Gene EVM0016124 and its application in determining the dormancy degree of Lonicera japonica seeds

Abstract

The present invention provides a gene EVM0016124 and its application in determining the dormancy degree of honeysuckle seeds. The nucleotide sequence of the gene EVM0016124 is shown in SEQ ID NO.1, and the dormancy degree of honeysuckle seeds can be determined by the expression level of the gene.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to a gene EVM0016124 and an application thereof in determining the dormancy degree of honeysuckle seeds. Background Art

[0002] Lonicera maackii is a shrub or small tree of the genus Lonicera in the family Caprifoliaceae. It is a common tree species in my country and one of the four major ornamental tree species in landscaping. Its fruit does not fall even when snow falls, making it a major ornamental tree species in winter with extremely high ornamental value. In addition, the leaves of Lonicera maackii can be used to extract gum, the stem bark can be used to make artificial cotton, the seed oil can be used to make soap, and the flowers and young leaves can be used to extract aromatic oils. It is also an excellent source of nectar, and the nectar has the effect of clearing away heat and detoxifying, and has great medicinal value. In short, Lonicera maackii has great value in many aspects.

[0003] Seed propagation is an important way to breed Lonicera japonica. However, due to the different degrees of dormancy of Lonicera japonica seeds, the plants grow unevenly, the seedlings are uneven, and there are missing seedlings, broken ridges, and empty cups, which brings certain difficulties to seedling production. Therefore, knowing the dormancy degree of Lonicera japonica seeds during the breeding process will greatly facilitate seedling work. The germination rate of Lonicera japonica seeds is usually used to determine the dormancy degree of seeds, but the results are often affected by individual differences in seeds, environmental and human factors, and the results are not accurate and have poor repeatability. In recent years, with the deepening of molecular biology research, some genes have been regarded as molecular markers related to seed dormancy, but marker genes that can determine the dormancy degree of Lonicera japonica seeds have not yet been found in Lonicera japonica. Summary of the invention

[0004] The present invention aims to solve one of the technical problems in the related art to at least a certain extent. In the breeding process of Lonicera japonica, the germination rate of Lonicera japonica seeds is usually used to determine the dormancy degree of seeds, but the results are often affected by individual differences in seeds, environment and human factors, and the results are not accurate and have poor repeatability. With the deepening of molecular biology research, some molecular marker genes considered to be related to seed dormancy have been discovered one after another, but marker genes that can determine the dormancy degree of Lonicera japonica seeds have not been found in Lonicera japonica. In view of this, the inventors of the present invention discovered a gene EVM0016124 in Lonicera japonica through research. The dormancy degree of Lonicera japonica seeds can be efficiently and accurately determined by the expression of this gene in Lonicera japonica seeds.

[0005] Specifically, the present invention provides the following technical solutions:

[0006] In a first aspect of the present invention, a reagent for detecting the expression of gene EVM0016124 is provided for use in determining the dormancy degree of Lonicera japonica seeds. The nucleotide sequence of gene EVM0016124 is shown in SEQ ID NO.1.

[0007] In some embodiments of the present invention, specific primers are used to amplify the expression level of gene EVM0016124 in the test sample and the reference sample, and the dormancy degree of Honeysuckle seeds is determined by comparing the expression levels of gene EVM0016124 in the test sample and the reference sample, wherein the expression level of gene EVM0016124 in dormant seeds is lower than that in dormancy-released seeds.

[0008] In some embodiments of the present invention, the reference samples include dormant seed samples and dormancy-released seed samples;

[0009] The dormant seed sample is a sample obtained by soaking the honeysuckle seeds in clean water at 37°C for 12 hours;

[0010] The dormancy-released seed samples are obtained by soaking the honeysuckle seeds in clean water at 37° C. for 12 hours and then keeping them away from light at 4° C. for 20 days.

[0011] In some embodiments of the present invention, the specific primer includes an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown as SEQ ID NO.2, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO.3.

[0012] In a second aspect of the present invention, a method for determining the dormancy degree of honeysuckle seeds is provided, comprising the following steps:

[0013] Using the cDNA of the sample to be tested and the cDNA of the reference sample as templates, respectively using specific primers to amplify the EVM0016124 gene, and counting the expression levels of the EVM0016124 gene in the sample to be tested and the reference sample;

[0014] Based on the difference between the expression level of the EVM0016124 gene in the test sample and the expression level of the EVM0016124 gene in the reference sample, the dormancy level of the test sample is determined.

[0015] In some embodiments of the present invention, the reference samples include dormant seed samples and dormancy-released seed samples;

[0016] When there is no significant difference between the expression amount of the EVM0016124 gene in the test sample and the expression amount of the EVM0016124 gene in the reference sample, it is determined that the dormancy degree of the test sample is the same as that of the reference sample;

[0017] When the expression level of the EVM0016124 gene in the sample to be tested is significantly lower than the expression level of the EVM0016124 gene in the dormant seed sample in the reference sample, it is determined that the dormancy level of the sample to be tested is higher than that of the reference sample;

[0018] When the expression level of the EVM0016124 gene in the sample to be tested is significantly higher than the expression level of the EVM0016124 gene in the dormancy-released seed sample in the reference sample, it is determined that the dormancy level of the sample to be tested is lower than that of the reference sample.

[0019] In some embodiments of the present invention, the significant difference includes a significant difference when P<0.05.

[0020] In some embodiments of the present invention, the dormant seed sample is a sample obtained by soaking honeysuckle seeds in clean water at 37°C for 12 hours;

[0021] The dormancy-released seed samples are obtained by soaking the honeysuckle seeds in clean water at 37° C. for 12 hours and then keeping them away from light at 4° C. for 20 days.

[0022] In a third aspect of the present invention, a reagent for detecting the expression of gene EVM0016124 is provided for use in preparing a kit for determining the dormancy degree of honeysuckle seeds. The nucleotide sequence of gene EVM0016124 is shown in SEQ ID NO.1.

[0023] In a fourth aspect of the present invention, a kit is provided, comprising: a reagent for detecting the expression of gene EVM0016124, wherein the reagent comprises specific primers, and the specific primers comprise an upstream primer shown in SEQ ID NO.2 and a downstream primer shown in SEQ ID NO.3.

[0024] In the fifth aspect of the present invention, an isolated nucleic acid molecule is provided, wherein the nucleic acid molecule has the sequence shown in SEQ ID NO.1.

[0025] The beneficial effects achieved by the present invention are at least:

[0026] The present invention provides a dormancy marker gene EVM0016124 for honeysuckle seeds, which is obtained by high-throughput sequencing and analysis screening using honeysuckle seeds with different dormancy degrees as sample materials. The expression level of the gene in dormant seeds is lower than that in dormancy-released seeds. By comparing the expression level of the EVM0016124 gene in the sample to be tested and the reference sample, the dormancy degree of the sample to be tested can be accurately determined. It has been confirmed by experiments that the dormancy degree of honeysuckle seeds can be accurately determined using the EVM0016124 gene. The present invention has higher accuracy, stronger scientificity and good repeatability in determining the dormancy degree of honeysuckle seeds. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 The germination rate results of seeds after different treatments provided in the embodiments of the present invention are shown.

[0028] Figure 2 It is the expression amount of the EVM0016124 gene in dormant seeds and dormancy-released seeds provided by the embodiments of the present invention. DETAILED DESCRIPTION

[0029] Embodiments of the present invention are described in detail below. Examples of the embodiments are shown in the accompanying drawings. The embodiments described below with reference to the accompanying drawings are exemplary and are intended to be used to explain the present invention, but should not be construed as limiting the present invention.

[0030] The present invention provides a Lonicera japonica seed dormancy marker gene EVM0016124, and the nucleotide sequence of the marker gene EVM0016124 is shown in SEQ ID NO.1.

[0031] >EVM0016124 coding sequence (SEQ ID NO.1)

[0032] ATGGCAGCAAGTGCAAACAGAATACTCTTCTTGTTGCTTTTGTCTCTTCTTCTCTTGATTACATTCTCCACTGCATTTGAGGGCTACAATAGACTTCAGCCATCTTTAAATAGATGCTCGGCCACATCGCACAAG AAGCCGTGTATGTTCTTTTGCCTAAAGTGTTGCTCGAAATGCTTGTGCGTACCACCAGGCACTTATGGCAACAACAAACATGCCCTTGCTACAACAACTGGAAGACCCAACAAGGCGGTCCTAAATGCCCTTAA

[0033] The present invention also provides the use of the gene EVM0016124 in determining the dormancy degree of honeysuckle seeds. The expression level of the gene EVM0016124 in dormant seeds is lower than that in dormancy-released seeds.

[0034] In the present invention, the expression amount of gene EVM0016124 in the test sample and the reference sample is used by using specific primers, and the dormancy degree of honeysuckle seeds is determined by comparing the expression amount of gene EVM0016124 in the test sample and the reference sample. In the present invention, the primer set is preferably designed according to gene EVM0016124, the nucleotide sequence of the upstream primer in the primer set is shown in SEQ ID NO.2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.3. In the present invention, the varieties of the test sample and the reference sample are preferably the same.

[0035] The reference samples mentioned include dormant seeds and dormancy-released seeds. According to a specific embodiment, the germination rate of the dormant seeds is less than 10% in 7 days, and the germination rate in 20 days is less than 50%. The germination rate of dormancy-released seeds is higher than 90% in 7 days, and the germination rate in 20 days is higher than 95%. According to a specific embodiment, the dormant seeds are seeds soaked in 37°C water for 12 hours; the dormancy-released seeds are seeds soaked in 37°C water for 12 hours and then protected from light at 4°C for 20 days. The present invention uses the expression level of the EVM0016124 gene in the reference sample as a standard for determining the dormancy degree of Honeysuckle seeds. In the present invention, the determination method is preferably real-time fluorescence quantitative PCR.

[0036] The present invention determines the dormancy degree of honeysuckle seeds by comparing the expression amount of gene EVM0016124 in the sample to be tested and the reference sample. The determination method is: when there is no significant difference between the expression amount of gene EVM0016124 in the sample to be tested and the expression amount of gene EVM0016124 in the reference sample, it is determined that the dormancy degree of the sample to be tested is the same as that of the reference sample; when the expression amount of gene EVM0016124 in the sample to be tested is significantly lower than the expression amount of gene EVM0016124 in the dormant seed sample in the reference sample, it is determined that the dormancy degree of the sample to be tested is higher than that of the reference sample; when the expression amount of gene EVM0016124 in the sample to be tested is significantly higher than the expression amount of gene EVM0016124 in the dormant seed release seed in the reference sample, it is determined that the dormancy degree of the sample to be tested is lower than that of the reference sample (the significant difference includes the significant difference when P<0.05).

[0037] The present invention also provides a method for screening the above-mentioned honeysuckle seed dormancy marker gene EVM0016124, the screening method comprising the following steps:

[0038] The seeds of Lonicera japonica with different dormancy degrees were used as sample materials, and the gene data of Lonicera japonica seeds with different dormancy degrees were obtained through RNA extraction, library construction, and transcriptome sequencing.

[0039] The obtained genetic data were subjected to data quality control, reference genome comparison, and gene expression analysis in sequence to obtain the honeysuckle seed dormancy marker gene EVM0016124.

[0040] The sample materials mentioned are seeds of Honeysuckle with different dormancy levels.

[0041] According to a specific implementation, the honeysuckle seeds with different dormancy levels include dormancy seeds (Dormancy, D) and dormancy release seeds (Dormancy Release, DR). Dormancy seeds are seeds that have been soaked in 37°C water for 12 hours, and dormancy release seeds are seeds that have been soaked in 37°C water for 12 hours and then kept away from light at 4°C for 20 days.

[0042] The present invention does not specifically limit the RNA extraction, library construction, and transcriptome sequencing, and the RNA extraction method, library construction method, and transcriptome sequencing platform conventional in the art may be used for the extraction.

[0043] The obtained gene data is subjected to data quality control, reference genome alignment, and gene expression analysis in sequence to obtain the Lonicera maackii seed dormancy marker gene EVM0016124. In the present invention, the reference genome is preferably the high-quality genome Lonicera maackii whole genome sequencing (https: / / ngdc.cncb.ac.cn / gsa / search?searchTerm="CRA010924") of Lonicera maackii. In the present invention, the quality-controlled data is compared with the reference genome to obtain matching data, and then the matching data is analyzed for expression. In the present invention, the gene expression analysis preferably includes the following steps: mapping the clean reads of each sample to the Lonicera maackii reference genome to obtain the expression level of mRNA, using StringTie through the maximum flow algorithm, and using FPKM (Fragments Per Kilobase of transcript per Million fragments mapped) for normalization as an indicator for measuring the transcript or gene expression level.

[0044] In order to make the purpose, technical scheme and advantages of the present invention more clearly understood, the present invention is described in detail below in conjunction with the embodiments, but they should not be construed as limiting the scope of protection of the present invention. In the following embodiments, unless otherwise specified, all conventional methods are used. The materials, reagents, etc. used in the following embodiments, unless otherwise specified, can all be obtained from commercial sources.

[0045] Preparation before the experiment:

[0046] Honeysuckle seeds: Honeysuckle (Lonicera maackii) seeds were collected on the campus of Beijing Forestry University. After collection in winter, the peel and pulp were removed by hand washing, rinsed and placed in a 28℃ incubator for 10 days, and then dried and stored at room temperature.

[0047] The seeds obtained above were treated by the following method to prepare seeds after different treatments:

[0048] Dormant seeds (D): Soak the seeds in 37℃ water for 12 hours, and then place them evenly in a petri dish with eight layers of gauze (the gauze has been sterilized at high temperature). Add sterilized distilled water to the petri dish to make the gauze saturated and moist. There are 25 seeds per dish, 4 dishes per group, and a total of 100 seeds.

[0049] Dormancy release seeds (DR): Soak the seeds in 37℃ water for 12 hours, then wrap them in moist gauze and store them at 4℃ in the dark for 20 days, then evenly place the seeds in a culture dish with eight layers of gauze (the gauze has been sterilized at high temperature), add sterile distilled water to the culture dish, and make the gauze saturated and moist. There are 25 seeds per dish, 4 dishes per group, and a total of 100 seeds.

[0050] The dormant seeds and dormancy-released seeds were cultured in an incubator at 22°C and 16 h / 8 h photoperiod, and the germination rate was counted daily. A 20-day germination experiment was conducted. The number of germinated seeds and moldy seeds was counted daily, the germination rate was calculated, and the germination curve was drawn.

[0051] The germination rate calculation formula is: [total number of germinations on the day / (total number of seeds in each group - total number of mildewed seeds on the day)], and the germination standard is that the radicle breaks through the seed coat.

[0052] Results Figure 1 ,Depend on Figure 1 It can be seen that seeds that were not treated at 4°C generally began to germinate on the 6th to 7th day, with a germination rate of less than 10% on the 7th day, and nearly half of the seeds had not germinated after 20 days. Seeds that were stored at 4°C in the dark for 20 days began to germinate within 3 days, with a germination rate of more than 90% after 7 days and more than 95% after 14 days. No new seeds germinated within 14-20 days. Therefore, seeds soaked in 37°C water for 12 hours can be regarded as dormant seeds, and seeds soaked in 37°C water for 12 hours, then wrapped in moist gauze and stored at 4°C in the dark for 20 days can be regarded as non-dormant seeds.

[0053] Example 1

[0054] Example 1 Screening of seed dormancy marker gene EVM0016124 by the following method:

[0055] 1) Obtaining seeds of honeysuckle with different dormancy levels

[0056] The seeds of Lonicera maackii were collected on the campus of Beijing Forestry University. After collection in winter, the peel and pulp were removed by hand washing, rinsed and placed in a 28℃ incubator for 10 days, and then dried and stored at room temperature. The dried seeds were soaked in 37℃ water for 12 hours and used as dormant seeds; the dried seeds were soaked in 37℃ water for 12 hours and then kept in dark at 4℃ for 20 days, which were used as dormancy-release seeds.

[0057] The above-mentioned dormant seeds and dormancy-released seeds were used as sample materials, with 3 biological replicates for each group of samples and 30 seeds for each replicate. After collection, they were immediately quick-frozen with liquid nitrogen and stored in an ultra-low temperature refrigerator at -80°C.

[0058] 2) RNA extraction, library construction, and transcriptome sequencing

[0059] The frozen seeds in 1) above were sent to Beijing Biomaike Cloud Technology Co., Ltd., and the total plant RNA was extracted using the RNA prep Pure Plant Total RNA Extraction Kit (Tiangen). After quality inspection, the transcriptome library was constructed, and the eukaryotic mRNA was enriched with magnetic beads with Oligo (dT), and the mRNA was randomly sheared by adding Fragmentation buffer. Using mRNA as a template, the first cDNA chain and the second chain were synthesized, and the cDNA was purified. The purified double-stranded cDNA was then end-repaired, A-tailed, and connected to the sequencing adapter, and then the fragment size was selected using AMPure XP beads. Finally, the cDNA library was enriched by PCR. After the library was constructed, the Qubit 3.0 fluorescence quantification instrument was used for preliminary quantification, and the concentration needed to reach more than 1ng / uL. Then, the Qsep400 high-throughput analysis system was used to detect the inserted fragments of the library. After the inserted fragments met expectations, the effective concentration of the library (library effective concentration>2nM) was accurately quantified using the Q-PCR method to ensure the quality of the library. After the library quality inspection was qualified, PE150 mode sequencing was performed using the Illumina NovaSeq6000 sequencing platform.

[0060] 3) Data quality control and reference genome comparison

[0061] The raw data (raw reads) were quality controlled to remove the reads containing adapters and low-quality reads (including reads with N ratio greater than 10% and reads with quality value Q≤10 accounting for more than 50% of the entire read). After the above series of quality controls, high-quality clean data was obtained.

[0062] The high-quality genome of Lonicera maackii (whole genome sequencing, https: / / ngdc.cncb.ac.cn / gsa / search?searchTerm="CRA010924") was used as the reference genome, and the quality control data was compared with it to obtain the matching data (mapped reads) for subsequent transcript assembly and expression analysis.

[0063] 4) Gene expression analysis

[0064] The clean reads of each sample were mapped to the Lonicera japonica reference genome to obtain the expression level of mRNA, and StringTie was used to perform the maximum flow algorithm and FPKM (Fragments Per Kilobase of transcript per Million fragments mapped) was used for normalization as an indicator to measure the expression level of transcripts or genes.

[0065] Through comparative analysis, it was found that the expression level of gene EVM0016124 in dormant seeds and dormancy-released seeds showed significant differences. The expression level of this gene can be used to indicate the dormancy degree of Lonicera japonica seeds.

[0066] Example 2

[0067] Example 2 verified the dormancy marker gene EVM0016124 found by screening in honeysuckle seeds, including the following contents:

[0068] (1) Obtaining seeds of Lonicera japonica with different dormancy levels

[0069] The seeds of Lonicera maackii were collected on the campus of Beijing Forestry University. After collection in winter, the peel and pulp were removed by hand washing, rinsed and placed in a 28℃ incubator for 10 days, and then dried and stored at room temperature. The seeds that were soaked in 37℃ water for 12 hours were used as dormant seeds, and the seeds that were soaked in 37℃ water for 12 hours and then kept away from light at 4℃ for 20 days were used as dormancy-released seeds.

[0070] (2) Extraction of total RNA from samples

[0071] RNA prep Pure Plant Total RNA Extraction Kit (Tiangen) was used to extract total RNA from the samples collected in step 1). RNA concentration and integrity were determined using a Nano micro-spectrophotometer and 1% agarose gel electrophoresis, respectively.

[0072] (3) Reverse transcription of total RNA of samples

[0073] In an RNase free PCR tube, complete the reverse transcription reaction of the total RNA obtained in step 2) and remove the genomic DNA. Prepare the reverse transcription system according to Table 1 below:

[0074] Heat for 5 seconds to completely inactivate RT / RI Enzyme and gDNA Remover, and store the product cDNA at -20℃.

[0075] (4) Real-time fluorescence quantitative PCR verification of EVM0016124 gene

[0076] The cDNA generated by reverse transcription in step 3) was diluted 8 times and used as a template, and qRT-PCR was performed according to the qRT-PCR reaction system and reaction conditions in Table 2 below:

[0077] Table 2 qRT-PCR reaction system

[0078] Composition Usage amount / µL 2 x SuperReal PreMix Plus (SYBR Green) 10µL Upstream primer (10 μM) 0.5µL Downstream primer (10 μM) 0.5µL Template cDNA (cDNA) 1µL RNase-free water 8µL Total 20µL

[0079] Note: The device model used for fluorescence quantitative PCR verification is: CFX Connect TM Optics Module, the specific equipment number is: 788BR04747; the software used for gene expression data analysis is: Bio-Rad CFX Manager.

[0080] The upstream primers and downstream primers used are:

[0081] Upstream primer: GCCACATCGCACAAGAAGC (SEQ ID NO. 2);

[0082] Downstream primer: TTAAGGGCATTTAGGACCGCC (SEQ ID NO. 3).

[0083] The SYBR Green chimeric fluorescence method was used for the reaction. The pre-denaturation reaction program was set as: 95°C pre-denaturation for 2 min, the PCR reaction program was set as: 94°C denaturation for 5 s, 60°C annealing for 30 s, 39 cycles; the melting curve analysis reaction program was set as 65-95°C with an increase of 0.5°C every 5 s;

[0084] Each sample to be tested was subjected to 3 technical replicates and 3 biological replicates, and an independent internal reference gene Pt18S was added to each plate of samples.

[0085] The expression level of EVM0016124 gene in dormant seeds and dormancy-released seeds was counted in the expression instrument, and the results are shown in Figure 2and Table 3.

[0086] Table 3 Expression levels of EVM0016124 gene in seeds with different treatments

[0087] sample Expression level of EVM0016124 gene Standard error Dormant seeds (D) 0.00046 0.00008 Dormant Release Seed (DR) 1.00000 0.05144

[0088] From Table 3 and Figure 2 It can be seen that compared with dormant seeds, the expression level of EVM0016124 gene in dormancy-released seeds is higher; the expression level of EVM0016124 gene in honeysuckle seeds is negatively correlated with the degree of dormancy, and increases with the release of dormancy of honeysuckle seeds.

[0089] In summary, the technical solution provided by the present invention can accurately determine the dormancy degree of the sample to be tested. Compared with the traditional identification method that relies on observing the seed germination rate and physiological indicators, the technical solution provided by the present invention can accurately reflect the dormancy degree of honeysuckle seeds, and has higher accuracy, stronger scientificity and good repeatability.

[0090] In the description of this specification, the description with reference to the terms "some embodiments", "specific implementation methods", etc. means that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representation of the above terms does not necessarily refer to the same embodiment or example. Although the embodiments of the present invention have been shown and described above, it can be understood that the above embodiments are exemplary and cannot be understood as limitations of the present invention. Those of ordinary skill in the art can change, modify, replace and modify the above embodiments within the scope of the present invention.

Claims

1. Detection of genes EVM0016124 The use of the expressed reagent in determining the dormancy degree of honeysuckle seeds is characterized in that: The gene EVM0016124 The nucleotide sequence is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that: Use specific primers to amplify genes in the test sample and reference sample EVM0016124 By comparing the genes in the test sample and the reference sample EVM0016124 The expression level of the gene is used to determine the dormancy degree of honeysuckle seeds. EVM0016124 The expression level in dormant seeds was lower than that in dormancy-released seeds.

3. The use according to claim 2, characterized in that: The reference samples include dormant seed samples and dormancy-released seed samples; The dormant seed sample is a sample obtained by soaking the honeysuckle seeds in clean water at 37°C for 12 hours; The dormancy-released seed samples are obtained by soaking the honeysuckle seeds in clean water at 37° C. for 12 hours and then keeping them away from light at 4° C. for 20 days.

4. The use according to claim 2, characterized in that: The specific primers include an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer is shown as SEQ ID NO.2, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO.

3.

5. A method for determining the dormancy degree of honeysuckle seeds, characterized in that: The steps include: Using the cDNA of the sample to be tested and the cDNA of the reference sample as templates, specific primer pairs were used to EVM0016124 Genes are amplified, and the number of genes in the sample to be tested and the reference sample is counted. EVM0016124 The expression level of the gene; Based on the samples to be tested EVM0016124 Gene expression levels and reference samples EVM0016124 The difference in the expression level of the gene is used to determine the dormancy level of the sample to be tested; Said EVM0016124 The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

6. The method according to claim 5, characterized in that The reference samples include dormant seed samples and dormancy-released seed samples; When the sample to be tested EVM0016124 Gene expression levels and reference samples EVM0016124 When there is no significant difference in the expression of the gene, it is determined that the dormancy level of the sample to be tested is the same as that of the reference sample; When the sample to be tested EVM0016124 The expression level of the gene was significantly lower than that of the dormant seed sample in the reference sample EVM0016124 When the expression level of the gene is greater than that of the reference sample, the dormancy level of the sample to be tested is determined to be higher than that of the reference sample; When the sample to be tested EVM0016124 The expression level of the gene was significantly higher than that of the dormancy-released seed samples in the reference samples. EVM0016124 When the expression level of the gene is lower than that of the reference sample, it is determined that the dormancy level of the sample to be tested is lower than that of the reference sample.

7. The method according to claim 6, characterized in that The dormant seed sample is a sample obtained by soaking the honeysuckle seeds in clean water at 37°C for 12 hours; The dormancy-released seed samples are obtained by soaking the honeysuckle seeds in clean water at 37°C for 12 hours and then keeping them away from light at 4°C for 20 days. The significant differences include those when P<0.

05.

8. A detection gene EVM0016124 Use of the expressed reagent in preparing a kit, characterized in that, The kit is used to determine the dormancy degree of honeysuckle seeds. Gene EVM0016124 The nucleotide sequence is shown in SEQ ID NO.

1.

9. A kit, characterized in that: include: Detection of genes EVM0016124 The reagent for expression comprises specific primers, wherein the specific primers comprise an upstream primer as shown in SEQ ID NO.2 and a downstream primer as shown in SEQ ID NO.

3.

10. An isolated nucleic acid molecule, characterized in that The sequence of the nucleic acid molecule is shown as SEQ ID NO.1.

Images