A fish rhabdovirus recombinant adenovirus vector vaccine and a preparation method and application thereof

By constructing a recombinant adenovirus vector vaccine containing the M gene of mandarin fish rhabdovirus and administering immunization via immersion, the problems of cumbersome operation and potential pathogenicity risk of traditional mandarin fish rhabdovirus vaccines have been solved, achieving a highly efficient and safe immune protection effect.

CN119709790BActive Publication Date: 2025-11-28SHANGHAI OCEAN UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510247744.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-03-04
Publication Date
2025-11-28
Estimated Expiration
2045-03-04

AI Technical Summary

Technical Problem

Current technologies lack effective methods for preventing and treating mandarin fish sciroceros virus (SCRV) infection, especially since traditional vaccines are cumbersome to administer or pose a potential risk of infection, making them unsuitable for large-scale application.

Method used

A recombinant adenovirus vector vaccine containing the M gene of SCRV virus was prepared by using fish bullet virus recombinant adenovirus vector vaccine. The vaccine was constructed using homologous recombination technology and immunized by immersion method to prepare a high-titer recombinant adenovirus vaccine.

Benefits of technology

It achieves efficient and safe immunization through immersion, with an immunization protection rate of over 80%, overcoming the limitations of traditional injection vaccines in the juvenile stage. It has good application prospects and economic benefits, and has no side effects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119709790B_ABST
    Figure CN119709790B_ABST
Patent Text Reader

Abstract

The application relates to the technical field of biological medicine, and particularly discloses a fish rhabdovirus recombinant adenovirus vector vaccine and a preparation method and application thereof. The recombinant adenovirus vaccine carrying the M gene of the SCRV virus is prepared by using a replication-defective recombinant adenovirus vector, and the preparation method comprises the following steps: mandarin fish rhabdovirus M gene cloning, construction of a Pshuttle-CMV-ECMV vector with a target gene SCRV-M, obtaining of a SCRV-M recombinant adenovirus plasmid, screening of the SCRV-M recombinant adenovirus, and preparation of the SCRV-M recombinant adenovirus vaccine. The SCRV-M recombinant adenovirus vaccine prepared by the application can be used for immunoprophylaxis of SCRV virus infection in the juvenile fish stage through a soaking mode, the SCRV-M recombinant adenovirus vaccine has passed an animal safety test, and has a wide application prospect in the prevention and control of fish rhabdovirus.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biological medicine, and particularly relates to a fish rhabdovirus recombinant adenovirus vector vaccine and a preparation method and application thereof. BACKGROUND

[0002] SCRV is a negative-strand RNA virus belonging to the Rhabdoviridae family and Perhabdovirus genus, which has a wide host infectivity and diversity and can cause severe hemorrhagic septicemia in freshwater and marine fish. Rhabdovirus has five major proteins, namely glycoprotein (G), matrix protein (M), nucleoprotein (N), phosphoprotein (NS) and RNA polymerase large protein (L). As one of the major pathogens in mandarin fish culture, the existence of SCRV has brought huge losses to the culture industry, and there is currently a lack of effective drug treatment and prevention measures. Traditional fish rhabdovirus prevention methods mainly rely on the development of inactivated or attenuated virus vaccines. Although inactivated vaccines have certain protective effect, they need to be injected manually and are complicated to operate, which is not suitable for large-scale application. Although attenuated live vaccines are easy to spread through water, they have potential pathogenic risks, and direct release into water may not meet environmental control policies.

[0003] Adenovirus vaccines have become the first choice for gene expression and vaccine delivery of various pathogens due to their high titer, high efficiency and the characteristics of not integrating foreign genes into the host genome. Recombinant adenovirus can effectively transfer the target gene to various cells and stimulate the body to produce effective and persistent specific humoral and cellular immune responses. In addition, recombinant adenovirus can also infect a variety of bony fish through immersion, showing extremely high infection efficiency and inducing effective mucosal immunity and T cell immune response. In various animal models, the mucosal immune response induced by adenovirus vectors is more effective than parenteral immunity, showing a persistent immune response capacity. These characteristics make adenovirus vectors a promising vaccine candidate for preventing SCRV infection and provide new ideas and methods for the research and development of fish rhabdovirus immersion vaccines. SUMMARY

[0004] The present application provides a fish rhabdovirus recombinant adenovirus vector vaccine and a preparation method and application thereof, which solves the problem that mandarin fish culture is susceptible to SCRV virus infection and cannot be prevented by injection of vaccines.

[0005] The present application adopts the following technical scheme: a fish rhabdovirus recombinant adenovirus vector vaccine, the antigen protein of the recombinant adenovirus vector vaccine contains the M gene of the SCRV virus, and the nucleotide sequence of the antigen of the recombinant adenovirus vector vaccine is shown in SEQ ID NO: 1.

[0006] The preparation method of the fish rhabdovirus recombinant adenovirus vector vaccine comprises the following steps:

[0007] (1) Analyzing the M gene of the SCRV virus, designing primers SCRV-M-F and primers SCRV-M-R, and performing PCR amplification on the cDNA of the SCRV virus as a template, wherein the primers SCRV-M-F and primers SCRV-M-R are added with the homologous sequences and enzyme digestion sites of the Pshuttle-CMV-ECMV vector;

[0008] (2) Constructing the Pshuttle-CMV-ECMV vector with the target gene SCRV-M: cloning the SCRV-M gene obtained to the Pshuttle-CMV-ECMV vector through the homologous recombination technology to construct the Pshuttle-CMV-ECMV vector with the SCRV-M gene: Pshuttle-CMV-ECMV / SCRV-M;

[0009] (3) Obtaining the recombinant adenovirus plasmid: performing homologous recombination on the obtained recombinant adenovirus vector Pshuttle-CMV-ECMV / SCRV-M and the PAd-easy-1 vector in the Escherichia coli BJ5183 to construct the recombinant adenovirus plasmid;

[0010] (4) Screening the obtained recombinant adenovirus: performing Pac I enzyme digestion on the positive plasmid of the recombinant adenovirus screened to be used for transfecting the HEK293 cells to obtain the recombinant adenovirus with the SCRV-M gene;

[0011] (5) Preparing the fish rhabdovirus recombinant adenovirus vaccine: performing passage on the harvested recombinant adenovirus with the SCRV-M gene, detecting the expression of the target antigen protein, inoculating the recombinant adenovirus capable of expressing the detected protein into the HEK293 cells for multiple passages, repeatedly freezing and thawing, and measuring the virus titer, and obtaining the fish rhabdovirus recombinant adenovirus vector vaccine prepared from the recombinant adenovirus with a high titer.

[0012] Further, the nucleotide sequence of the primer SCRV-M-F is shown in SEQ ID NO: 2.

[0013] Further, the nucleotide sequence of the primer SCRV-M-R is shown in SEQ ID NO: 3.

[0014] Further, the virus titer in the step (5) needs to be greater than 1×10 8 mL -1 TCID50.

[0015] Further, the step (5) takes the high titer recombinant adenovirus 1ml infection culture HEK293 cells, and the above-mentioned HEK293 cells are repeatedly frozen and thawed 3 times with the supernatant after 72h of infection, and then the fish rhabdovirus recombinant adenovirus vector vaccine is obtained by centrifugation at 3000-4000rpm / min for 8-10min.

[0016] The application of the fish rhabdovirus recombinant adenovirus vector vaccine in the preparation of a medicine for treating hemorrhagic septicemia caused by the mandarin fish rhabdovirus.

[0017] The application of the fish rhabdovirus recombinant adenovirus vector vaccine in the preparation of an anti-fish rhabdovirus soaking preparation.

[0018] The beneficial effects of the present application are:

[0019] (1) According to the principle that the M gene of the SCRV virus is a key component in the viral genome, and the M protein mainly participates in the assembly process of the virus particle, and has a key influence on the morphology and infectivity of the virus, after amplifying the mandarin fish rhabdovirus M gene, the M gene is connected to the Pshuttle-CMV-ECMV vector, and after positive PCR screening, it is homologously recombined with the PAd-easy-1 backbone vector to construct a replication-defective recombinant adenovirus plasmid, and the replication-defective recombinant adenovirus containing the target gene is obtained after transfecting cells with the plasmid; the recombinant adenovirus detected is inoculated into HEK293 cells for multiple passages, and the high-titer recombinant adenovirus is selected to prepare the SCRV-M recombinant adenovirus vaccine, and the vaccine has high stability.

[0020] (1) The SCRV-M recombinant adenovirus vaccine prepared by the present application can be immunized by soaking, and can be soaked and immunized during the juvenile period of fish, and the immunoprotection rate is as high as 80% or more, and the immunization effect is good, which overcomes the problem that traditional injection vaccines are limited in use during the juvenile period of fish, and has good application prospect and can bring better economic benefits.

[0021] (2) The SCRV-M recombinant adenovirus vaccine prepared by the present application is safe and effective, and has no toxic side effects. BRIEF DESCRIPTION OF DRAWINGS

[0022] Figure 1The construction process diagram of the SCRV-M recombinant adenovirus vector of the application is as follows: A: identification of the SCRV-M gene PCR product: lane 1, DNA Maker; lane 2, SCRV-M gene PCR amplification product; lane 3: blank control. B: recombinant plasmid PCR amplification and double enzyme digestion results: lane 1, DNA Maker; lane 2, Sal I and Xho I double enzyme digestion results; lane 3, PCR amplification results; lane 4, empty vector PCR amplification results. C: identification of the recombinant adenovirus vector: lane 1, DNA Maker; lane 2, recombinant adenovirus plasmid Pac I enzyme digestion results; lane 3, M gene PCR amplification results; lane 4, blank control.

[0023] Figure 2 The green fluorescence expression result diagram of the SCRV-M recombinant adenovirus vaccine of the application is as follows: A: GFP expression of HEK293 cells infected by the recombinant adenovirus; B: blank control group of HEK293 cells.

[0024] Figure 3 The Western-blot detection result diagram of the SCRV-M recombinant adenovirus SCRV-M protein expression of the application is as follows: lane 1, M protein expression result of the recombinant adenovirus harvested from HEK293 cells; lane 2, control group of the recombinant empty vector virus harvested from HEK293 cells; lane 3, blank control group of HEK293 cells.

[0025] Figure 4 The survival rate result diagram of the mandarin fish treated by the SCRV-M recombinant adenovirus vaccine of the application for 7 days is as follows.

[0026] Figure 5 The effect diagram of the SCRV-M recombinant adenovirus vaccine of the application in preventing and treating SCRV virus infection on the mandarin fish is as follows. DETAILED DESCRIPTION

[0027] In order for those skilled in the art to better understand the solutions of the present application, the technical solutions in the embodiments of the present application will be described clearly and completely in combination with the drawings in the embodiments of the present application. Obviously, the described embodiments are only a part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor should belong to the protection scope of the present application.

[0028] Human embryonic kidney cells 293 (HEK293 cells) adherent growth in cell culture medium, in 5% CO2, 37℃ constant temperature incubator. With 10% fetal bovine serum, 100U / ml penicillin and 100mg / ml streptomycin DMEM medium (Gibco) for HEK293 cell culture medium; with only 2% fetal bovine serum DMEM medium for HEK293 cells during the culture maintenance solution.

[0029] The Siniperca chuatsi rhabdovirus (SCRV) selected in the present application is stored in the National Aquatic Animal Pathogen Bank of the Ministry of Agriculture and Rural Affairs.

[0030] The DNA purification recovery kit and the plasmid extraction kit in the embodiments of the present application are products of Tian Gen Biochemical Technology (Beijing) Co., Ltd.

[0031] The Pshuttle-CMV-ECMV vector in the embodiments of the present application is purchased from Haizeye Biotechnology Co., Ltd.

[0032] The high-fidelity enzyme premix in the embodiments of the present application is purchased from Nanjing Novozyme Bio-Science Co., Ltd.

[0033] Example 1: Construction of SCRV-M recombinant adenovirus vector:

[0034] (1) Siniperca chuatsi rhabdovirus M gene cloning:

[0035] First, the DNA template of SCRV-M is amplified by PCR with the primer SCRV-M-F and the primer SCRV-M-R, and the SCRV virus cDNA as the template, wherein

[0036] The sequence of SCRV-M-F is SEQ ID NO: 2:

[0037] 5'- ATTTGCGGCCGCGCCACCATGCCTCTGTTTAAGAAGAG -3'

[0038] The sequence of the primer SCRV-M-R is SEQ ID NO: 3:

[0039] (5'- CCGCTCGAGATGCCAGCTATGACCAG-3'),

[0040] The specific steps are as follows: SCRV-M-F 1 μL (10 μM), SCRV-M-R 1 μL (10 μM), SCRV virus cDNA 1 μL, high-fidelity enzyme premix 10 μL, supplementing nuclease-free water to 20 μL, performing PCR amplification according to the following program, 1 cycle (95 ℃ 3 min), 35 cycles (95 ℃ 10 s, 58 ℃ 30 s, 72 ℃ 30 s), 1 cycle (72 ℃ 5 min), and storing at 4 ℃. After PCR amplification, agarose electrophoresis is performed to verify the PCR result of the SCRV-M gene, and after obtaining a single SCRV-M gene target fragment, the above PCR product is purified using a DNA purification recovery kit; the result is shown in Figure 1 Fig. 1A.

[0041] The SCRV-M gene DNA template is successfully amplified, as shown in the result. Figure 1

[0042] (2) Constructing a Pshuttle-CMV-ECMV vector with a target gene (SCRV-M):

[0043] The purified SCRV-M gene is double-digested with Not I and Xho I restriction endonucleases to produce compatible sticky ends, and the Pshuttle-CMV-EGFP vector is also double-digested with Not I and Xho I restriction endonucleases to match the ends of the SCRV-M gene. The digested SCRV-M gene and the Pshuttle-CMV-EGFP vector are subjected to an overnight ligation reaction at 16 ℃ using T4 DNA ligase to form a recombinant DNA molecule. The ligation product is transformed into E. coli DH5α competent cells. The transformed cells are spread on LB agar plates containing kanamycin and incubated for 12-16 hours. Smaller single colonies are selected from the incubated plates and transferred to liquid culture medium containing kanamycin for expansion culture for 12 hours. The expanded bacterial solution is subjected to PCR identification to confirm the insertion of the SCRV-M target gene. The bacterial solution with a PCR identification result consistent with the target size is further expanded, and then plasmid DNA is extracted using a plasmid extraction kit and subjected to sequencing analysis to verify the sequence correctness of the recombinant plasmid; the result is shown in Figure 1 Fig. 1B.

[0044] As shown in Figure 1 Fig. 1B, the SCRV-M fragment has been successfully homologously recombined into the Pshuttle-CMV-EGFP vector.

[0045] (3) Obtaining a Pshuttle-CMV-EGFP / SCRV-M recombinant adenovirus plasmid:

[0046] ​First, the Pshuttle-CMV-EGFP / SCRV-M vector was subjected to Pme I enzyme digestion to obtain a linearized vector. Subsequently, the linearized Pshuttle-CMV-EGFP / SCRV-M vector was transformed into BJ5183 competent cells containing a PAd-easy-1 helper vector by heat shock method. The transformation procedure included mixing 5 μL of purified linearized vector with 50 μL of BJ5183 competent cells, followed by heat shock treatment at 42°C for 80 seconds. After heat shock, the recombination mixture was plated on LB plates containing 100 μg / mL kanamycin for screening. The PCR products were detected by 0.8% agarose gel electrophoresis to confirm the insertion of the target gene. The positive product was cultured in bulk, and the plasmid DNA was extracted and subjected to enzyme digestion with Pac I to verify the correctness of the recombinant adenovirus plasmid. The selected positive plasmid was further transformed into Stbl3 competent cells by heat shock method to obtain a large amount of high-quality plasmid DNA. The positive clones picked were subjected to enzyme digestion with Pac I again to ensure the correctness of the plasmid construction. Finally, the positive enzyme digestion product was recovered and prepared for the next step of transfection experiment; the results are shown in Figure 1 FIG. 3C.

[0047] As shown in the results of Figure 1 FIG. 3C, the Pshuttle-CMV-EGFP / SCRV-M recombinant adenovirus plasmid was successfully obtained.

[0048] (4) Screening of SCRV-M recombinant adenovirus:

[0049] The positive recombinant adenovirus plasmid obtained in the previous step was subjected to Pac I enzyme digestion to remove the Ori element and the kanamycin resistance gene, thereby exposing the inverted terminal repeat (ITR) and packaging signal of the adenovirus. Subsequently, the linearized recombinant adenovirus plasmid was transfected into HEK293 cells using liposomes.

[0050] The specific steps are as follows: 24 hours before transfection, logarithmically growing HEK293 cells were digested with trypsin solution, and then diluted with cell culture medium to a cell density of 1 x 10 7 cells / ml to form a cell suspension. The cell suspension was added to 25 cm 2Cell culture flasks were placed in a cell culture incubator with a CO2 concentration of 5% and a temperature of 37°C. Transfection was performed when cell adhesion reached 60-70%. 30 μL of Lipofectamine™ 3000 was mixed with 900 μL of DMEM cell culture medium, followed by the addition of 4 μg of linearized recombinant adenovirus plasmid. After incubation at room temperature for 20 minutes, the mixture was added to the cells, and the cells were cultured at 37°C for 4 hours. Subsequently, the culture medium was removed, and 10 mL of cell maintenance medium containing 10% FBS was added, and the cells were cultured further. Transfection efficiency was assessed by monitoring intracellular GFP expression and cytopathic effect (ME). When high levels of GFP expression were observed in the cells, 5 mL of the supernatant cell maintenance medium was gently removed, and the remaining culture medium was collected for virus passage and amplification. Results are as follows: Figure 2 As shown.

[0051] like Figure 2 The results showed that HEK293 cells transfected with the adenovirus vaccine plasmid SCRV-M exhibited abundant GFP fluorescence 48 hours after transfection, while no GFP fluorescence was observed in the negative control HEK293 cells. This indicates that the adenovirus vaccine plasmid SCRV-M was successfully constructed.

[0052] (5) Preparation of fish rhabdovirus recombinant adenovirus vaccine:

[0053] HEK293 cells in the logarithmic growth phase were harvested, digested with trypsin digestion solution, and then diluted with cell culture medium to a cell density of 1×10⁻⁶. 7 The cell suspension was prepared by adding 5 ml of the cell suspension to a 25 cm³ / bottle. 2The cell culture bottle is placed in a cell culture incubator with a CO2 volume content of 5% and a temperature of 37°C. When the cell adhesion rate reaches 60-70%, the culture medium is removed and the virus-containing culture solution collected in the previous step is added. When a large number of GFP expressions are observed in the cells, the virus solution of the HEK293 cells is collected, and then the cells are lysed using RIPA lysis buffer. After lysis, the protein sample is broken up using ultrasonic waves, and centrifuged at 12000 rpm for 10 minutes at 4°C to separate the supernatant. The supernatant is mixed with 6xLoading Buffer, and then heated at 95°C for 10 minutes to denature the protein. Next, the treated protein sample is loaded into the SDS-PAGE electrophoresis gel well for electrophoretic separation, with an electrophoretic condition of 80V for 1 hour, and then the voltage is increased to 120V until the electrophoresis is completed. Taking β-actin as an internal reference, according to the protein molecular weight standard, the protein bands to be tested in the gel are cut off, and these protein bands are transferred to a PVDF membrane with a transfer condition of 200mA current for 2 hours. After the membrane transfer is completed, the PVDF membrane is placed in a 5% skim milk solution for 1 hour to reduce non-specific binding. After blocking, the membrane is incubated with a 1:1000 diluted GFP antibody overnight to specifically bind the target protein. The next day, the membrane is washed with PBST buffer for 3 times, 10 minutes each time, to remove the unbound antibody. Then, the membrane is incubated with a 1:2000 diluted goat anti-mouse secondary antibody for 2 hours, and then washed with PBST buffer for 3 times, 10 minutes each time, to remove the excess secondary antibody. Finally, a developing agent is added and the chemiluminescence reaction on the membrane is detected to evaluate the expression of the target protein in the recombinant adenovirus.

[0054] For the recombinant adenovirus capable of stably expressing the target protein, it is inoculated into HEK293 cells and passaged multiple times. After each virus solution is harvested, it is repeatedly frozen and thawed 2 to 3 times to release the virus particles. By determination, when the titer of the recombinant virus reaches 1x10 8 mL -1 TCID50, the recombinant adenovirus vaccine of the rhabdovirus is prepared using the recombinant adenovirus stock solution: the specific steps are as follows:

[0055] Logarithmic growth phase HEK293 cells are taken, the cells are digested using a trypsin digestion solution, and then diluted with a cell culture medium to a cell density of 1x10 7 cells / ml to form a cell suspension, and the above cell suspension is added to 25cm 2The cell culture bottle is placed in a cell culture box, and the cell culture box has a CO2 volume content of 5% and a temperature of 37°C. When the cell adhesion rate reaches 60-70%, the culture medium is removed, 1 ml of the collected recombinant adenovirus in the previous step is added to infect the cultured HEK293 cells, and the cells are cultured for 1 h. Then, 4 ml of HEK293 cell maintenance solution is added, and the cells are cultured for 72 h. Then, the above-mentioned HEK293 cells and supernatant are repeatedly frozen and thawed for 3 times, and then centrifuged at 4000 rpm / min for 10 min. The supernatant is collected, which is the recombinant adenovirus vaccine of rhabdovirus.

[0056] The results are shown in Figure 3 .

[0057] The results are shown in Figure 3 . As shown in the results, the HEK293 cells infected with the SCRV-M recombinant adenovirus vaccine can stably express the SCRV-M protein, while the HEK293 cells infected with the recombinant empty vector adenovirus and the blank HEK293 cells do not express the SCRV-M protein. This indicates that the SCRV-M recombinant adenovirus vaccine can successfully express the target protein SCRV-M, and the SCRV-M recombinant adenovirus vaccine is successfully constructed.

[0058] Example 2: Safety effect verification of SCRV-M recombinant adenovirus vaccine:

[0059] In order to comprehensively evaluate the safety of the recombinant adenovirus vaccine in preventing rhabdovirus and ensure the safety of its clinical application, a series of safety tests were conducted on the vaccine according to the provisions of the Chinese Veterinary Pharmacopoeia. The test used 5g heavy mandarin fish as experimental animals, and the recombinant adenovirus vaccine titer used was 1×10 9 mL -1 TCID50.

[0060] In the experimental design, the first group of mandarin fish was immunized by soaking with the recombinant adenovirus vaccine soaking preparation prepared by diluting 1×10 9 mL -1 TCID50 recombinant adenovirus vaccine with artificial seawater at a ratio of 1:50, and the immunization lasted for 15 minutes. The second group of mandarin fish was immunized by injection, with each fish being inoculated with 0.1 mL of recombinant adenovirus vaccine. The third group of mandarin fish was used as a control group without vaccination. During the test period, all experimental groups of mandarin fish were closely monitored for clinical adverse reactions, and the number of dead fish was recorded every day within 7 days after immunization. In addition, within 60 days after inoculation, the length and weight changes of the fish in each group were measured and recorded regularly. The results are shown in Figure 4 .

[0061] According to Figure 4The results shown show that in the case of good growth of the control group of mandarin fish, no dead fish was observed within 7 days in the first two groups inoculated with the vaccine, and no clinical adverse reactions were found. Moreover, there was no significant difference in the length and weight of the fish after 60 days between the inoculation group and the control group. These results show that the SCRV-M recombinant adenovirus vaccine has high safety, which provides a scientific basis for its use in clinical practice.

[0062] Example 3: Application of the SCRV-M recombinant adenovirus vaccine

[0063] Select mandarin fish with a weight of about 10 g, and inoculate the vaccine by immersion, using artificial seawater diluted at a ratio of 1:50 to 1 x 10 9 mL -1 The TCID50recombinant adenovirus vaccine preparation can be used to prepare a recombinant adenovirus vaccine immersion preparation for immersion immunization. The recombinant adenovirus vaccine immersion preparation is used for immunization, which lasts for 15 minutes. In order to ensure the controllability of the experiment, a negative control group without inoculation of the vaccine is also set up. The experimental fish is cultured in a circulating water culture system at 28°C. After an immunization period of 28 days, all the mandarin fish are injected intraperitoneally with 20 μL of SCRV virus with a concentration of 1 x 10 5 TCID50 / mL. During the subsequent observation period, the survival and death of the mandarin fish in each group are recorded every day, and the survival curves are drawn according to these data to evaluate the protective effect of the vaccine. The results are shown in Figure 5

[0064] According to the experimental results shown in Figure 5 , the mortality rate of the mandarin fish inoculated with the SCRV-M recombinant adenovirus vaccine is about 20% within the 20-day observation period. In contrast, the mortality rate of the mandarin fish in the negative control group without inoculation of the vaccine reached 70% within the same period. This significant difference indicates that the SCRV-M recombinant adenovirus vaccine inoculated by immersion has an 80% protective effect on mandarin fish against SCRV virus infection.

[0065] The above shows and describes the basic principles and main features of the present application and the advantages of the present application. Those skilled in the art should understand that the present application is not limited by the above examples, and the above examples and descriptions in the specification are only to illustrate the principles of the present application. Without departing from the spirit and scope of the present application, various changes and improvements can be made to the present application, and these changes and improvements all fall within the scope of the claimed present application. The scope of protection of the present application is defined by the appended claims and their equivalents.​

Claims

1. A recombinant adenovirus vector vaccine of a mandarinfish rhabdovirus, characterized in that: The antigen protein of the recombinant adenovirus vector vaccine is the M gene of the SCRV virus, and the nucleotide sequence of the antigen of the recombinant adenovirus vector vaccine is shown in SEQ ID NO: 1; the preparation method of the Megalocytivirus Sinensis recombinant adenovirus vector vaccine comprises the following steps: (1) analyzing the M gene of the SCRV virus, designing primers SCRV-M-F and primers SCRV-M-R, and performing PCR amplification on the cDNA of the SCRV virus as a template, wherein the primers SCRV-M-F and primers SCRV-M-R are added with the homologous sequences and enzyme digestion sites of the Pshuttle-CMV-ECMV vector; (2) constructing the Pshuttle-CMV-ECMV vector with the target gene SCRV-M: cloning the obtained SCRV-M gene into the Pshuttle-CMV-ECMV vector through homologous recombination technology to construct the Pshuttle-CMV-ECMV / SCRV-M vector with the SCRV-M gene; (3) obtaining the recombinant adenovirus plasmid: performing homologous recombination on the obtained recombinant adenovirus vector Pshuttle-CMV-ECMV / SCRV-M and the PAd-easy-1 vector in Escherichia coli BJ5183 to construct the recombinant adenovirus plasmid; (4) screening the obtained recombinant adenovirus: performing Pac I enzyme digestion on the obtained recombinant adenovirus positive plasmid and then using the positive plasmid to transfect HEK293 cells to obtain the recombinant adenovirus with the SCRV-M gene; (5) preparing the Megalocytivirus Sinensis recombinant adenovirus vector vaccine: passing the harvested recombinant adenovirus with the SCRV-M gene, detecting the expression of the target antigen protein, inoculating the recombinant adenovirus with the expressed protein into HEK293 cells for multiple passages, repeatedly freezing and thawing, and determining the virus titer, and obtaining the Megalocytivirus Sinensis recombinant adenovirus vector vaccine by using the recombinant adenovirus with a high titer; The nucleotide sequence of the primer SCRV-M-F is shown in SEQ ID NO: 2, and the nucleotide sequence of the primer SCRV-M-R is shown in SEQ ID NO:

3.

2. The application of the Megalocytivirus Sinensis recombinant adenovirus vector vaccine according to claim 1 in the preparation of a drug for treating hemorrhagic septicemia caused by Megalocytivirus Sinensis.

3. The application of the Megalocytivirus Sinensis recombinant adenovirus vector vaccine according to claim 1 in the preparation of an anti-Megalocytivirus Sinensis soaking preparation.

4. The recombinant adenoviral vector vaccine of the mandarin fish rhabdovirus according to claim 1, characterized in that, The virus titer in the step (5) is greater than 1 x 10 8 mL -1 TCID50.

5. The recombinant adenoviral vector vaccine of the mandarin fish rhabdovirus according to claim 1, characterized in that, In step (5), 1 ml of the recombinant adenovirus with a high titer is used to infect the cultured HEK293 cells, the above-mentioned HEK293 cells and supernatant are repeatedly frozen and thawed for 3 times after 72 hours of infection, and then the fish Megalocytivirus recombinant adenovirus vector vaccine is obtained by centrifugation at 3000-4000 rpm / min for 8-10 min.

Citation Information

Patent Citations

  • Adenovirus granule obtaining method

    CN110229793A

  • Preparation method of salmonidae fish viral hemorrhagic septicemia recombinant adenovirus vaccine

    CN115887632A