Phyllostachys pubescens PheXTH2 protein for regulating and controlling plant stem cell wall thickness, coding gene and application

Abstract

The invention relates to the technical field of plant molecular biology, in particular to a moso bamboo PheXTH2 protein for regulating and controlling the thickness of a plant stem cell wall, a coding gene and application. According to the invention, a gene expression vector is transferred into wild arabidopsis thaliana through an agrobacterium-mediated method for the first time, and a result shows that the thickness of inter-bundle fiber cell walls of an arabidopsis thaliana plant over-expressed with the PheXTH2 gene is increased, which indicates that the gene can regulate and control the thickness of the cell wall of a plant stem. Therefore, the PheXTH2 can be used as a potential molecular breeding tool, is used for improving the stalk property and increasing the plant outturn quantity and ecological benefits, and has a wide application prospect.

Description

Technical Field

[0001] The invention relates to the technical field of plant molecular biology, and in particular to a bamboo PheXTH2 protein for regulating the thickness of plant stem cell walls, a coding gene and an application thereof. Background Art

[0002] Bamboo is a natural composite material known for its rapid growth and excellent mechanical properties. Moso bamboo is a grass, but its stems are highly lignified. The thickness and composition of the cell wall determine the wood properties of the plant, but our understanding of the molecular regulation mechanism of the stem cell wall is still limited.

[0003] XYLOGLUCAN ENDOTRANSGLUCOSYLASE / HYDROLASE (XTH) is an enzyme that mediates cell wall relaxation by catalyzing the hydrolysis and reconnection of xyloglucan molecules between cellulose microfibrils (i.e., a "molecular grafting" mechanism). XTH Genes play specific roles in plant growth and development, including AtXTH4 and AtXTH9 It helps in the expansion of wood cells and the formation of secondary walls; SbHY5 pass SbXTH7 Regulate the hemicellulose content of sweet sorghum cell walls, thereby regulating the development of cell walls. These studies show that XTH Can regulate cell wall synthesis.

[0004] Therefore, the biomolecules related to stem cell wall development in bamboo were isolated and identified. XTH Genes are very important for a comprehensive understanding of the molecular mechanisms of bamboo cell wall development and have become a technical challenge that needs to be urgently addressed in this field. Summary of the invention

[0005] In order to solve the above technical problems, the present invention provides a bamboo PheXTH2 protein capable of regulating the thickness of plant stem cell walls, and its amino acid sequence is shown in SEQ ID NO.1.

[0006] Meanwhile, the present invention provides a nucleic acid encoding the bamboo PheXTH2 protein.

[0007] Preferably, the nucleotide sequence is as shown in SEQ ID NO.2.

[0008] Furthermore, the present invention provides a biomaterial containing the bamboo PheXTH2 protein or the nucleic acid; the biomaterial is recombinant DNA, expression cassette, transposon, plasmid vector, viral vector, engineered bacteria or non-renewable plant cells or tissues.

[0009] Furthermore, the present invention provides the use of the bamboo PheXTH2 protein, the nucleic acid or the biological material in regulating the thickness of plant stem cell walls.

[0010] Preferably, the plant stem cell wall is an interfascicular fiber cell wall.

[0011] In some specific embodiments, the expression level or activity of the bamboo PheXTH2 protein is increased to increase the thickness of the plant stem cell wall.

[0012] Preferably, overexpression of bamboo PheXTH2 Gene to increase the thickness of plant stem cell walls.

[0013] In some embodiments, the overexpression method is selected from one or more combinations of (1) to (5): (1) by introducing a plasmid containing the gene; (2) by increasing the copy number of the gene on the plant chromosome; (3) by changing the promoter sequence of the gene on the plant chromosome; (4) by operably linking a strong promoter to the gene; (5) By introducing enhancers.

[0014] In some specific embodiments, the expression level or activity of the bamboo PheXTH2 protein is reduced or eliminated to reduce the thickness of the plant stem cell wall.

[0015] Preferably, knocking out bamboo PheXTH2 Gene to reduce the thickness of plant stem cell walls.

[0016] In some embodiments, the knockout is performed using any known knockout method.

[0017] In some embodiments, the knockout is performed using homologous recombination.

[0018] In some embodiments, the knockout is edited using a CRISPR-Cas system.

[0019] In addition, the present invention also provides the use of the moso bamboo PheXTH2 protein, the nucleic acid, or the biological material in preparing transgenic plants.

[0020] In some embodiments, the using comprises the steps of: according to PheXTH2The CDS sequence of the gene was used to design cloning primers. The cDNA obtained by reverse transcription of total RNA from bamboo stems was used as a template for PCR amplification. The amplified product was connected to the pMD19-T cloning vector and transformed into Escherichia coli (DH5α) for sequencing. Then the sequence with the correct sequence was used to construct an overexpression vector. pCAMBIA-2300-eGFP , Arabidopsis thaliana was transformed by Agrobacterium-mediated method to obtain transgenic plants.

[0021] The present invention also provides the use of the moso bamboo PheXTH2 protein, the nucleic acid or the biological material in plant breeding.

[0022] The breeding methods include but are not limited to transgenic, hybridization, backcrossing, self-pollination or asexual reproduction.

[0023] Specifically, the present invention provides a method for regulating the thickness of plant stem cell walls, comprising: using genetic engineering means to increase the expression level or activity of bamboo PheXTH2 protein or its encoding gene in plants to increase the thickness of plant stem cell walls; or, reducing or eliminating the expression level or activity of bamboo PheXTH2 protein or its encoding gene to reduce the thickness of plant stem cell walls.

[0024] Preferably, the genetic engineering means comprises: introducing an expression vector carrying a target gene into plant cells by using Ti plasmid, plant virus vector, direct DNA transformation, microinjection, or electroporation technology.

[0025] Preferably, the method further comprises: identifying positive transgenic plants by kanamycin (Kan) resistance screening, observing and detecting the phenotype of positive transgenic plants, and analyzing the expression of target genes in transgenic plants and wild-type plants by semi-quantitative PCR. The stems are made into 8-micron slices by paraffin sectioning, stained by toluidine blue staining, and then the cell walls are observed under an optical microscope, and the thickness of the cell walls is counted.

[0026] Preferably, the plant comprises Arabidopsis thaliana or bamboo.

[0027] Compared with the prior art, the present invention has the following beneficial effects: The present invention provides for the first time a PheXTH2 protein related to the cell wall development of bamboo and its encoding gene and application. For the first time, the gene expression vector was transferred into wild-type Arabidopsis thaliana by Agrobacterium-mediated method, and the results showed that overexpression PheXTH2 The thickness of the interfascicular fiber cell walls of Arabidopsis plants expressing the gene increased, indicating that the gene can regulate cell wall thickness. PheXTH2 It can be used as a potential molecular breeding tool to improve stem wood properties, increase plant yield and ecological benefits, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 Overexpression in Arabidopsis PheXTH2 The positive plant detection results of the gene; M: DNA Marker; WT: wild-type Arabidopsis (Col-0), negative control; P: pCAMBIA-2300-eGFP Plasmid, negative control; 2#: PheXTH2 ; H2O: negative control.

[0029] Figure 2 Overexpression in Arabidopsis PheXTH2 The detection results of stem cell wall thickness after gene addition; different lowercase letters indicate statistical differences.

[0030] Figure 3 Overexpression in Arabidopsis PheXTH2 Semi-quantitative analysis results of genes; where M: DNA Marker; WT: wild-type Arabidopsis thaliana (Col-0), negative control; Actin : internal reference gene; XTH2 : PheXTH2 Gene. DETAILED DESCRIPTION

[0031] In order to make the purpose, technical scheme and advantages of the present invention clearer, the technical scheme in the present invention will be described clearly and completely below. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments in the present invention, all other embodiments obtained by ordinary technicians in the field without creative work are within the scope of protection of the present invention. In the embodiments provided in this specification, if no specific technology or conditions are indicated, the technology or conditions described in the literature in the field, such as Molecular Cloning Laboratory Manual (Sambrook J & Russell ld W, Molecular Cloning: a Laboratory Manual, 2001) or the product instructions are used. The reagents or instruments used without indicating the manufacturer are all conventional products that can be purchased through regular channels.

[0032] Example 1. Bamboo PheXTH2 Gene cloning and vector construction 1. The bamboo stems were collected from Guangde City, Anhui Province (N30°52′33″8, E119°25′22″4). The materials were transported to the laboratory on dry ice and stored in a -80°C ultra-low temperature refrigerator for subsequent experiments.

[0033] 2. RNA Extraction The specific operations are as follows: (1) Take about 2-3 g of bamboo stem material, place it in a mortar pre-cooled with liquid nitrogen, quickly grind it into powder in liquid nitrogen, and quickly transfer it to a 2 mL RNase-free centrifuge tube pre-cooled with liquid nitrogen; (2) Add 1 mL of Trizol to each tube and quickly invert to mix; (3) Add 200 μL of chloroform to each tube, vortex and mix for 1 min, and place on ice for 15 min. (4) Centrifugation at 12,000 rpm, 10 min, 4°C; (5) Pipette 600 μL of supernatant into a 1.5 mL RNase-free centrifuge tube, add an equal volume of isopropanol, and place on ice for 15 min. (6) Centrifuge at 12,000 rpm for 10 min, discard the supernatant, and wash the precipitate twice with 70% ethanol (prepared with nuclease-free water); (7) After drying at room temperature, dissolve the precipitate in 50-100 μL of nuclease-free water.

[0034] 3. Convert total RNA into cDNA through reverse transcription (1) Perform cDNA first-strand reverse transcription using the PrimeScript RT reagent Kit with gDNA Eraser (TaKaRa): (a) Reaction for removal of genomic DNA The reaction mixture was prepared on ice according to the ingredients in Table 1. The PCR reaction program was: 42°C, 2 min.

[0035] Table 1 Reaction system for removing genomic DNA

[0036] (b) Reverse transcription reaction The reverse transcription PCR reaction program was: 37°C, 15 min; 85°C, 5 s; 4°C low temperature storage. The reverse transcription reaction system is shown in Table 2.

[0037] Table 2 Reverse transcription reaction system

[0038] 4. Gene cloning (1) PheXTH2 The nucleotide sequence of the gene is shown in SEQ ID NO.2, and the amino acid sequence of the encoded protein is shown in SEQ ID NO.1; The primer sequences are as follows: PheXTH2-F :ATGAGGACGATTGCGGTTGG (SEQ ID NO.3) PheXTH2-R : TCAACGCAGCTTGCACTCG (SEQ ID NO.4) (2) PCR amplification Using bamboo cDNA as template, PCR amplification was performed with corresponding primers, and the reaction program was: 94°C, 1 min; 95°C, 10 s; 60°C, 30 s; 72°C, 1 min; 30 cycles; 72°C, 10 min. 20 μL of amplification system was prepared on ice as shown in Table 3 below.

[0039] Table 3 PCR reaction system

[0040] (3) Use 1% agarose gel electrophoresis to check whether the band size is as expected, and proceed to the next step of gel recovery and purification for the band of the expected size.

[0041] (4) Gel recovery and purification: Gel recovery and purification were performed according to the instructions of the M5 gel extraction kit (Zhejumei, Beijing).

[0042] 5. Connect the cloned product to the vector (1) In a microcentrifuge tube, add 100 ng of PCR product, 1 μL of Pmd19-T vector (TaKaRa), 5 μL of 2× ligation buffer (TaKaRa), and an appropriate amount of ddH2O to a total volume of 10 μL. Gently mix all ingredients and ligate at 16°C for 30 min.

[0043] (2) Transform the ligated product into competent bacteria (DH5α), cool on ice for 30 minutes, heat shock at 42°C for 30-60 seconds, and then quickly cool on ice for 3 minutes. Add 600 μL LB liquid culture medium to the product and resume culture at 37°C for 30 minutes. Spread the mixture onto an agarose plate containing appropriate antibiotics.

[0044] (3) After culturing overnight on the culture plate, select well-grown colonies for PCR testing to confirm whether they contain the target gene. The positive bacterial solution that has been identified correctly will be sent to Suzhou Anshengda Company for sequencing.

[0045] 6. Construction of expression vector (1) After sequencing is correct PheXTH2 Plasmid added pCAMBIA-2300-eGFP The homology arms of the vector were added by PCR, and then the vector and the target gene were connected according to the instructions of M5superFastseamless.

[0046] (2) Transform the ligation product into competent E. coli (DH5α) using the heat shock method, and then spread the bacteria onto LB agar plates containing appropriate selective antibiotics.

[0047] (3) Culture the bacteria on the plate until visible colonies are formed. Select a single colony for colony PCR and sequence the positive clone. Correct sequencing indicates that the overexpression vector pCAMBIA-2300-PheXTH2-eGFP Build successful.

[0048] 7. Plant transformation (1) Grow robust Arabidopsis plants (approximately 5 weeks) under a long-day (14 h light, 10 h dark) environment.

[0049] (2) Cut off the first 1-5 cm long main inflorescence (to promote the growth of more lateral inflorescences). Perform infiltration transformation within one week after pruning (3-5 days). In addition, the plant needs to be fully watered 1 day before infiltration transformation so that the plant stomata can fully open during transformation.

[0050] (3) pCAMBIA-2300-PheXTH2-eGFP Transform GV3101 Agrobacterium, identify positive monoclonal colonies by PCR, add positive monoclonal colonies to 1 mL LB medium containing antibiotics, culture at 28 °C for 16 h, then take 150 μL of bacterial solution and add it to 150 mL fresh liquid LB medium, shake and culture at 28 °C until OD 600 >0.8.

[0051] (4) Centrifuge the bacterial solution at 4000g for 20 min, then resuspend the bacteria in 120 mL of infiltration solution (10% sucrose + 400 μL / L silwet-77, mix thoroughly before dipping, OD 600 =0.8-1.0). At the same time, cut off the fruit pods and fully opened flowers on the plants.

[0052] (5) Immerse the inflorescence of the plant in the bacterial solution for 45 seconds and shake it gently.

[0053] (6) Place the infected plants in a dark incubator for 48 to 72 hours, then place them in normal light conditions and continue to infect them several times at regular intervals.

[0054] (7) Continue to culture until the plants mature, collect the seeds, place them in a dry environment for about 1 week, and screen for transformants.

[0055] (8) The CTAB method was used to extract Arabidopsis genomic DNA and PCR was performed to screen positive plants ( Figure 1 ).

[0056] 8. Observation and detection of stem cell wall thickness The positive transgenic Arabidopsis plants that had been genetically screened were selected as the experimental group, and the wild-type Arabidopsis plants (Col-0) that had not been transformed were used as the control group. All plants were cultured under the same growth conditions to maintain consistency. When the height of the Arabidopsis inflorescence axis was above 20 cm, the material at 2 cm from the base of the inflorescence axis was immersed in 70% FAA and fixed at 4 °C for 48 h, followed by alcohol gradient dehydration, xylene transparency, paraffin embedding, and finally the embedded samples were cut into 8 μm slices and stained with toluidine blue. After sealing, the cell wall was observed under an optical microscope (Olympus), and the thickness of the vessel and interfascicular fiber cell wall was counted after taking pictures, and statistical analysis and mapping were performed.

[0057] Figure 2 Overexpression was shown PheXTH2 Differences between Arabidopsis thaliana and wild-type Arabidopsis thaliana (WT) in cell wall, overexpression PheXTH2 The thickness of the cell wall of the posterior duct remains unchanged, but the thickness of the cell wall of the interfascicular fibers increases significantly, indicating that PheXTH2 Promoted the thickening of interfascicular fiber cell walls.

[0058] 9. Gene semi-quantitative analysis Arabidopsis thaliana Actin As the internal reference (control group), the expression pattern of the target gene was analyzed. PheXTH2 Gene ， Subsequently, agarose gel electrophoresis was performed to detect the overexpression of PheXTH2 The gene expression level increased significantly ( Figure 3 ).

[0059] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A bamboo PheXTH2 protein, characterized in that: Its amino acid sequence is shown in SEQ ID NO.

1.

2. A nucleic acid encoding the bamboo PheXTH2 protein according to claim 1.

3. The nucleic acid according to claim 2, characterized in that Its nucleotide sequence is shown in SEQ ID NO.

2.

4. A biomaterial, characterized in that: It contains the bamboo PheXTH2 protein described in claim 1, or the nucleic acid described in claim 2 or 3; the biological material is recombinant DNA, expression cassette, transposon, plasmid vector, virus vector, engineered bacteria or non-renewable plant cells or tissues.

5. Use of the bamboo PheXTH2 protein according to claim 1, the nucleic acid according to claim 2 or 3, or the biomaterial according to claim 4 in regulating the thickness of plant stem cell walls.

6. The use according to claim 5, characterized in that: The plant includes Arabidopsis thaliana or bamboo.

7. The use according to claim 5, characterized in that: The expression level or activity of the bamboo PheXTH2 protein is increased to increase the thickness of the plant stem cell wall; or the expression level or activity of the bamboo PheXTH2 protein is reduced or eliminated to reduce the thickness of the plant stem cell wall.

8. Use of the bamboo PheXTH2 protein according to claim 1, the nucleic acid according to claim 2 or 3, or the biological material according to claim 4 in preparing transgenic plants.

9. Use of the bamboo PheXTH2 protein according to claim 1, the nucleic acid according to claim 2 or 3, or the biomaterial according to claim 4 in plant breeding.

10. A method for regulating the thickness of plant stem cell walls, characterized in that: include: By using genetic engineering means, the expression level or activity of the bamboo PheXTH2 protein or its encoding gene is increased in plants to increase the thickness of the plant stem cell wall; or, the expression level or activity of the bamboo PheXTH2 protein or its encoding gene is reduced or eliminated to reduce the thickness of the plant stem cell wall.

Images