Corn nitrate reductase and xanthine dehydrogenase cofactor 2 protein gene ZmCNX2 and application thereof

Abstract

The invention is suitable for the technical fields of molecular biology and biology, and provides a corn nitrate reductase and xanthine dehydrogenase cofactor 2 protein gene ZmCNX2 and application thereof. The nucleotide sequence of the ZmCNX2 gene is as shown in SEQ ID NO: 1, and the amino acid sequence of the cofactor 2 protein of nitrate reductase and xanthine dehydrogenase encoded by the ZmCNX2 gene is as shown in SEQ ID NO: 2. The invention discovers that the mutant of the ZmCNX2 gene in corn shows the phenotype of germination before harvesting; compared with wild type arabidopsis thaliana seeds, the transgenic arabidopsis thaliana seeds are obviously delayed in germination. The results show that lack of the ZmCNX2 gene can cause corn seeds to lack dormancy and directly germinate on clusters, and overexpression of the ZmCNX2 gene in arabidopsis thaliana can delay seed germination, so that the core position of the gene in seed dormancy and germination regulation is further verified.

Description

Technical Field

[0001] The invention belongs to the field of molecular biology and biotechnology, and particularly relates to a cofactor 2 protein gene ZmCNX2 of corn nitrate reductase and xanthine dehydrogenase and an application thereof. Background Art

[0002] Maize (Zea mays L.), as an important grain crop, is widely grown around the world. However, viviparous phenotype, as a grain trait that is harmful to crops, is common in crops such as maize, wheat and rice, which may lead to a significant decrease in crop yield and economic losses. Especially in maize, if the ear sprouts before harvest, it will lead to the loss of starch, protein and oil, and also produce carcinogens during processing. Therefore, grains with sprouted ears are prone to deterioration and pose a threat to human health. Normal dormancy of seeds at harvest is crucial for seed storage and food safety.

[0003] Studies have shown that changes in the content of abscisic acid (ABA) and gibberellins during the maturity stage of seeds are the main reasons for their early germination. Abscisic acid is a key plant hormone that affects seed germination, dormancy and viviparity. A series of viviparous mutants lead to the phenotype of ear germination by regulating the biosynthesis pathway of abscisic acid. In maize, these viviparous mutants are mainly divided into two categories: the first type of mutants, in addition to the phenotype of ear germination, the endosperm and seedlings of the corn kernels also show a white or light yellow phenotype; the second type of mutants have a normal yellow endosperm and normal green leaves. The last step of abscisic acid biosynthesis is catalyzed by abscisic aldehyde oxidase 3, which oxidizes abscisic aldehyde to abscisic acid. Therefore, the activity of abscisic aldehyde oxidase 3 is essential for the biosynthesis of abscisic acid. Molybdenum cofactor is required for the production of aldehyde oxidase activity, so insufficient molybdenum cofactor content will lead to a decrease in abscisic acid content. The ZmCNX2 gene in maize encodes GTP 3', 8-cyclase, which catalyzes the first step of molybdenum cofactor biosynthesis. It catalyzes the formation of a unique free radical CC bond between the initial substrate GTP and S-adenosyl-L-methionine to produce a unique cyclic nucleotide 3', 8-cH2GTP (38), which is then rearranged in the mitochondria by cyclopyranopterin monophosphate synthase to produce a pyranopterin ring, forming the first stable intermediate cyclopyranopterin monophosphate. Cyclopyranopterin monophosphate is then transported to the cytoplasm to synthesize a molybdenum cofactor, thereby participating in the biosynthesis of abscisic acid.

[0004] In Arabidopsis, mutants of the gene AtCNX2 homologous to ZmCNX2 show a significant retardation when grown on a standard sucrose medium, with yellowing of the seedling leaves and a phenotype that cannot stretch normally. However, in corn, the mutant phenotype of ZmCNX2 and its specific function are still unknown. To this end, the present invention proposes a cofactor 2 protein gene ZmCNX2 of corn nitrate reductase and xanthine dehydrogenase and its application. Summary of the invention

[0005] The purpose of the present invention is to provide a cofactor 2 protein gene ZmCNX2 of corn nitrate reductase and xanthine dehydrogenase and its application, aiming to solve the problems raised in the above background technology.

[0006] To achieve the above object, the present invention provides the following technical solutions:

[0007] The amino acid sequence of the cofactor 2 protein of corn nitrate reductase and xanthine dehydrogenase is shown in SEQ ID NO:2.

[0008] The nucleotide sequence of the corn nitrate reductase and xanthine dehydrogenase cofactor 2 protein gene ZmCNX2 is shown in SEQ ID NO: 1, and it encodes the corn nitrate reductase and xanthine dehydrogenase cofactor 2 protein mentioned above.

[0009] Application of maize nitrate reductase and xanthine dehydrogenase cofactor 2 protein gene ZmCNX2 in regulating seed germination and dormancy.

[0010] Furthermore, when the corn nitrate reductase and xanthine dehydrogenase cofactor 2 protein gene ZmCNX2 is deficient, the corn seeds lack dormancy and present a phenotype of germination before harvest.

[0011] Furthermore, overexpression of the corn nitrate reductase and xanthine dehydrogenase cofactor 2 protein gene ZmCNX2 can delay the germination of Arabidopsis seeds.

[0012] Further, the following steps are included:

[0013] The entry vector pDONR207 connected to the correctly sequenced ZmCNX2 gene was recombined with the pEarleyGate101 expression vector using LR enzyme to form the ZmCNX2 plant expression vector; the ZmCNX2 plant expression vector was then transformed into Escherichia coli, positive colonies were picked, the recombinant pEarleyGate101 plasmid was confirmed by PCR detection, and it was transformed into Agrobacterium GV3101, the positive strain was confirmed by PCR detection, and it was frozen for use.

[0014] Compared with the prior art, the present invention has the following beneficial effects:

[0015] The present invention provides a ZmCNX2 gene closely related to the germination and dormancy of corn seeds, which encodes a cofactor 2 protein of nitrate reductase and xanthine dehydrogenase. Its mutant in corn exhibits a phenotype of germination before harvest, and a plant expression vector containing the ZmCNX2 gene is constructed, which is successfully introduced into Arabidopsis thaliana by an Agrobacterium-mediated transformation method to obtain a homozygous T3 transgenic Arabidopsis thaliana plant. Through a seed germination experiment conducted on a 1 / 2MS culture medium, it is found that the germination of transgenic Arabidopsis thaliana seeds is significantly delayed compared with wild-type Arabidopsis thaliana seeds. These results not only further confirm the important role of the ZmCNX2 gene in regulating seed germination, but also indicate that the lack of the gene can cause corn seeds to lack dormancy and germinate directly on the cob, while overexpression of the ZmCNX2 gene in Arabidopsis thaliana can delay seed germination, which further verifies the core position of the gene in seed dormancy and germination regulation. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 A multiple sequence alignment at the amino acid level was performed for the maize ZmCNX2 gene in different crops (sorghum, rice, wheat) and Arabidopsis.

[0017] Figure 2 Schematic diagram of the phylogenetic tree analysis of the maize ZmCNX2 gene.

[0018] Figure 3 The figures are phenotypes of maize ZmCNX2 mutants; A is the heterozygous ear phenotype at 15, 30 and 45 days after pollination; B is the wild-type and mutant grain phenotype at 30 and 45 days after pollination; C is the wild-type and mutant embryo phenotype at 20, 25, 30, 35, 40 and 45 days after pollination.

[0019] Figure 4 Determination of abscisic acid content in maize ZmCNX2 mutant vpm

[0020] Figure 5 To determine the relative expression levels of genes related to abscisic acid synthesis in the maize ZmCNX2 mutant vpm.

[0021] Figure 6 The figures are statistical graphs of germination rates of strains heterologously expressing the maize ZmCNX2 gene in Arabidopsis; A is the phenotype graph of three Arabidopsis strains overexpressing ZmCNX2 germinated on 1 / 2MS medium for 3 and 5 days; B is the germination rate statistical graph of three Arabidopsis strains overexpressing ZmCNX2 grown on 1 / 2MS medium for 3 days; C is the whole plant length statistical graph of three Arabidopsis strains overexpressing ZmCNX2 grown on 1 / 2MS medium for 5 days. DETAILED DESCRIPTION

[0022] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0023] The specific implementation of the present invention is described in detail below in conjunction with specific embodiments.

[0024] Example 1: Cloning of the cofactor 2 protein gene ZmCNX2 of maize nitrate reductase and xanthine dehydrogenase;

[0025] 1. RNA extraction;

[0026] Total RNA was extracted from the embryos of mature seeds of maize inbred line B73 using the Ultrapure RNA Extraction Kit (CW0581) from Cornwell. The specific steps are as follows:

[0027] (1) Take the soaked seed embryos, grind them thoroughly in liquid nitrogen, add 1 ml of TRIzon Reagent for every 30-50 mg of tissue, and mix well.

[0028] (2) Gently invert the sample with TRIzon Reagent several times to fully lyse the sample. Leave it at room temperature for 5 minutes to completely separate the protein-nucleic acid complex.

[0029] (3) Add 200 μl of chloroform, cover the centrifuge tube, shake vigorously for 15 seconds, and leave at room temperature for 2 minutes.

[0030] (4) Centrifuge at 12,000 rpm for 10 min at 4°C, aspirate 550 μl of the upper aqueous phase and transfer it to a new RNase-Free centrifuge tube.

[0031] (5) Add 550 μl of 70% ethanol (prepared with RNase-Free Water) to the aqueous phase solution and mix by inversion.

[0032] (6) Add all the solution obtained in the previous step to the adsorption column (Spin Columns RM) in the collection tube. If the solution cannot be added in one go, add it in multiple times. Centrifuge at 12,000 rpm for 20 seconds, discard the waste liquid in the collection tube, and put the adsorption column back into the collection tube.

[0033] (7) Add 700 μl of Buffer RW1 to the adsorption column, centrifuge at 12,000 rpm for 20 s, discard the waste liquid in the collection tube, and return the adsorption column to the collection tube.

[0034] (8) Add 500 μl of Buffer RW2 to the adsorption column (check whether anhydrous ethanol has been added before use), centrifuge at 12,000 rpm for 20 s, pour out the waste liquid in the collection tube, and put the adsorption column back into the collection tube.

[0035] (9) Repeat step (8).

[0036] (10) Centrifuge at 12,000 rpm for 2 min and discard the waste liquid in the collection tube. Leave the adsorption column at room temperature for several minutes to dry thoroughly.

[0037] (11) Place the adsorption column in a new RNase-Free centrifuge tube, add 30-50 μl RNase-Free Water to the middle part of the adsorption column, incubate at room temperature for 1 min, centrifuge at 12,000 rpm for 1 min, collect the RNA solution, and store it at -80 °C to prevent degradation.

[0038] 2. Reverse transcription;

[0039] The extracted RNA was reverse transcribed using US EVERBRIGHT RT mix with DNase (All-in One). The system is as follows:

[0040] Table 1 Reverse transcription system

[0041] Reagents volume 5×RTAll-in-OneMix 4μl DNase 1μl Template RNA 1μl RNaseFreeWater 14μl 20μl (total volume)

[0042] Place the entire system into a PCR instrument and set the program to: 37°C, 2 min; 55°C, 15 min; 85°C, 5 min.

[0043] 3. Amplification of the full-length open reading frame (ORF) of the ZmCNX2 gene;

[0044] According to the coding sequence of maize ZmCNX2 published in the Ensembl plant database, specific cloning primers for the gene were designed as follows:

[0045] ZmCNX2-F: ATGATGCGACGCTGCGTC (as shown in SEQ ID NO: 3)

[0046] ZmCNX2-R:TCAGCCACCTATATGTATCATGGG (as shown in SEQ ID NO: 4)

[0047] Using the cDNA obtained by reverse transcription as a template, high-fidelity heat-resistant DNA polymerase PrimeSTAR GXL DNA polymerase was used to clone ZmCNX2. The reaction system was as follows:

[0048] Table 2 Reaction system

[0049] Components volume 5× PrimeSTARGXL Buffer 10μl dNTPMixture 4μl ZmCNX2-F 1.5μl ZmCNX2-R 1.5μl cDNA 2μl PrimeSTARGXLDNAPolymerase 1μl Sterile distilled water 30μl

[0050] The PCR reaction program was 98°C, 10 s; 60°C, 15 s; 68°C, 1 min 10 s; 35 cycles; 68°C, 7 min; 16°C, 1 min.

[0051] The amplified product was subjected to electrophoresis detection, and an amplified band was found at around 1179 bp (the 3 bp base encoding the stop codon had been removed), which was consistent with the expected target gene size.

[0052] 4. ZmCNX2 was connected to pDONR207 vector;

[0053] The target fragment ZmCNX2 was connected to the pDONR207 vector by seamless cloning using the Ready-to-Use Seamless Cloning Kit to obtain a recombinant vector.

[0054] The ligation reaction system is as follows:

[0055] Table 3 Ligation reaction system

[0056] Reagents Dosage Target gene fragment 1.5μl pDONR207 vector 1μl Mix 2.5μl

[0057] 5. DH5α E. coli competent transformation and bacterial liquid PCR detection;

[0058] (1) Thaw 50 μl of DH5α competent E. coli on ice.

[0059] (2) Use a pipette to take 5 μl of the ligation product or recombinant plasmid and add it to 50 μl of DH5α E. coli competent cells.

[0060] (3) After a 30-min ice bath, heat shock was performed at 42°C for 90 s, followed by an ice bath for 5 min. 800 μl of LB liquid culture medium was then added.

[0061] (4) Incubate at 37°C with shaking for 1 hour, then centrifuge at 8000 rpm for 5 minutes. Discard the supernatant and keep about 50 μl of the culture medium in the centrifuge tube. Mix well by pipetting, then spread on LB solid culture medium containing the corresponding antibiotics, and incubate at 37°C with an inverted incubator for 12-16 hours.

[0062] (5) Pick a single colony and place it in 800 μl of LB liquid culture medium containing the corresponding antibiotics. Place the centrifuge tube in a shaker and culture at 37°C and 180 rpm for about 10 h.

[0063] (6) Perform PCR molecular detection on the bacterial solution using Ex Taq enzyme. The bacterial solution with positive PCR results was amplified and 15% glycerol was added to the bacterial solution, which was sent to Bio-Gene for sequencing. The original bacterial solution was stored in a -80 refrigerator.

[0064] Example 2: Bioinformatics analysis of maize ZmCNX2 gene;

[0065] like Figure 1 and Figure 2 As shown, we performed multiple sequence alignment and phylogenetic tree analysis at the amino acid level for the ZmCNX2 gene in different crops (sorghum, rice, wheat) and Arabidopsis. The results showed that ZmCNX2 was highly conserved among different species, and had the highest homology with the homologous gene in sorghum, and a homology of 79.85% with the homologous protein AtCNX2 in Arabidopsis.

[0066] Example 3: Phenotypic observation of maize ZmCNX2 gene mutants;

[0067] Phenotypic observations were made on the EMS mutant vpm of the ZmCNX2 gene in maize. Compared with the B73 inbred line, the mutant did not have normal seed dormancy and viviparous seeds could be observed before harvest. Figure 3 As shown in A and B, there was no significant difference between the mutant and normal seeds at 15 days after pollination. However, at 30 days after pollination, the two could be distinguished in the heterozygous ears, at which time the mutant had begun to show a germination phenotype, but the buds did not break the seed coat. Until 45 days after pollination, the roots and shoots in the mutant kernels were significantly elongated. We obtained embryos of wild type and mutants at different pollination times and observed their growth. Figure 3 As shown in C, during seed development and maturation, starting from about 25 days after pollination, the embryos of the mutant began to germinate and grow compared to the wild type that entered dormancy. The above results show that in maize, mutations in the ZmCNX2 gene can cause maize seeds to fail to enter normal dormancy, thus presenting a phenotype of germination before harvest.

[0068] Example 4: Determination of abscisic acid content in maize ZmCNX2 mutant vpm;

[0069] Previous studies have shown that maize viviparous mutants exhibit defects in ABA biosynthesis, and ZmCNX2 is also indirectly involved in ABA biosynthesis. To test whether the pre-harvest germination phenotype of the mutant is related to ABA deficiency, we measured the ABA content in embryos of wild type (WT) and mutant (vpm) at 30 days after pollination by LC-MS / MS. Figure 4 As shown, the results showed that the abscisic acid content in mutant embryos was significantly lower than that in the wild type, about 1 / 15 of that in the wild type.

[0070] Example 5: Determination of the expression of genes related to abscisic acid synthesis in the maize ZmCNX2 mutant vpm;

[0071] For gene expression analysis, embryos were isolated from immature seeds 30 days after pollination and stored at -80°C. Total RNA from the samples was extracted, and first-strand cDNA was synthesized using the Ultrapure RNA Kit and the UEIris II First-Strand cDNA Synthesis Kit. Fluorescence quantitative PCR experiments were performed using 2x SYBR Green qPCR Master Mix to quantitatively determine the expression levels of ZEP, NCED9, VP14, AO3, ABH4, and ABH5. The maize ZmGAPDH gene was used as an internal reference gene. Figure 5 As shown, compared with the wild type, the expression levels of ZEP and NCED9 involved in abscisic acid biosynthesis in the mutant were higher, while the expression levels of VP14 and AO3 were lower. In addition, we also found that the expression levels of ABHD4 and ABHD5 involved in abscisic acid metabolism in the mutant were decreased.

[0072] Example 6: Construction of ZmCNX2 plant expression vector;

[0073] The recombinant pDONR207 plasmid containing the ZmCNX2 gene fragment that had been sequenced correctly was processed and cloned using Gateway TM LR Clonase TM ∥Enzyme mix connects the target gene fragment to the plant expression vector pEarleyGate101 through recombination exchange. The reaction system is as follows:

[0074] Reagents Dosage pEarleyGate101 2μl pDNOR207-ZmCNX2 2.5μl LREnzyme 0.5μl

[0075] The reaction system was placed in a connector and reacted at 25°C for 3 hours for transformation of E. coli. Positive colonies were picked, and the recombinant pEarleyGate101 plasmid was confirmed by PCR detection, and transformed into Agrobacterium GV3101. The positive strains were confirmed by PCR detection and frozen for future use.

[0076] Example 7: Acquisition and molecular detection of ZmCNX2 gene-transfected Arabidopsis thaliana;

[0077] The floral dipping method was used to transform Arabidopsis thaliana. The specific steps are as follows:

[0078] (1) Invert the flowering Arabidopsis plant with the flower bud facing downward and inoculate it with Agrobacterium solution for 2 minutes.

[0079] (2) Lay the transformed Arabidopsis plants flat, cover them with plastic wrap, grow them under low light intensity for 24 hours, and then culture them under normal light conditions. One week later, infect the plants again using the same procedure as above.

[0080] (3) The transformed plants can bloom and grow normally, and the seeds can be harvested when the siliques are completely yellow and about to crack.

[0081] (4) After Basta screening and PCR identification, some of the harvested T0 generation seeds were used to obtain T1 generation transgenic plants. After two generations of additional generations and screening, T3 generation Arabidopsis plants were obtained, which can be used for subsequent phenotypic identification.

[0082] Example 8: Statistics of germination rate of T3 generation ZmCNX2 gene-transfected Arabidopsis;

[0083] Wild-type (WT) and ZmCNX2-transgenic Arabidopsis T3 seeds (OE1, OE2, OE3) were sterilized and sown on solid 1 / 2MS medium. After 3 days of low-temperature vernalization, they were transferred to the Arabidopsis culture room for further germination. Starting from 12 hours after the seeds were placed, the seeds were counted every 12 hours to observe the germination and record the seed germination rate. Figure 6 As shown in Figures AC, the results showed that the germination rate of Arabidopsis seeds overexpressing the ZmCNX2 gene was significantly slowed down compared with wild-type seeds, indicating that overexpression of the ZmCNX2 gene can delay the germination of Arabidopsis seeds.

[0084] In summary, the present invention successfully obtained a cofactor 2 protein gene ZmCNX2 of corn nitrate reductase and xanthine dehydrogenase from the corn inbred line B73. By adopting the Agrobacterium-mediated transformation method, the present invention successfully introduced the plant expression vector containing the ZmCNX2 gene into Arabidopsis thaliana, and obtained homozygous T3 transgenic Arabidopsis thaliana plants. The results of the germination experiment showed that the germination of transgenic Arabidopsis thaliana seeds was significantly delayed compared with wild-type Arabidopsis thaliana seeds. These results indicate that the cofactor 2 protein gene ZmCNX2 of corn nitrate reductase and xanthine dehydrogenase affects ABA synthesis, and the mutation of this gene will cause corn ears to germinate before harvest. In addition, ectopic expression of ZmCNX2 in Arabidopsis thaliana can delay the germination of Arabidopsis thaliana seeds.

[0085] The above are only preferred embodiments of the present invention. It should be pointed out that, for those skilled in the art, several modifications and improvements can be made without departing from the concept of the present invention. These should also be regarded as the protection scope of the present invention. These will not affect the effect of the implementation of the present invention and the practicality of the patent.

Claims

1. A cofactor 2 protein of maize nitrate reductase and xanthine dehydrogenase, characterized in that Its amino acid sequence is shown in SEQ ID NO:

2.

2. The cofactor 2 protein gene ZmCNX2 of maize nitrate reductase and xanthine dehydrogenase, characterized in that: The nucleotide sequence thereof is shown in SEQ ID NO: 1, which encodes the cofactor 2 protein of corn nitrate reductase and xanthine dehydrogenase according to claim 1.

3. Use of the corn nitrate reductase and xanthine dehydrogenase cofactor 2 protein gene ZmCNX2 according to claim 2 in regulating seed germination and dormancy.

4. The use according to claim 3, characterized in that: When the corn nitrate reductase and xanthine dehydrogenase cofactor 2 protein gene ZmCNX2 is deficient, the corn seeds lack dormancy and present a phenotype of germination before harvest.

5. The use according to claim 3, characterized in that: Overexpression of the corn nitrate reductase and xanthine dehydrogenase cofactor 2 protein gene ZmCNX2 can delay the germination of Arabidopsis seeds.

6. The use according to claim 3, characterized in that: The following steps are involved: The entry vector pDONR207 connected to the correctly sequenced ZmCNX2 gene was recombined with the pEarleyGate101 expression vector using LR enzyme to form the ZmCNX2 plant expression vector; the ZmCNX2 plant expression vector was then transformed into Escherichia coli, positive colonies were picked, the recombinant pEarleyGate101 plasmid was confirmed by PCR detection, and it was transformed into Agrobacterium GV3101, the positive strain was confirmed by PCR detection, and it was frozen for use.

Images