Plant glandular hair development regulation gene NtMIXTA, its encoded protein, biological material and application
By regulating the NtMIXTA gene for the development of tobacco glandular trichomes through genetic engineering, the problem of low breeding efficiency of glandular trichome traits in traditional breeding techniques has been solved. This has resulted in a significant increase in glandular trichome density and enhanced tobacco stress resistance and aroma quality, while shortening the breeding cycle.
Patent Information
- Application Number
- CN202411915011.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-24
- Publication Date
- 2026-05-19
- Estimated Expiration
- 2044-12-24
AI Technical Summary
Traditional breeding techniques are inefficient in selecting plants for glandular trichome traits, making it difficult to quickly and specifically increase glandular trichome density and improve glandular trichome type.
The gene NtMIXTA, which is responsible for the development and density of glandular hairs in tobacco, was cloned and regulated using genetic engineering techniques. This was achieved by overexpressing or knocking out the NtMIXTA gene, including constructing overexpression and knockout vectors and transforming tobacco cells to achieve positive gene regulation.
It significantly increased glandular trichome density, especially the density of long-stalked glandular trichomes, enhanced the stress resistance and aroma quality of tobacco, shortened the breeding cycle, and improved breeding efficiency.
Smart Images

Figure CN119709776B_ABST
Abstract
Description
Technical Field
[0001] This invention application relates to the field of molecular-assisted breeding technology, specifically to a gene regulating the development of plant glandular trichomes. NtMIXTA Its encoded proteins, biomaterials, and applications. Background Technology
[0002] The epidermal hairs of tobacco, serving as the primary physical defense line on the plant's surface, densely cover the plant and play multiple protective roles. They effectively reduce transpiration from tobacco leaves, mitigate damage from ultraviolet radiation, and resist insect infestation and pathogen infection. Based on their secretory functions, tobacco epidermal hairs are meticulously divided into two main categories: non-secreting epidermal hairs and secreting epidermal hairs (i.e., glandular hairs). Based on the number of stalk cells, tobacco glandular hairs can be further divided into long-stalked and short-stalked glandular hairs. Long-stalked glandular hairs have a complex structure, consisting of one basal cell, 3-5 stalk cells, and 1-12 head cells. They are key sites for the synthesis and secretion of tobacco aroma precursors such as cephalosporin and lysine, and also act as physical and chemical barriers against external stresses. Short-stalked glandular hairs, on the other hand, consist of a single-celled stalk and a multicellular glandular head structure. Their cell walls are encased in a thick cuticle, serving as the site for the synthesis of tobacco leaf resistance proteins, thus constructing a robust chemical defense line.
[0003] Compared to traditional breeding methods, using genetic engineering to regulate the development of plant epidermal trichomes and increase the density of glandular trichomes in tobacco has significant advantages. Traditional breeding often requires lengthy natural and artificial selection processes, which are cumbersome and inefficient. Genetic engineering, on the other hand, can precisely locate and manipulate target genes, achieving rapid and targeted genetic improvement. This not only greatly shortens the breeding cycle but also improves the accuracy and efficiency of the improvement. Currently, the scientific community has identified genes such as… NtCycB2 , NtHD9 , NtHD12 Key genes that can influence the development of tobacco glandular trichomes are being identified. Against this backdrop, utilizing modern biotechnology methods such as genetic engineering to deeply explore gene resources that can increase tobacco glandular trichome density is of great significance for enhancing the stress resistance of tobacco leaves, improving tobacco quality, promoting the sustainable development of the tobacco industry, and enhancing the market competitiveness of tobacco products.
[0004] The information disclosed in this background section is intended only to enhance the understanding of the background technology of this disclosure and should not be construed as an admission or in any way implying that the information constitutes prior art known to those skilled in the art. Summary of the Invention
[0005] This disclosure provides a gene regulating plant glandular trichomes. NtMIXTA The study aims to address the technical problem of low efficiency in the selection of plant glandular trichome traits using traditional breeding techniques, including their encoded proteins, biomaterials, and applications.
[0006] According to the first aspect of this disclosure, a plant glandular trichome generation regulatory gene is provided. NtMIXTA Its nucleotide sequence is shown in SEQ ID NO.1.
[0007] According to a second aspect of this disclosure, a gene regulating the generation of glandular trichomes in the plant is provided. NtMIXTA The encoded protein has the amino acid sequence shown in SEQ ID NO.2.
[0008] According to a third aspect of this disclosure, a biological material is provided containing the plant glandular trichomes regulatory gene. NtMIXTA Or a fragment thereof.
[0009] In some embodiments of this disclosure, the biological material is any one of nucleic acid molecules, overexpression vectors, host cells, engineered bacteria, or transformed plant cells.
[0010] According to the fifth aspect of this disclosure, the plant glandular trichomes regulatory gene NtMIXTA Its encoded protein or contains the gene regulating the formation of glandular trichomes in the plant. NtMIXTA The biomaterials are used in any of the following (1) to (7):
[0011] (1) Application in positive regulation of plant glandular trichome development or in the preparation of reagents for positive regulation of plant glandular trichome development;
[0012] (2) Application in positive regulation of plant glandular hair density traits or in the preparation of reagents for positive regulation of plant glandular hair density traits;
[0013] (3) Application in regulating plant glandular trichome types or in preparing reagents for regulating plant glandular trichome types;
[0014] (4) Application in the selection / identification of varieties / strains related to the density trait of plant glandular hairs;
[0015] (5) Application in the construction or breeding of transgenic plants with increased glandular trichome density;
[0016] (6) Application in enhancing plant stress resistance or in the preparation of reagents that enhance plant stress resistance;
[0017] (7) Application in enhancing the aroma quality of plants or in the preparation of reagents that enhance the aroma quality of plants.
[0018] In some embodiments of this disclosure, the expression or upregulation of the... NtMIXTA Gene.
[0019] In some embodiments of this disclosure, the plant glandular hairs include at least one of long-stalked glandular hairs and short-stalked glandular hairs.
[0020] In some embodiments of this disclosure, the plant includes tobacco.
[0021] One or more technical solutions provided in the embodiments of this application have at least one of the following technical effects or advantages:
[0022] Based on cloning in tobacco NtMIXTA The gene, with a coding region of 1077 bp and encoding 358 amino acids, is expressed at the highest level in glandular hairs. Further research revealed that... NtMIXTA Gene knockout reduced glandular trichome density, while overexpression significantly increased it (experimental studies showed that long-stalked glandular trichomes increased by 189.86% and 193.31% respectively compared to the control, and short-stalked glandular trichomes increased by 81.17% and 72.94% respectively compared to the control), indicating that... NtMIXTA Genes can positively regulate the occurrence and development of glandular trichomes in tobacco. This application is of great significance for revealing the molecular regulatory network of plant glandular trichome formation. Attached Figure Description
[0023] Figure 1 Tobacco as an embodiment of this application NtMIXTA Gene cloning.
[0024] Figure 2 As shown in one embodiment of this application NtMIXTA Analysis of gene expression patterns in tissues.
[0025] Figure 3 This is the structure of the overexpression vector pC2300-35S-GFP in one embodiment of this application.
[0026] Figure 4 This is a PCR identification of the recombinant vector bacterial culture in one embodiment of this application.
[0027] Figure 5 As shown in one embodiment of this application NtMIXTA Detection of gene overexpression levels.
[0028] Figure 6 As shown in one embodiment of this application NtMIXTA Gene knockout vector structure.
[0029] Figure 7 This is a PCR identification of the recombinant vector bacterial culture in one embodiment of this application.
[0030] Figure 8 As shown in one embodiment of this application NtMIXTA Sequencing analysis of the sgRNA region of gene knockout lines.
[0031] Figure 9 As shown in one embodiment of this application NtMIXTA Microscopic photograph of the morphology of glandular hairs on the leaf surface of a transgenic plant. Detailed Implementation
[0032] Unless otherwise specified, the instruments and equipment involved in the following embodiments are all conventional instruments and equipment; the reagents involved are all commercially available conventional reagents; and the detection methods involved are all conventional methods unless otherwise specified.
[0033] To better understand the technical solution of this application, the above technical solution will be described in detail below with reference to the accompanying drawings and specific embodiments. However, the following embodiments are only used to illustrate this application in detail and do not limit the scope of this application in any way.
[0034] Example 1: Tobacco NtMIXTA Cloning of genes
[0035] This example relates to tobacco. NtMIXTA Gene cloning is performed using specific primers. NtMIXTA (F: ATGGGAAGGTCACCTTGTTGT, R: AAATACTGGTGAATCAGCAGGTAA) PCR amplification of cDNA from leaves of tobacco variety K326 yielded its CDS sequence, with a band size of approximately 1100 bp. Figure 1 The PCR amplification product was purified and sequenced. The sequencing results showed that... NtMIXTA The coding region is 1077 bp in length (as shown in SEQ ID NO.1) and encodes 358 amino acids (as shown in SEQ ID NO.2).
[0036] Example 2 NtMIXTA Analysis of tissue expression characteristics of genes
[0037] In order to investigate NtMIXTA The expression of the gene in tobacco was analyzed using qRT-PCR. NtMIXTA The expression patterns of the gene in different tissues of K326 were as follows: Figure 2 As shown, NtMIXTA It is expressed in roots, stems, leaves, flowers, and glandular hairs (epidermal hairs), with the highest expression level in glandular hairs and the lowest expression level in stems, indicating that this gene has tissue-specific expression and is involved in the development of tobacco glandular hairs.
[0038] Example 3 NtMIXTA Creation and Molecular Identification of Transgenic Plants
[0039] To further explore NtMIXTA The functions of genes were explained in this example. NtMIXTA Gene overexpression materials and NtMIXTA The creation of gene knockout materials.
[0040] 1. NtMIXTA Creation and Molecular Identification of Gene Overexpression Materials
[0041] Using homologous recombination technology, homologous recombination primers were designed (F: catgattacgaattcgagctcATGGGAAGGTCACCTTGTTGTG, R: acgacggccagtgccaagcttTTAAAATACTGGTGAATCAGCAGGTA), and the vector pC2300-35S-GFP was digested with enzymes. Figure 3 )and NtMIXTA The CDS sequence was ligated and then transformed into E. coli. The results of bacterial culture PCR detection are as follows: Figure 4 Plasmids were extracted and sequenced for verification. NtMIXTA The overexpression vector was successfully constructed.
[0042] NtMIXTA After successful construction of the overexpression vector, leaves of tobacco variety K326 were infected using Agrobacterium-mediated transformation, resulting in eight positive transgenic plants. RNA was extracted from the positive transgenic plants, and specific primers (F: GCTCACTTGCCCAATAGGACTGAC, R: TGTGACTTAGGTTTGCCGCATCC) were designed for detection using real-time quantitative PCR. NtMIXTA Gene expression levels were screened, and 8 transgenic plants with expression levels higher than the control were obtained. Figure 5 Plants No. 2 and No. 5, which had higher expression levels, were selected for subsequent experiments.
[0043] 2. NtMIXTA Creation and Molecular Identification of Gene Knockout Materials
[0044] Construction of the knockout vector: Using the online design tool (https: / / zlab.bio / guide-design-resources) NtMIXTA Designing gRNA target sequences in the coding region of genes (Targeting Sequence: TAGCAGCTCACTTGCCCAAT) AGG (The underlined area indicates the PAM region), the restriction endonuclease BsaI was used to inhibit the vector Cas-PF at 37°C. Figure 6 After single enzyme digestion and gel recovery, the target gene fragment was ligated, transformed into E. coli, and the bacterial culture PCR detection results were as follows: Figure 7 As shown, plasmids were extracted and sequenced.
[0045] Agrobacterium-mediated transformation NtMIXTAThe knockout vector was transformed into K326 sterile seedlings, successfully obtaining 15 positive transgenic plants. Genomic DNA was extracted from each plant, and primers (F: TCTAACACCGTTCCGAGTCA, R: ACTTGCTGCAACCAAACACG) were designed upstream and downstream of the target site to target the target site. NtMIXTA Sequencing of the target sites revealed mutations in the sgRNA region in transgenic plants 1 and 11. Figure 8 ).
[0046] Example 4 NtMIXTA Morphological observation and density analysis of glandular hairs in transgenic plants
[0047] Observation of epidermal hairs on tobacco leaves at the six-leaf-one-bud stage using a super depth-of-field microscope revealed ( Figure 9 ), NtMIXTA The knockout lines KO1 and KO11 showed a decrease in the overall number of leaf glandular trichomes, while the overexpression lines OE3 and OE5 showed a significant increase in glandular trichome density, with the most significant increase in long-stalked glandular trichomes. The statistical results of glandular trichome density are shown in Figure 9. All long-stalked glandular trichomes disappeared on the leaf surface of KO1, and only a very small number of long-stalked glandular trichomes were observed in KO11. The density of short-stalked glandular trichomes and protective trichomes did not change significantly compared to K326. In OE2 and OE5, the number of long-stalked glandular trichomes increased by 189.86% and 193.31% respectively compared to K326, while the number of short-stalked glandular trichomes increased by 81.17% and 72.94% respectively compared to K326, while the protective trichomes showed no significant change. These results indicate that... NtMIXTA Genes are positive regulators of tobacco epidermal hair development, especially of long-stalked glandular hairs.
[0048] Although some preferred embodiments of this invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments as well as all changes and modifications falling within the scope of this invention.
[0049] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from the spirit and scope of its inventive concept. Therefore, if these modifications and variations fall within the scope of the claims of this application and their equivalents, this application also intends to include these modifications and variations.
Claims
1. A gene regulating plant glandular trichomes with a nucleotide sequence as shown in SEQ ID NO.
1. NtMIXTA The application of its encoded protein or biological material containing the gene in any of the following (1) to (4): (1) Application in positive regulation of plant glandular trichome development or in the preparation of reagents for positive regulation of plant glandular trichome development; (2) Application in positive regulation of plant glandular hair density traits or in the preparation of reagents for positive regulation of plant glandular hair density traits; (3) Application in the selection / identification of varieties / strains related to the density trait of plant glandular hairs; (4) Application in the construction or breeding of transgenic plants with increased glandular trichome density; Its features are, Overexpression or upregulation of the expression NtMIXTA The gene can increase the density of glandular hairs; the plant glandular hairs are at least one of long-stalked glandular hairs and short-stalked glandular hairs; the plant is tobacco; the biological material is any one of nucleic acid molecules, overexpression vectors, host cells, and engineered bacteria.