure 1 As shown in the figure, the colony radius of the pathogen is measured to calculate the inhibition rate of each bacterium against the pathogen.
[0064] Inhibition rate = (Control colony radius - Treated colony radius) / Control colony radius × 100%.
[0065] The three pathogen strains used in this patent were all isolated from apple orchards with continuous cropping obstacles and are preserved at the Mumeituli Ecological Agriculture Co., Ltd. strain preservation center.
[0066] Table 2. Inhibition rates of the four bacterial strains against the pathogen.
[0067]
[0068] Note: Data in the table are mean ± standard error. Lowercase letters after the data indicate that the results have been verified by Duncan's new multiple range test. P The difference was statistically significant at levels <0.05. The same applies below.
[0069] It was found that among the four strains, KF-B6 exhibited a higher inhibition rate against the three pathogens than the other three functional strains, with an inhibition rate as high as 78.49-83.81% and an antagonism coefficient of grade I. This also indicates that the bacterium possesses broad-spectrum antibacterial activity against apple continuous cropping obstacle pathogens. Therefore, through primary and secondary screening, the KF-B6 strain, which has EPS production capacity and significant antibacterial activity against the main pathogens of apple continuous cropping obstacle, was finally selected.
[0070] Example 2: Identification of KF-B6 strain
[0071] (1) Morphological identification
[0072] The KF-B6 strain was streaked onto Gao's I and NA media, respectively, and incubated at 45°C for 72 hours. Single colonies were grown, and the morphological characteristics of the colonies were observed.
[0073] The results are as follows: Figure 2 As shown, the colonies of KF-B6 bacteria on Gao's I medium exhibit distinct characteristics: they are round, semi-transparent, with a wrinkled, patterned surface, and exhibit strong adhesion to the medium surface, making them difficult to pick up. When picked up, they form strings with high viscosity. On NA medium, the colonies are round, moist, raised, and somewhat sticky.
[0074] Simultaneously, after Gram staining, the bacterial morphology was observed under a microscope, such as... Figure 3 As shown. Gram staining results show that KF-B6 bacteria are Gram-positive, with short rod-shaped cells, and produce spores.
[0075] (2) Physiological and biochemical identification
[0076] Physiological and biochemical identification was performed according to the methods in Bergey's Manual of Bacterial Identification (Second Edition) and the Manual of Systematic Identification of Common Bacteria, with the experiments repeated three times. The physiological and biochemical parameters of strain KF-B6 were detected, and the results are shown in Table 3.
[0077] Table 3 Physiological and biochemical characteristics of KF-B6 strain
[0078]
[0079] Note: "+" indicates a positive reaction or is available; "-" indicates a negative reaction.
[0080] (3) 16S rDNA sequence analysis and phylogenetic analysis
[0081] KF-B6 was inoculated into LB liquid medium and cultured at 45°C with shaking for 1 day until the culture medium became turbid. The bacterial culture was then added to a centrifuge tube (1.5 mL), and the genome was extracted strictly according to the genome extraction kit procedure. Using the extracted DNA genome as a template, PCR reaction was performed to amplify the 16S DNA (16S ribosomal DNA) sequence fragment using 27f / 1492r primers (27f: GAGTTTGATCCTGGCTCAG; 1492r: ACGGCTACCTTGTTACGACTT). The PCR reaction conditions were: 94°C for 5 min, 94°C for 30 s, 55°C for 40 s, 72°C for 1.5 min, 30 cycles, and a final extension at 72°C for 10 min.
[0082] After electrophoresis, the PCR products were excised and recovered (the excising and recovery steps were strictly performed according to the instructions of the full-size gold gel extraction kit). The products were ligated into the pEASY T3 vector, and then transformed into Trans-Top1 competent cells using the heat shock transformation method. White-spot colonies were selected using blue-white screening and added to LB broth containing Amp, incubated at 37°C and 200 rpm for 8–12 h. Positive clones were detected using M13F / M13R primers. Positive clones were sent to BGI Genomics in Beijing for sequencing. The obtained sequences were assembled, proofread, and then analyzed using BLAST in the GeneBank database.
[0083] Results: The 16S rDNA sequence length of KF-B6 was determined to be 1512 bp. NCBI alignment results showed that the 16S rDNA sequence of KF-B6 was consistent with... Paenibacillus ehimensis The similarity of GE17-1 (Sequence ID: KF030787.1) is as high as 99.20%.
[0084] Finally, based on morphological analysis, physiological and biochemical tests, and molecular biological gene sequence comparison, strain KF-B6 was identified as *Bacillus erythropoietinus*. Paenibacillus ehimensis ).
[0085] On September 30, 2024, *Bacillus erythropoietinus* (Ehime-like Bacillus) was included. Paenibacillus ehimensis KF-B6 is deposited at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC No. 32131. The address of the depository is: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.
[0086] The 16S rDNA sequence of KF-B6 is shown below:
[0087]
[0088] Example 3 Safety test of Bacillus erythropoietinus KF-B6
[0089] Experimental method: Activated KF-B6 was inoculated onto blood agar plates, with hemolytic positive bacteria as a control. The plates were incubated at 45℃ for 24-72 hours, and the hemolysis was observed.
[0090] Preparation method of blood agar plate medium: 18g peptone, 1g yeast powder, 5g NaCl, 15g agar, 1L distilled water, pH 7.2-7.4. Sterilize at 121℃ for 30min. After the medium cools to 50℃, add 5% sheep blood, mix well, and pour into agar plates.
[0091] The results are as follows Figure 4 As shown, no hemolytic clear zone appeared around KF-B6 colonies within 24-72 hours, while a hemolytic zone appeared around hemolytic positive bacteria within 24 hours. This indicates that KF-B6 bacteria are not hemolytic and are harmless to humans, livestock, and poultry, and have high application safety.
[0092] Example 4: Functional Study of Bacillus erythropoietinus KF-B6
[0093] 1. Bacillus erythropoietinus KF-B6 degrades the cell wall of pathogens, dissolves hyphae and spores, inactivating them and reducing the number of pathogens.
[0094] (1) Decomposition and destruction of hyphae and spores of the main pathogens of apple continuous cropping obstacles, namely Fusarium oxysporum, Fusarium rotundum and Fusarium moniliforme.
[0095] ① Preparation of seed culture of 3 pathogens: Activated Fusarium oxysporum, Fusarium solani, and Fusarium moniliforme were inoculated into PDA liquid medium and cultured at 30℃ and 200rpm for 18h to obtain seed culture of 3 pathogens;
[0096] ②KF-B6 seed culture preparation: Activated KF-B6 was inoculated into liquid culture medium B and cultured at 40℃ with shaking at 200 rpm for 18 h to obtain KF-B6 seed culture;
[0097] ③ Co-culture: The two seed liquids were treated according to the table below (Table 4), inoculated into liquid culture medium C for co-culture, and cultured at 30℃ and 35℃ with shaking at 200rpm for 40h respectively. The degradation of pathogen mycelium was examined under a microscope, and the viable count of pathogens in each treatment group and the control group was detected. The reduction of pathogen activity was calculated (Table 5).
[0098] The method for preparing the PDA liquid culture medium is as follows: Weigh 200 g of peeled potatoes and cut them into pieces approximately 1 cm thick. 3Small pieces are boiled in an appropriate amount of distilled water for 30 minutes, then filtered through double-layer gauze to extract the juice. 20g of glucose is added, heated to dissolve, and water is added to make up to 1000 mL. The mixture is then dispensed and sterilized at 121℃ for 30 minutes.
[0099] Table 4. Co-culture methods of KF-B6 and pathogens
[0100]
[0101] Microscopic examination results as follows Figure 5 As shown, the details are as follows:
[0102] (1) The mycelia of the three pathogens in group CK were robust and grew well. Figure 5 (35℃), compared with the CK group, after 18 hours of co-culture with KF-B6, the three pathogens in treatments I, II and III began to show degradation of hyphal cell walls. After 40 hours of culture, all three pathogens showed thickened, deformed, broken and hollow hyphae, indicating that KF-B6 produced chitinase that degraded the hyphal cell walls of the pathogens.
[0103] (2) Compared with treatments I, II, and III, the pathogenic mycelia in treatments V, VI, and VII were broken and hollow, and were degraded faster and more thoroughly. At the same time, some pathogenic spores also showed hollowness, indicating that KF-B6 and the chitinase it produces can not only degrade pathogenic mycelia, but also destroy pathogenic spores, reducing or eliminating their activity. Figure 5 ).
[0104] Table 5 shows the bacterial viability of pathogens in each treatment group and the control group. As can be seen from Table 5, under different temperatures and co-culture methods, KF-B6 exhibits strong degradative activity against the mycelia of all three pathogens, rendering them partially or completely inactive. KF-B6 showed the strongest degradative effect against *Fusarium oxysporum* mycelia, completely inactivating them at both 30 and 35℃. Compared with the control group (CK), the activity of *Fusarium solani* was reduced by 200-20000 times, and the activity of *Fusarium moniliforme* was reduced by 1300-12000 times. This indicates that KF-B6 not only inhibits the growth of the main pathogens causing apple continuous cropping obstacles—*Fusarium oxysporum*, *Fusarium solani*, and *Fusarium moniliforme*—but also degrades their mycelia and even spores, rendering them partially or completely inactive, demonstrating significant biocontrol effects.
[0105] Table 5. Bacterial viability of pathogens under different treatments
[0106]
[0107] 2. Chitin decomposition by Bacillus erythropoietin KF-B6 (qualitative detection)
[0108] (1) Chitin-degrading plate clear zone method: Use a sterile bamboo stick to inoculate activated KF-B6 bacteria onto chitin-degrading plate culture medium, and incubate in constant temperature incubators at 28℃, 37℃ and 45℃ for 48h. The results show clear zones of chitin decomposition ( Figure 6 ).
[0109] The chitin-dissolving agar medium consisted of: 0.7 g K₂HPO₄·3H₂O, MgSO₄ . 0.5g of 7H₂O and ZnSO₄ . 0.001g 7H2O, 0.5g KH2PO4, 0.01g FeSO4, 40mL colloidal chitin, add distilled water to 1L, and adjust the pH to 7.3-7.5 with 40% NaOH.
[0110] (2) Chitin decomposition method by shaking flask: Activated KF-B6 bacteria were inoculated into liquid culture medium B using sterile bamboo sticks and incubated at 40℃ and 200rpm for 18h to obtain seed culture; the seed culture was inoculated into chitin shaking flask culture medium at an inoculation rate of 1% and incubated at 30℃, 35℃, and 40℃ and 200rpm for 40h respectively; chitin shaking flask culture medium without seed culture was used as a control, and the changes in the amount of chitin in the control and KF-B6 inoculated chitin shaking flask culture medium were observed. Results showed that the chitin particles in the shaking flasks inoculated with KF-B6 bacteria were completely decomposed ( Figure 7 (35℃).
[0111] The chitin-based shake flask culture medium has the following composition: 10g peptone, 0.7g K₂HPO₄·3H₂O, and MgSO₄. . 0.5g of 7H₂O, ZnSO₄ . 0.001g of 7H2O, 0.3g of KH2PO4, 40mL of colloidal chitin, pH adjusted to 7.3 with 40% NaOH.
[0112] The above-mentioned method for preparing colloidal chitin is as follows: 5g of chitin is dissolved in 200mL of concentrated hydrochloric acid pre-cooled at 4℃, stirred on a magnetic stirrer for 2 hours, and allowed to stand at 4℃ for 24 hours; the above substance is added to 1000mL of 95% ethanol pre-cooled at 4℃, stirred for 2 hours, and left to stand at room temperature overnight. The supernatant is discarded, and the white precipitate at the bottom is centrifuged at 4000 rpm for 20 minutes. The precipitate is collected and dissolved in 100mL of distilled water to form a colloidal state, thus obtaining colloidal chitin with a chitin content of 5%.
[0113] 3. Detection of chitinase activity produced by Bacillus erythropoietinus KF-B6
[0114] The fermentation broth of KF-B6 CK group in Table 4, the mixed fermentation broth of KF-B6 and pathogen co-culture under different treatments I-VII, and the fermentation broth of the above chitin shake flask culture medium were filtered with a 0.22 μm microporous membrane to obtain sterile filtrate. The sterile filtrate was added to perforated chitin-degrading petri dishes and placed at 37℃ for 24 h. The results showed that clear zones of degraded chitin appeared in all cases, indicating that the filtrates of different treatments contained chitinase.
[0115] Sterile filtrates from different experimental treatments were appropriately diluted. The chitinase activity in the diluted solutions was determined using a chitinase reagent kit from Shanghai Fenxi Biotechnology Co., Ltd. The chitinase activity in the original solution was calculated by multiplying the result by the dilution factor. The chitinase standard curve was calculated as y = 18.457x - 1.1636 (where x is the OD value). 450 (y represents chitinase activity in U / L), standard curve R 2 =0.9956, indicating a good linear relationship.
[0116] The results are shown in Table 6:
[0117] (1) The chitinase activity in the sterile filtrate of KF-B6 CK group was 11.51-13.54 U / mL, indicating that Bacillus erythrozoata KF-B6 can produce chitinase in the absence of exogenous chitin or pathogen hyphae.
[0118] (2) The chitinase activity of the fermentation broth in the chitin shake flask culture medium was 13.71-17.40 U / mL, which was higher than that of the CK group, indicating that exogenous chitin induced KF-B6 to produce chitinase with higher activity.
[0119] (3) The chitinase activity in the sterile filtrate of treatments I to VII was higher than that in the KF-B6 CK group, indicating that the pathogen hyphae became exogenous chitin, which could induce KB-B6 to produce more chitinase, and the enzyme activity was the highest during the degradation of Fusarium oxysporum, reaching 17.88 U / mL.
[0120] (4) KF-B6 is a strain that produces a high amount of chitinase, which can efficiently degrade pathogen hyphae and spores, causing partial or complete inactivation of pathogens, and has the potential to exert a strong biocontrol effect.
[0121] Table 6. Chitinase activity under different treatments
[0122]
[0123] 4. Detection of the inhibition rate of volatile antibacterial substances of Bacillus erythropoietin KF-B6 against the main pathogens of apple continuous cropping disorders: Fusarium oxysporum, Fusarium solani, and Fusarium moniliforme.
[0124] The specific method is as follows:
[0125] (1) Plate inoculation: Three pathogenic bacterial cakes were spot-inoculated in the center of PDA medium; KF-B6 bacteria were streaked onto NA medium with a sterile bamboo stick.
[0126] (2) Determination of the antibacterial effect of KF-B6 volatile substances by plate inversion method: The above-mentioned NA medium inoculated with KF-B6 bacteria and PDA medium inoculated with pathogens were inverted together and sealed with sealing film to form the treatment group, with 3 replicates for each treatment; at the same time, the empty NA medium without KF-B6 bacteria and PDA medium inoculated with pathogens were inverted together to form the control group. The plates were incubated at 30℃. When the pathogens in the control group filled the plates, the antibacterial effect of KF-B6 on the pathogens in the treatment group was observed and the antibacterial rate was calculated.
[0127] Inhibition rate % = (9cm - diameter of pathogen in the treatment group) / 9cm × 100%
[0128] The results are as follows Figure 8 As shown in Table 7, the volatile antibacterial substances produced by KF-B6 showed inhibition rates of 91.11%, 87.78%, and 86.67% against three pathogenic bacteria, namely Fusarium oxysporum, Fusarium solani, and Fusarium moniliforme, respectively, demonstrating extremely significant antibacterial effects.
[0129] Table 7. Inhibition rate of KF-B6 volatile antibacterial substance against three pathogenic bacteria.
[0130]
[0131] 5. Determination of the broad-spectrum antibacterial effect of Bacillus erythropoietinus KF-B6
[0132] The antibacterial activity of KF-B6 against other pathogens causing fruit and vegetable diseases was evaluated using a plate confrontation experiment (the same method as the secondary screening method).
[0133] The results are as follows Figure 9 As shown in Table 8, KF-B6 not only exhibits high antagonism against the main pathogens causing continuous cropping obstacles in apples, but also shows antagonistic effects against other apple pathogens, such as *Alternaria lobata* (apple tree rot), *Alternaria appleensis* (apple leaf spot), *Botrytis cinerea* (apple ring rot), *Alternaria solanacea* (tomato early blight), *Pyrophyllus oryzae* (rice blast), and *Helicobacter pylori* (corn leaf spot), as well as pathogens of vegetables and field crops. Figure 9 The antibacterial rate was 59.84%-82.54% (Table 8).
[0134] Table 8 shows the inhibition rate of KF-B6 against other pathogens.
[0135]
[0136] 6. Ehime Bacillus KF-B6's ability to rapidly and highly produce EPS
[0137] (1) Activation of microbial strains
[0138] KF-B6 bacteria were inoculated onto NA medium slant using a sterile inoculation loop and incubated at 45°C for 72 hours. Microscopic examination revealed that all bacteria were spores.
[0139] (2) Inoculation and culture
[0140] Slant inoculation: Add 10 mL of sterile water to the NA medium slant containing bacteria. Use a sterile inoculation loop to scrape the spores into distilled water to prepare an inoculation suspension. Inoculate the suspension into EPS-producing liquid medium A at a 1% inoculation rate. Use liquid medium A without KF-B6 bacteria as CK. Incubate at 200 rpm and 45℃ for 2 / 4 / 6 / 8 / 12 / 16 / 20 / 24 / 28 / 32 / 40 / 48 h, with 3 replicates for each time period. Take out the shake flasks at different times and observe the viscosity. Store at 4℃. After all time periods of incubation are completed, determine the EPS yield at the same time.
[0141] (3) The EPS production detection method is as follows:
[0142] ①Precipitate crude polysaccharides
[0143] EPS was extracted from the fermentation broth using a low-temperature alcohol precipitation method. 10 mL of KF-B6 EPS fermentation broth cultured for different time periods was placed in a boiling water bath for 10 min to denature the proteins. After natural cooling, it was centrifuged at 10000 rpm for 15 min at 4°C to remove the proteins, retaining the supernatant. 2.0 mL of the supernatant was added to 6 mL of anhydrous ethanol and extracted at 4°C for 24 h to allow the EPS to fully separate. The supernatant of the precipitated EPS was centrifuged at 10000 rpm for 15 min at 4°C to remove the supernatant, retaining the EPS precipitate. The centrifuge tube containing the EPS precipitate was dried in an oven at 50°C. The dried precipitate was dissolved in 20 mL of distilled water to obtain the test solution.
[0144] ② Creating a standard curve
[0145] Prepare a 100 mg / L (100 μg / mL) glucose standard solution. Pour 0.2, 0.4, 0.6, 0.8, and 1.0 mL of the standard solution into 20 or 25 mL stoppered test tubes, respectively. Add water to make up any fractions less than 1 mL. Add 1.0 mL of 6% phenol and 5.0 mL of concentrated sulfuric acid to each tube. Let stand for 10 min, then vortex to mix. Incubate at 30°C for 20 min. Measure the optical density at 490 nm. Use 1.0 mL of water as a blank and perform the same color development. Measure the optical density value (OD). 490 A standard curve was plotted with the x-axis representing the graph and the glucose content representing the y-axis. Figure 10 ).
[0146] Table 9 Glucose Standard Curve
[0147]
[0148] ③ Sample content determination
[0149] The sample was diluted by different factors according to its viscosity. The sample solutions of different dilution factors were taken and the optical density was measured by the same colorimetric method as described above. The polysaccharide content was calculated using a standard curve.
[0150] ④ Methods for calculating extracellular polysaccharides
[0151]
[0152] In the formula:
[0153] m1 -- Sugar content in the sample solution obtained from the standard curve, in micrograms (μg).
[0154] V1 -- Sample final volume, in milliliters (mL)
[0155] V2 -- The volume transferred for colorimetric determination, in milliliters (mL).
[0156] V3 -- Sample volume, in milliliters (mL)
[0157] 0.9 -- Correction factor for converting glucose to dextran.
[0158] The calculation result is rounded to two decimal places.
[0159] (4) Results of EPS production at different time points
[0160] The results are shown in Table 10. It can be seen that the fermentation broth of *Bacillus erythropoietinus* KF-B6 had a slight viscosity at 6 hours of culture, and the EPS yield was measured at 21.80 μg / mL, indicating that EPS production began at 6 hours; therefore, *Bacillus erythropoietinus* KF-B6 is currently the fastest-producing EPS strain reported. The viscosity of the fermentation broth increased slightly at 12 hours, and increased significantly at 16 hours, reaching a yield of 978.41 μg / mL. The highest yield of 4307.39 μg / mL was reached at 24 hours (Table 10). The yield stabilized after 24 hours. The EPS content in the fermentation broth was high, and a large amount of EPS was precipitated with anhydrous ethanol. Figure 11 (A), and EPS has high viscosity ( Figure 11 The presence of B indicates that it has a high molecular weight and good binding properties, which is conducive to promoting the formation of soil aggregates. Therefore, Bacillus erythropoietinus KF-B6 is currently the strain that produces EPS the fastest and has a relatively high EPS yield.
[0161] Table 10 EPS production of KF-B6 bacteria at different time points
[0162]
[0163] 7. The nutritional conversion ability of Bacillus erythropoietinus KF-B6 in decomposing macromolecular organic matter.
[0164] (1) Determination of starch-decomposing ability
[0165] The KF-B6 strain was activated and inoculated onto Gao's No. 1 medium using a sterile inoculation needle. It was then incubated at 28 / 37 / 45 / 50℃ for 72 h, respectively. After staining with Lugol's iodine solution (25 times diluted from the original solution), the size of the clear zone around the colony of strain KF-B6 was measured.
[0166] (2) Determination of protein-degrading ability
[0167] The KF-B6 strain was activated and inoculated onto the protein decomposition function test medium using a sterile inoculation needle. The culture was carried out at 28 / 37 / 45 / 50℃ for 72 h, and the size of the transparent zone around the colony of strain KF-B6 was measured.
[0168] (3) Determination of the ability to break down cellulose
[0169] The KF-B6 strain was activated and inoculated onto the cellulose dissociation function test medium using a sterile inoculation needle. The medium was then incubated at 28 / 37 / 45 / 50℃ for 72 h, and the size of the clear zone around the colony of strain KF-B6 was measured.
[0170] (4) Determination of fat-decomposing ability
[0171] The KF-B6 strain was activated and inoculated onto the lipolysis function test medium using a sterile inoculation needle. The culture was carried out at 28 / 37 / 45 / 50℃ for 72 h, and the size of the halo around the colony of strain KF-B6 was measured.
[0172] (5) Nitrogen fixation capacity determination
[0173] The KF-B6 strain was activated and streaked onto nitrogen-fixing medium (Ashbek medium) and silicate bacteria medium using a sterile inoculation loop. The strains were then incubated at 28 / 37 / 45 / 50℃ for 72 hours, respectively. The growth of the bacteria was observed. If the bacteria reproduced quickly and grew well, it indicated that the bacteria had a strong nitrogen-fixing ability.
[0174] The preparation method of the protein decomposition function detection medium is as follows: Weigh 2.0g of casein, moisten it with 5mL of 0.5mol / L NaOH, add 150mL of distilled water, stir in a boiling water bath until completely dissolved, add distilled water to 800mL, then add 3.0g of beef extract, 5.0g of NaCl, and 0.1g of CaCl2·2H2O, dissolve and mix thoroughly, bring the volume to 1L with distilled water, set the pH to natural, and add 20.0g of agar powder.
[0175] The culture medium for detecting the cellulolytic function consists of: 1.0 g sodium nitrate, 1.2 g Na2HPO4·12H2O, 0.9 g KH2PO4, 0.5 g MgSO4·7H2O, 0.5 g KCl, 0.5 g yeast extract, 0.5 g acid-hydrolyzed casein, 0.2 g Congo red, 10 g sodium carboxymethyl cellulose, 1 L distilled water, pH 7.0±1, and 20 g agar powder.
[0176] The preparation method of the lipolysis function detection medium is as follows: Weigh 10.0g of peptone, 5.0g of NaCl, and 0.1g of CaCl2·2H2O into 800mL of distilled water, dissolve them completely, add 20.0g of agar, adjust the pH to 7.2, bring the volume to 1L, sterilize at 121℃ for 30min, cool to 65℃, add 10mL of Tween80, Tween60, or Tween40 sterilized separately at 121℃ for 30min, and mix well.
[0177] The nitrogen-fixing medium (Ashbek medium) consists of: 10g mannitol, 0.2g KH2PO4, 0.2g NaCl, 0.2g MgSO4·7H2O, 0.1g CaSO4·7H2O, 5g CaCO3, 1L distilled water, pH 6.8-7.0, and 20g agar powder.
[0178] The silicate bacteria culture medium consists of: 5g sucrose, 2g Na2HPO4·12H2O, 0.1g CaCO3, 0.5g MgSO4·7H2O, 1mL 0.5% FeCl3·6H2O solution, 1L distilled water, pH 7.0-7.2, and 20g agar powder.
[0179] Table 11 Nutritional conversion function of KF-B6 bacteria in decomposing macromolecular organic matter
[0180]
[0181] The results are as follows Figure 12 As shown in Table 11, KF-B6 bacteria have the ability to produce cellulase, amylase, protease, lipase, and nitrogenase at different temperatures. Figure 12 Furthermore, this bacterium exhibits the strongest function in the high-temperature range of 37-45℃. It is known that this bacterium can decompose cellulose-rich organic matter such as crop straw, as well as raw materials containing starch, protein, and fat such as corn flour and soybean meal, into small-molecule organic nutrients such as disaccharides, monosaccharides, small peptides, amino acids, and fatty acids. This balances the small-molecule organic nutrients in the soil, which is beneficial for plant absorption and utilization. At the same time, it provides nutrients for other microorganisms and increases the diversity of microorganisms in the soil.
[0182] Meanwhile, this bacterium showed good growth on both Assumption medium and silicate bacteria medium, indicating that it has a strong nitrogen-fixing ability. Figure 13 (Left: Assumption medium, Right: Silicate bacteria medium) can increase the supply of nitrogen nutrition to plants.
[0183] 8. Determination of the growth-promoting properties of Bacillus erythropoietinus KF-B6
[0184] (1) After the KF-B6 strain was activated, it was inoculated into liquid culture medium B and cultured at 40℃ and 200rpm for 18h to obtain seed liquid;
[0185] (2) Inoculate the seed liquid into the IAA-producing fermentation medium at an inoculation rate of 10%, and incubate at 40℃ and 200rpm for 24h to obtain the fermentation broth.
[0186] The fermentation medium for producing IAA consists of: 5.0g yeast extract, 5.0g soybean meal powder, 1.0g K2HPO4▪3H2O, 0.5g MnSO4▪H2O, 0.6g NaCl, 0.4g MgSO4▪7H2O, 0.2g KCl, 1g sucrose, 2g CaCO3, 1L distilled water, natural pH, and 200mg / L of filtered and sterilized L-tryptophan solution added after sterilization.
[0187] (3) Determination of ability to produce indoleacetic acid
[0188] ① Determination of the IAA standard curve
[0189] IAA standard solutions with concentrations of 0, 20, 40, 60, 80, and 100 μg / mL were prepared and mixed with Salkowski colorimetric solution at a volume ratio of 1:1. The solutions were incubated at room temperature in the dark for 30 min, and then the OD values at each concentration were measured. 530 (A 1:1 mixture of distilled water and Salkowski colorimetric solution was used as a blank control). Finally, OD was used as the blank control. 530 Plotting the graph with IAA concentration on the ordinate and plotting it on the x-axis yields the IAA standard curve.
[0190] ② Determination of IAA concentration in bacterial culture
[0191] The KF-B6 fermentation broth was centrifuged at 6000 rpm for 15 min, and then 4 mL of the supernatant was mixed with an equal volume of Salkowski colorimetric solution. The mixture was incubated at room temperature in the dark for 30 min to observe whether it turned red. If it turned red, it indicated that the bacterium had a certain capacity for IAA production, and its OD value was further measured. 530 Value (using a mixture of uninoculated liquid culture medium and an equal volume of Salkowski colorimetric solution as a control). The relationship between IAA concentration and OD... 530The corresponding IAA concentration is calculated using the standard relationship curve.
[0192] Finally, after incubation at 45℃ for 24 hours, the yield of IAA produced by this bacterium was measured to be 26.84 μg / mL. Therefore, this bacterium has the potential to promote the growth of plant roots and plants.
[0193] Example 5: Effect of Bacillus erythropoietinus KF-B6 on Soil Water-Stable Aggregates for Rapid and High-Yield EPS Production
[0194] The tested soil was sandy loam, sieved through a 0.25 mm sieve, and sterilized at 121℃ for 40 min. KF-B6 was cultured in liquid medium A to obtain a KF-B6 fermentation broth containing EPS (EPS content = 3500.65 μg / mL, viable count = 550 million / mL). This fermentation broth was inoculated at a rate of 5% (v / w) into petri dishes containing 80.0 g of soil sample as the treatment group. Soil samples inoculated with an equal volume of sterile water were designated CK1, and soil samples inoculated with liquid medium A were designated CK2. Each treatment was repeated six times. The petri dishes were incubated at 40℃ for 30 days, with sterile water added periodically to maintain relative soil surface moisture. Every 10 days, the proportion of soil water-stable aggregates >0.25 mm was determined using the wet sieving method (detection method refers to NYT1121.19-2008 Soil Testing, Parts 19 and 20).
[0195] Result: As Figure 14 As shown in Table 12, the KF-B6 fermentation broth inoculation group significantly increased the proportion of water-stable aggregates (>0.25 mm) in the soil after 10 days, reaching 21.38%, which was 5.4 times that of the CK1 sterile water treatment group, and the proportion of aggregates with a particle size greater than 3 mm was 9.45%. After 20 days of cultivation, the proportion of water-stable aggregates >0.25 mm reached its maximum, at 32.97%, which was 6.6 times that of the CK1 sterile water treatment group. The proportion of water-stable soil aggregates after 30 days of cultivation was not significantly different from that after 20 days, but the proportion of particles larger than 3 mm gradually decreased, and the particle size became more stable between 0.25-3 mm, indicating that the soil structure tended to stabilize after 20 days. In contrast, the proportion of water-stable aggregates in the CK2 group inoculated with liquid culture medium did not show a significant increase compared to CK1. Figure 14 This indicates that KF-B6 bacteria and its produced EPS promote the formation of soil water-stable aggregates, with high efficiency in aggregate formation and strong soil aggregate stability. Therefore, KF-B6 has the function of effectively improving soil.
[0196] Table 12 Effects of different treatments on the proportion (%) of water-stable aggregates at each treatment level
[0197]
[0198] Example 6: Preparation of KF-B6 Bacillus erythropoietin inoculant and compound microbial fertilizer
[0199] 1. Preparation of KF-B6 liquid microbial inoculant
[0200] (1) Preparation of slant spore suspension: Activated KF-B6 was streaked onto the NA medium slant with a sterile inoculation loop and cultured at 45℃ for 3 days. The spore rate was greater than 95% under a microscope. The spores were washed off with 10 mL of sterile distilled water and transferred to a sterile and dry inoculation bottle. The bottle was then incubated at 80℃ for 5 min to obtain the spore suspension inoculation agent.
[0201] (2) EPS production liquid fermentation: The spore suspension was inoculated into the EPS-producing liquid culture medium A at an inoculation rate of 10%, and cultured at 45℃ and 200rpm for 48h in a constant temperature shaker. The fermentation broth was viscous and more than 95% of the spores were observed under a microscope, thus obtaining the EPS-containing KF-B6 fermentation broth.
[0202] (3) Preparation of KF-B6 liquid microbial agent: Add 15% (w / v) mineral potassium humate, 3.5% (w / v) potassium dihydrogen phosphate, 2% (w / v) seaweed liquid with pH 7.0, 3% (w / v) ethylene glycol, 1.5% (w / v) OP-10 and 0.05% (w / v) sodium dehydroacetate to the KF-B6 fermentation broth containing EPS, and mix thoroughly to obtain KF-B6 liquid microbial agent.
[0203] The above-mentioned KF-B6 liquid microbial inoculant contains: 550 million viable bacteria / mL, 3500.65 μg / mL extracellular polysaccharide, and pH 6.0.
[0204] 2. Preparation of KF-B6 compound microbial fertilizer
[0205] (1) Preparation of slant spore suspension: The method is the same as that for the preparation of KF-B6 liquid microbial agent.
[0206] (2) Inoculate the slant spore suspension into liquid culture medium B at an inoculation rate of 10% and incubate at 40℃ and 200rpm for 18h.
[0207] (3) Inoculate the seed liquid into liquid culture medium C at an inoculation rate of 10%, and culture at 45℃ and 200rpm for 24h to obtain fermentation broth. The spore rate in the fermentation broth is >95%, and the bacterial count is >600 million / mL.
[0208] (4) Preparation of KF-B6 compound microbial fertilizer: The fermentation broth of KF-B6 and the sterilized carrier were mixed evenly at a volume-to-mass ratio of 1:2. The mixture was spread to a thickness of 15cm-20cm in a constant temperature incubation room at 45℃ and ventilated for 6 days until the moisture content was below 10%, thus obtaining KF-B6 compound microbial fertilizer.
[0209] The carrier is a mixture of vermiculite, fully matured cow manure compost, peat moss, and humic acid in a weight ratio of 1:2:1:1.
[0210] The above-mentioned KF-B6 compound microbial fertilizer contains: 45.60% organic matter, 9.26% total nutrients (N+P2O5+K2O), 8.63% moisture, 380 million KF-B6 effective live bacteria / g, and pH 7.5.
[0211] Example 7 Pot Experiment
[0212] 1. Experimental seedlings: M9 T337 rootstock seedlings with the same growth rate, which were prepared for transplanting after two months of hardening off in the seedling shed.
[0213] 2. Soil used in the experiment: Samples were taken from a 30-year-old, continuously cropped orchard in Zhangjiayuan Town, Qianyang County, Baoji City, Shaanxi Province. Multiple random samples were taken from an area 80cm away from the tree trunk and 10-40cm deep, and the soil was mixed evenly. The soil texture was sandy loam.
[0214] 3. Experimental Design
[0215] Control group (CK): Soil from orchards that have been continuously cropped (CK);
[0216] Treatment I (T1): 2.0 kg / pot of KF-6 compound microbial fertilizer (prepared in Example 6) in soil from orchards that have been continuously planted. At the same time, 10% (v / v) KF-B6 liquid microbial agent (prepared in Example 6) was added to the irrigation water when planting the flowers in the pots.
[0217] Treatment II (T2): Continuous cropping orchard soil + 2.0 kg / pot of carrier, wherein the carrier is a mixture of vermiculite, fully mature cow manure compost, peat moss and humic acid in a weight ratio of 1:2:1:1;
[0218] Each treatment consisted of 30 pots. When transplanting the seedlings from the nursery into large pots, 15 kg of soil from each of the different experimental treatments was used per pot, and the plants were watered regularly. The greenhouse humidity was maintained at 65%-70%; daytime temperature was 23-26℃, and nighttime temperature was 15-18℃; the greenhouse was ventilated regularly.
[0219] 4. Indicator Measurement
[0220] (1) Investigate the survival rate and growth of the trees six months later.
[0221] Calculate the survival rate of seedlings for each treatment; select 20 leaves from the middle part of the outer, normally developing branches of each plant, and investigate a total of 100 leaves for each treatment, measuring the weight of 100 leaves. Measure plant height, the increase in trunk circumference at 25cm from the soil surface, and root activity (methylene blue photoelectric colorimetric method).
[0222] Results: As shown in Table 13, the rootstock seedlings of treatments I (T1) and II (T2) showed better growth and development than those of the rootstock seedlings treated with continuous cropping soil. Among them, the seedlings of treatment T1, treated with KF-6 compound microbial fertilizer and microbial inoculant, exhibited the best growth and the highest survival rate of 96.67%. In contrast, the survival rate of the rootstock seedlings planted in the continuous cropping soil (CK) was low, at only 63.33%, and the trees showed weaker growth and lower root activity. Table 13 also shows that the T1 treatment increased leaf weight, plant height, trunk circumference, and root activity by 23.77%, 16.87%, 18.46%, and 38.72% respectively compared to the control (CK). The T2 treatment showed lower values for all indicators than the T1 treatment, indicating that KF-B6 bacteria still possesses resistance to continuous cropping.
[0223] Table 13 Effects of different treatments on the growth of M9 T337 rootstock seedlings
[0224]
[0225] (2) Effects of KF-B6 compound microbial fertilizer and inoculant on rhizosphere soil enzyme activity in continuously cropped apple trees
[0226] Six months later, fresh soil samples were taken from the rhizosphere of plants in different treatment groups using the five-point sampling method and mixed thoroughly. The activities of neutral phosphatase, urease, sucrase, and catalase were measured according to the instructions of the soil neutral phosphatase, soil urease, soil sucrase, and soil catalase test kits. Each treatment was repeated three times.
[0227] The results are as follows Figure 15 As shown, the levels of neutral phosphatase, urease, sucrase, and catalase in soil treated with KF-B6 (T1) were 1.63 times, 1.44 times, 3.81 times, and 2.53 times higher than those in the continuous cropping soil treatment (CK), respectively. Therefore, the application of KF-B6 compound microbial fertilizer and inoculant can increase soil enzyme activity, reflecting its ability to improve the transformation intensity of soil carbon, nitrogen, and phosphorus and promote the metabolic activities of soil microorganisms.
[0228] (3) Detection of culturable soil microorganisms
[0229] Six months later, the plate count method was used to determine the number of bacteria, fungi, actinomycetes, and Fusarium pathogens in the soil. The soil samples were diluted and spread on LB medium, PDA medium, and Gao's No. 1 medium.
[0230] Results: As shown in Table 14, after treatment I (T1) was treated with KF-6 compound microbial fertilizer and microbial inoculant, the levels of fungi and bacteria per gram of soil were as follows: The bacterial content in T1 was 8.01 times that of CK, the actinomycete content was 5.00 times that of CK, and the fungal content was 81.56% lower than CK. Therefore, KF-B6 compound microbial fertilizer and inoculant can significantly increase the number of bacteria in the soil, reduce the soil fungal content, and increase the bacterial / fungal ratio. This increased bacterial / fungal ratio is beneficial for the reconstruction of the soil microbial ecosystem in continuously cropped apple orchards, promoting plant growth.
[0231] Table 14. Effects of KF-B6 compound microbial fertilizer and inoculant treatments on soil microorganisms in apple continuous cropping.
[0232]
[0233] (4) Detection of KF-B6 culturable soil microorganisms
[0234] After transplanting, the initial bacterial count was determined, and the effective bacterial count of KF-B6 in the rhizosphere soil of the rootstock seedlings of treatment I (T1) was tested every month: large clumps of soil were removed from the roots, and the attached soil was retained. 10.00g of the soil was accurately weighed and placed in an Erlenmeyer flask containing 100mL of sterile physiological saline. The solution was serially diluted, and 0.1mL of each concentration was spread on Gao's No. I medium and incubated at 35℃ for 72h. The effective bacterial count of KF-B6 was calculated by plate counting method.
[0235] The results are shown in Table 15. It can be seen that the initial effective bacterial count of KF-B6 was 3.20 × 10⁻⁶. 7 CFU / g, close to the theoretical amount of 6.00 × 10⁻⁶. 7 The bacterial count decreased by one order of magnitude in the second month (CFU / g) and by five times in the fourth month compared to the second month. However, the bacterial count in the sixth month was not significantly different from that in the fourth month, indicating that KF-B6 can effectively colonize in soils and plant roots affected by continuous cropping, thereby playing a role in preventing and controlling diseases caused by continuous cropping.
[0236] Table 15 Changes in the number of KF-B6 bacteria in rhizosphere soil
[0237]
[0238] Example 8 Field Trial
[0239] A planting trial of the new apple variety Ruixianghong was conducted in an orchard in Zhangjiayuan Town, Qianyang County, Baoji City, Shaanxi Province. The orchard covered an area of 82 mu (approximately 5.8 hectares), with the previous crop being 30-year-old Fuji apples on rootstock. On March 20, 2022, saplings of the Ruixianghong variety, 2-year-old M9 T337 dwarfing self-rooted rootstock, were replanted at the original site, with a spacing of 3.8m × 1m. The trial consisted of two treatments, each with four replicates, and one replicate constituting one plot. Each experimental plot contained 25 apple trees.
[0240] 1. The specific process and experimental scheme for resistance to continuous cropping are as follows: Treatment with KF-B6 compound microbial fertilizer and liquid microbial inoculant.
[0241] (1) Planting trenches were dug before winter 2021.
[0242] ① Deep plowing and land preparation: After the autumn fruit harvest, remove old trees, pick out residual roots and diseased roots, and apply KF-B6 compound microbial fertilizer (prepared in Example 6) to the experimental plot when plowing, at a rate of 300 kg / mu;
[0243] ② Dig planting trenches: The planting trenches should be about 80 cm deep and 80 cm wide.
[0244] ③ Spring backfilling of planting trenches (March 6, 2022): Apply 500 kg of KF-B6 compound microbial fertilizer per mu in the planting trenches and mix it with the backfill soil before backfilling.
[0245] (2) Seedling treatment before planting on March 20, 2022
[0246] For seedlings that have not lost water after planting, soak the roots in a 100-fold diluted solution of KF-B6 liquid microbial agent (prepared in Example 6) for 30 minutes;
[0247] (3) Trees were planted on March 20, 2022.
[0248] ① When planting, apply 2kg of KF-B6 compound microbial fertilizer to each planting pit and mix it evenly with the soil; when planting, add 20% KF-B6 compound microbial fertilizer and 20% soil to a 100-fold diluted solution of KF-B6 liquid microbial agent to make a mud slurry, dip the roots of the seedlings in the mud slurry and then plant the seedlings in the dug pits.
[0249] ② Covering with soil
[0250] After covering with soil, a 300-fold diluted solution of KF-B6 liquid microbial agent (prepared in Example 6) was used for root irrigation.
[0251] (4) Management after planting in 2022
[0252] ① During the growing season (May-June): Drench the roots once with a 300-fold dilution of KF-B6 liquid inoculant (prepared in Example 6);
[0253] ② Autumn fertilization: 2 kg of KF-B6 compound microbial fertilizer + 0.5 kg of commercially available Mumei soil trace elements per tree.
[0254] 2. Control treatment: The KF-B6 compound microbial fertilizer in the above process and plan is replaced with farmyard manure (well-rotted cow manure dried to a moisture content of less than 30% and then crushed); water is used instead of KF-B6 liquid microbial agent.
[0255] The other agricultural operations were completely identical in both treatments.
[0256] 3. Detection indicators
[0257] (1) Soil index testing: Five-point sampling method was used to collect rhizosphere soil samples from apple trees in each plot. Six trees were selected in each plot to collect soil samples at fixed points. Five sampling points were set up at 0.5 m from the base of the trunk. 20-40 cm of soil was dug out with a soil drill with an inner diameter of 10 cm to collect the roots. The soil attached to the roots was shaken off. The contents of rhizosphere soil organic matter, total nitrogen, available potassium and available phosphorus, as well as soil aggregates and soil bulk density were measured.
[0258] The results are shown in Table 16. The nitrogen, phosphorus, and potassium contents in the soil of the KF-B6 compound microbial fertilizer and microbial inoculant treatment groups all increased, especially the organic matter content, which increased by 17.03 g / kg compared to the control group (CK), thus improving soil fertility. Simultaneously, this treatment also promoted the formation of water-stable aggregates, particularly increasing the proportion of large-particle aggregates. Specifically, the proportions of >2 mm and 1-2 mm water-stable aggregates increased by 28.01% and 47.64% respectively compared to the CK group. Compared to the CK group, the proportion of micro-aggregates (<0.25 mm) decreased by 48.60%, and the soil bulk density decreased by 6.87%. This indicates that KF-B6 bacteria and its inoculant not only improved soil organic matter but also promoted the formation of water-stable aggregates, reduced soil bulk density, and increased soil structure stability and permeability, achieving the effect of soil improvement.
[0259] Table 16 Effects of KF-B6 compound microbial fertilizer and microbial inoculants on the physicochemical properties of rhizosphere soil in continuously cropped apple orchards.
[0260]
[0261] (2) Detection of planting survival rate and apple tree growth indicators
[0262] Each treatment group had 4 plots with a total of 100 trees planted. One year later, the number of surviving trees was counted, and the survival rate was calculated. At the same time, 3 trees were selected and marked in each plot. The height and trunk diameter of the apple saplings were measured at the time of planting to obtain the initial values. One year later, the marked apple trees were measured again to obtain the final values. The height and trunk diameter were measured, the chlorophyll content of the leaves was determined, and the number of branches and the length of the branches were counted.
[0263] The results are shown in Table 17. The survival rate of the Ruixiang Red apple seedlings planted in the KF-B6 treatment group was as high as 94.00%, which was 16.05% higher than that in the CK treatment group. The growth rate of plant height, growth rate of trunk diameter, chlorophyll content, number of branches and branch length increased by 31.14%, 30.26%, 11.15%, 24.32% and 25.14% respectively. Therefore, KF-B6 bacteria and its inoculant can not only increase the survival rate of the new Ruixiang Red apple variety in continuously cropped orchards, but also have a significant promoting effect on its growth.
[0264] Table 17 Effects of apple planting survival rate and plant growth in continuously cropped orchards.
[0265]
[0266] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.
Claims
1. A strain of *Bacillus erythropoietinus*, characterized in that, The Ehime-like Bacillus specifically refers to Ehime-like Bacillus ( Paenibacillus ehimensis KF-B6, with accession number CGMCC No.32131.
2. The *Ehime*-like bacillus described in claim 1 (… Paenibacillus ehimensis The application of KF-B6 is characterized by, It is used in the prevention and control of continuous cropping obstacles in apples.
3. The application as described in claim 2, characterized in that, It is used in the suppression of pathogens; the pathogens include: Fusarium oxysporum, Fusarium solani, Fusarium moniliforme, *Alternaria alternata*, *Staphylococcus berenices*, *Alternaria solanacea*, *Pyrrosia lingua*, and *Helicobacter pylori*.
4. The application as described in claim 2, characterized in that, It is used in the production of chitinase.
5. The application as described in claim 2, characterized in that, It is used in the production of EPS and in promoting the formation of soil aggregates.
6. The application as described in claim 2, characterized in that, It is used in the decomposition of macromolecular organic compounds, such as starch, cellulose, protein, or fat.
7. The application as described in claim 2, characterized in that, It is used in the production of IAA and in promoting plant growth.
Citation Information
Patent Citations
A bacteriocin-producing spore-like bacillus and its application
CN110257269B
A strain of Bacillus amyloliquefaciens and its application in controlling apple replanting obstacles
CN112266881B
Bacillus erythropoietin-producing HD and its application
CN112680375B
Paenibacillus polymyxa and application thereof
CN116536199A
Paenibacillus ehimensis HD for producing antibacterial peptide and application of paenibacillus ehimensis HD
CN112680375A