Primer group, detection method of national standard swine-derived components and application

Abstract

The invention provides a primer group, a detection method of national standard swine-derived components and application, and relates to the technical field of biological detection. The invention provides a primer group. The primer group comprises a primer pair and a DBQ dual-extraction probe, wherein the primer pair and a conserved region of a national standard pig ATP8 gene have specificity and complementarity. The primer group provided by the invention aims at a conserved region of the national standard pig ATP8 gene, high specificity and accuracy of qPCR detection are ensured, and the non-specific amplification risk is effectively reduced. The high specificity of the primer pair enables the primer pair to be capable of detecting national standard swine-derived components in a trace sample, and the DBQ double-quenching probe realizes real-time monitoring of amplification of a target DNA sequence, so that the accuracy of quantitative analysis is improved. The combination of the primer pair and the probe reduces false positive and false negative results, is crucial to food safety detection and supervision, and ensures the reliability of detection results.

Description

Technical Field

[0001] The present invention relates to the field of biological detection technology, and in particular to a primer set, a detection method for national standard pig-derived components and applications thereof. Background Art

[0002] Biological detection technology is an important part of modern biological research and food safety. It involves the identification and quantitative analysis of specific components in biological samples. With the development of biotechnology, detection technology has evolved from traditional microscopy and DNA hybridization technology to gene chip technology, high-throughput sequencing technology, and quantitative PCR (qPCR) technology, which is currently widely used in the detection of various types of biological molecules. These technologies play an important role in many fields such as food traceability, disease diagnosis, and environmental monitoring, and are of great significance for ensuring public health safety and promoting the advancement of biotechnology.

[0003] Among the existing livestock and poultry animal-derived component detection technologies, quantitative PCR is highly favored due to its high sensitivity, accuracy and repeatability. This technology uses specific primers and probes to amplify the target DNA sequence, while monitoring the fluorescent signal that is proportional to the PCR product to achieve quantitative analysis of the target sequence. The detection principle of the quantitative PCR method is to add a pair of primers and a specific fluorescent probe to the PCR amplification system, and use the 3'-5' exonuclease activity of the amplification enzyme to separate the fluorescent group and the quenching group on the fluorescent probe during the PCR amplification process, so that the fluorescence monitoring system can receive the fluorescent signal that is positively correlated with the amplification of the PCR product. The application of this technology has greatly improved the accuracy and efficiency of detection.

[0004] However, despite the significant theoretical advantages of quantitative PCR technology, it still faces some technical and operational challenges in practical applications. In particular, in the design of specific probes and primers, such as TAMRA-based quenching probes, there is the problem of background signal interference, which reduces the specificity and accuracy of the detection. In addition, some probes and primers are not sensitive enough to detect low-abundance target sequences, limiting the application of quantitative PCR technology in detecting trace or rare target sequences. The problem of low accuracy also occurs from time to time, which may be due to non-specific binding of probes and primers, or errors in experimental operations, resulting in false positive or false negative results.

[0005] In summary, although quantitative PCR technology has high potential in the detection of animal-derived ingredients in livestock and poultry, it also has a series of technical defects. These problems include interference from background signals, insufficient sensitivity, and low accuracy. These challenges not only limit the scope of application of quantitative PCR technology, but also affect its reliability in actual production and research. Therefore, solving these problems is crucial to improving the accuracy, sensitivity, and applicability of livestock and poultry animal-derived ingredient detection technology, which is of great significance for ensuring the quality and safety of biological products and promoting the development and application of related technologies.

[0006] In view of this, the present invention is proposed. Summary of the invention

[0007] The first purpose of the present invention is to provide a primer set, a detection method and application of national standard pig-derived components. The primer set is designed based on the conservative region of the national standard pig ATP8 gene, and can detect the DBQ double quenching probe of the national standard pig simply, accurately and efficiently, wherein the DBQ double quenching probe has the advantages of lower background fluorescence value, high detection fluorescence increment, high detection specificity, good repeatability and high sensitivity, which is conducive to practical application.

[0008] In order to achieve the above-mentioned purpose of the present invention, the following technical solutions are particularly adopted:

[0009] In a first aspect, the present invention provides a primer set, comprising a primer pair and a DBQ double extraction quenching probe;

[0010] The primer pair is specific and complementary to the conserved region of the national standard pig ATP8 gene.

[0011] In an optional embodiment, the oligonucleotide sequence of the DBQ double quenching probe has a fluorescent group at the 5' end and a quenching group at the 3' end;

[0012] In an optional embodiment, the fluorescent group is selected from at least one of FAM, HEX, VIC, TET and ROX;

[0013] In an optional embodiment, the quenching group is DBQ1 and / or DBQ2;

[0014] In an optional embodiment, the quencher group is DBQ1.

[0015] In an optional embodiment, the nucleotide sequence of the DBQ double quenching probe is shown as SEQ ID NO.1.

[0016] In an optional embodiment, the primer pair includes a forward primer and a reverse primer;

[0017] The nucleotide sequence of the forward primer is shown in SEQ ID NO.2;

[0018] The nucleotide sequence of the reverse primer is shown in SEQ ID NO.3.

[0019] In a second aspect, the present invention provides a method for detecting a national standard porcine-derived component based on the primer set described in any one of the aforementioned embodiments, comprising:

[0020] Synthesize single-stranded DNA molecules as template DNA;

[0021] Using the primer pair in the primer set to amplify the template DNA to obtain a positive standard;

[0022] Absolutely quantifying the positive standard, and constructing a standard curve based on the absolutely quantitative positive standard;

[0023] Using the primer pair and DBQ double quenching probe in the primer set, qPCR amplification reactions are performed on the positive standard, the template DNA and the target biological sample for absolute quantification, respectively, to obtain the fluorescence signals of the positive standard at different concentrations, and the fluorescence signals corresponding to the target biological sample;

[0024] Based on the standard curve, obtaining a detection result of the target biological sample according to the fluorescent signal corresponding to the target biological sample;

[0025] In an optional embodiment, the nucleotide sequence of the single-stranded DNA molecule is shown as SEQ ID NO.4.

[0026] In an optional embodiment, the absolute quantification of the positive standard and the construction of a standard curve based on the absolute quantification of the positive standard include:

[0027] The positive standard was serially diluted 10 1 Up to 10 8 times, to obtain the positive standard with different concentrations;

[0028] Take dilution 10 1 Up to 10 8 The positive standard is tested by qPCR at a concentration of times the positive standard, and a standard curve is drawn with the logarithm of the copy number obtained according to the concentration of the positive standard as the abscissa and the CT value measured by the positive standard as the ordinate to obtain the absolute quantitative result of the positive standard.

[0029] In an optional embodiment, the use of the primer pair and DBQ double-quenching probe in the primer set to perform qPCR amplification reactions on the positive standard, the template DNA and the target biological sample for absolute quantification respectively comprises:

[0030] Prepare a template-free qPCR reaction mixture and perform a template-free qPCR reaction;

[0031] A qPCR amplification reaction system containing a DNA sample is prepared, and the positive standard and the template DNA are amplified based on the qPCR amplification reaction system to obtain fluorescence signal data corresponding to the positive standard; and the target biological sample is amplified using the qPCR amplification reaction system to obtain fluorescence signal data of the target biological sample.

[0032] In an optional embodiment, the qPCR amplification reaction system comprises:

[0033] 2×qPCR Mix UDG, 12.5 μL;

[0034] Forward primer 10 μM concentration, 0.5 μL;

[0035] Reverse primer 10 μM concentration, 0.5 μL;

[0036] DBQ dual quenching probe 10 μM concentration, 0.5 μL;

[0037] ddH2O, 9 μL;

[0038] DNA sample, 2 μL;

[0039] Wherein, the DNA sample includes the positive standard and the template DNA.

[0040] In an optional embodiment, the template-free qPCR reaction mixture comprises:

[0041] 2×qPCR Mix UDG, 12.5 μL;

[0042] Forward primer 10 μM concentration, 0.5 μL;

[0043] Reverse primer 10 μM concentration, 0.5 μL;

[0044] DBQ dual quenching probe 10 μM concentration, 0.5 μL;

[0045] ddH2O, 11 μL.

[0046] In a third aspect, the present invention provides an application of a primer set as described in any one of the aforementioned embodiments in national standard pig detection.

[0047] The present invention provides a primer set, a detection method and application of a national standard pig-derived component, wherein the primer set comprises a forward primer, a reverse primer, and a DBQ double quenching probe, wherein the primer pair has specificity and complementarity with a conserved region of a national standard pig ATP8 gene.

[0048] The primer set provided by the present invention ensures the high specificity of qPCR detection through its specific complementarity with the conserved region of the national standard pig ATP8 gene, thereby only amplifying the target gene sequence, significantly reducing the risk of nonspecific amplification, and improving the accuracy of the test results. This highly specific primer pair enables qPCR technology to detect national standard pig-derived components in trace samples, even if the abundance of these target DNA sequences is extremely low. In addition, the application of DBQ double quenching probe allows real-time monitoring of the amplification of target DNA sequences during the qPCR process, thereby achieving more accurate quantitative analysis. The DBQ double quenching probe has excellent performance in practical applications due to its advantages such as high fluorescence increment, high specificity, good repeatability and high sensitivity. By reducing the generation of false positive and false negative results, the combined use of specific primer pairs and DBQ double quenching probes is of great significance to the field of food safety testing and supervision, ensuring the reliability and effectiveness of the test results. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0050] Figure 1 This is a schematic diagram of the standard curve results (standard curve) established using the national standard porcine TAMRA modified probe for the comparative group in the examples of the present invention;

[0051] Figure 2 This is a schematic diagram of the standard curve results established using the national standard porcine TAMRA modified probe for the comparative group in the examples of the present invention (enlarged curve diagram);

[0052] Figure 3 This is a schematic diagram of the standard curve results (multi-component curve diagram) established using the national standard porcine TAMRA modified probe for the comparative group in the examples of the present invention;

[0053] Figure 4 This is a schematic diagram of the standard curve results (standard curve) established using the DBQ1 double quenching probe in the example group of the examples of the present invention;

[0054] Figure 5 This is a schematic diagram of the standard curve results established using the DBQ1 double quenching probe in the embodiment group of the present invention (enlarged curve diagram);

[0055] Figure 6This is a schematic diagram of the standard curve results (multi-component curve diagram) established using the DBQ1 double quenching probe in the example group of the present invention;

[0056] Figure 7 When the concentration of the standard in the embodiment of the present invention is 450 pg / μL, the qPCR detection results of the embodiment group and the comparative example group using two different probes are shown (A is an amplification curve diagram; B is a multi-component curve diagram);

[0057] Figure 8 The qPCR test results of the embodiment group and the comparative example group using two different probes when the concentration of the standard in the embodiment of the present invention is 45 pg / μL (A is an amplification curve graph; B is a multi-component curve graph);

[0058] Fig. 9 The qPCR test results of the embodiment group and the comparative example group using two different probes when the concentration of the standard in the embodiment of the present invention is 4.5 pg / μL (A is an amplification curve graph; B is a multi-component curve graph);

[0059] Fig.10 The qPCR test results of the embodiment group and the comparative example group using two different probes when the concentration of the standard in the embodiment of the present invention is 450 fg / μL (A is an amplification curve graph; B is a multi-component curve graph);

[0060] Fig.11 The qPCR test results of the embodiment group and the comparative example group using two different probes when the concentration of the standard in the embodiment of the present invention is 45 fg / μL (A is an amplification curve graph; B is a multi-component curve graph);

[0061] Fig.12 The qPCR test results of the embodiment group and the comparative example group using two different probes when the concentration of the standard in the embodiment of the present invention is 4.5 fg / μL (A is an amplification curve graph; B is a multi-component curve graph);

[0062] Fig.13 It is a graph showing the qPCR detection results of the example group and the comparative example group using two different probes when the concentration of the standard in the example of the present invention is 0.45 fg / μL (A is an amplification curve graph; B is a multi-component curve graph). DETAILED DESCRIPTION

[0063] The embodiments of the present invention will be described in detail below in conjunction with the examples, but it will be appreciated by those skilled in the art that the following examples are only used to illustrate the present invention and should not be considered as limiting the scope of the present invention. If no specific conditions are specified in the examples, the conditions are carried out according to normal conditions or the conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be obtained commercially.

[0064] The present application provides a primer set in an embodiment, comprising a primer pair and a DBQ double extraction quenching probe;

[0065] The primer pair is specific and complementary to the conserved region of the national standard pig ATP8 gene.

[0066] As mentioned above, DBQ dual quencher probe is a molecular biology tool used in quantitative PCR (qPCR) technology, which may contain at least one fluorescent group and one quencher group. During the qPCR process, this probe specifically binds to the target DNA sequence, and its fluorescent group emits a fluorescent signal when it is not approached by the quencher group.

[0067] As mentioned above, specificity refers to the ability of the primer pair to bind only to the target DNA sequence (in this case, a specific region of the national standard pig ATP8 gene) and not to other non-target sequences. This specificity ensures that only the target DNA sequence is amplified during the qPCR amplification process, thereby avoiding nonspecific amplification and false positive results.

[0068] As mentioned above, complementarity refers to the complementary pairing of the nucleotide sequence of the primer pair and the target DNA sequence in double-stranded DNA. In qPCR, the forward primer is complementary to one strand of the target sequence, and the reverse primer is complementary to the other strand. This complementary pairing ensures that the primer pair can accurately recognize and bind to the specific position of the target DNA sequence to initiate PCR amplification.

[0069] The specificity and complementarity of primer pairs are crucial for qPCR detection. Together, they ensure the accuracy of the experiment and improve the precision of the test by reducing the risk of nonspecific amplification and false positive results. In addition, this specific amplification enhances the sensitivity of qPCR, enabling it to detect extremely low-abundance target DNA sequences. At the same time, specificity and complementarity also ensure the repeatability of experimental results, ensuring that consistent results can be obtained in qPCR experiments under different conditions. Combined with the use of DBQ double-quenched probes, the amplification of PCR products can be accurately monitored to achieve quantitative analysis of target DNA sequences. Therefore, DBQ double-quenched probes and primer pairs with specificity and complementarity are the key to achieving accurate, sensitive and reliable qPCR detection, and play a vital role in improving the accuracy and applicability of livestock and poultry animal-derived component detection technology.

[0070] Furthermore, the oligonucleotide sequence of the DBQ double quenching probe has a fluorescent group at the 5' end and a quenching group at the 3' end;

[0071] Further, the fluorescent group is selected from at least one of FAM, HEX, VIC, TET and ROX;

[0072] Further, the quenching group is DBQ1 and / or DBQ2;

[0073] Furthermore, the quenching group is DBQ1.

[0074] Furthermore, the nucleotide sequence of the DBQ double quenching probe is shown in SEQ ID NO.1.

[0075] Further, the primer pair includes a forward primer and a reverse primer;

[0076] The nucleotide sequence of the forward primer is shown in SEQ ID NO.2;

[0077] The nucleotide sequence of the reverse primer is shown in SEQ ID NO.3.

[0078] Specifically, the nucleotide sequences of the forward and reverse primers can be:

[0079] Table 1. Nucleotide sequences of probes and primer pairs

[0080] name NO. Nucleotide sequence DBQ double extraction probe SEQ ID NO.1 5'-ATCTCAAACTACTCATACCCA-3' Forward primer SEQ ID NO.2 5'-ATCTACATGATTCATTACAATTAC-3' Reverse primer SEQ ID NO.3 5'-CTATGTTTTTGAGTTTTGAGTTCA-3'

[0081] In addition, the present application provides a method for detecting a national standard porcine-derived component based on the primer set described in any one of the aforementioned embodiments, comprising:

[0082] Step S1, synthesizing a single-stranded DNA molecule as a template DNA.

[0083] The above steps involve synthesizing a specific single-stranded DNA molecule that contains the conserved region of the national standard pig ATP8 gene, which is used as the template DNA for subsequent qPCR experiments, thereby obtaining a precisely defined single-stranded DNA template for generating positive standards. Using a synthetic single-stranded DNA molecule as a template ensures the consistency and reliability of the template in each experiment.

[0084] Specifically, single-stranded DNA molecules can be obtained by chemical synthesis or PCR method.

[0085] Step S2, using the primer pair in the primer set to amplify the template DNA to obtain a positive standard.

[0086] As described above, the template DNA is amplified by PCR using the forward and reverse primers in the primer set to generate sufficient amount of DNA fragments, which are used as positive standards, thereby obtaining DNA fragments containing the target sequence, i.e., the positive standard.

[0087] Positive standards can be used to establish a standard curve for qPCR, which is the basis for quantitative analysis.

[0088] Specifically, the amplification reaction can be performed using a conventional PCR instrument, using a DNA polymerase to synthesize a target DNA fragment under the guidance of a primer.

[0089] Step S3, performing absolute quantification on the positive standard, and constructing a standard curve based on the absolutely quantified positive standard;

[0090] As mentioned above, the purpose of absolute quantification of positive standards is to determine the exact copy number of the target DNA sequence in the standard, so that an accurate standard curve can be established. This step not only improves the accuracy and reliability of the test, but also helps to evaluate the efficiency of the qPCR reaction, calibrate the experimental conditions, reduce experimental errors, and ensure consistency between different experimental batches.

[0091] Absolute quantification is the determination of the exact copy number or concentration of the target DNA sequence in the standard. In a qPCR experiment, this can involve the following steps:

[0092] Standard preparation: Starting from a DNA sample of known concentration, a series of standards with varying concentrations are prepared through a series of dilution steps.

[0093] Serial dilution: The standard is serially diluted to different concentrations covering the expected detection range, for example, from 10 1 Up to 10 8 times dilution.

[0094] qPCR amplification: Perform qPCR amplification on these standards of different concentrations and record the CT value (threshold cycle number) at each concentration.

[0095] Draw a standard curve: Draw a standard curve with the logarithm of the standard copy number as the horizontal axis and the CT value as the vertical axis.

[0096] Determine concentration: With a standard curve, the exact copy number or concentration of each standard can be determined, which provides a benchmark for quantifying the target DNA sequence in the experiment.

[0097] The key to absolute quantification is to be able to accurately measure and compare the amount of target DNA sequence in the sample, and then accurately quantify the unknown sample. In this way, the accuracy and reliability of qPCR experimental results can be ensured, regardless of the concentration of the target sequence in the sample.

[0098] Step S4, using the primer pair and DBQ double quenching probe in the primer set, respectively performing qPCR amplification reactions on the positive standard, the template DNA and the target biological sample for absolute quantification, obtaining the fluorescence signals of the positive standard at different concentrations, and constructing a standard curve; and the fluorescence signal corresponding to the target biological sample;

[0099] In this step, the positive standard was diluted in series using primer pairs and DBQ double quenching probes, and qPCR amplification was performed to record the fluorescence signals at different concentrations to construct a standard curve. At the same time, qPCR amplification was performed on the template DNA and the target biological sample, and the fluorescence signals were recorded to establish a standard curve and obtain the fluorescence signal data of the target biological sample.

[0100] The standard curve allows for quantitative analysis of the target sequence in the target biological sample, improving the accuracy and sensitivity of the assay.

[0101] Amplification and fluorescence signal collection can be performed using a qPCR instrument, and the relationship between the fluorescence signal and DNA concentration can be analyzed using software to construct a standard curve.

[0102] Step S5, based on the standard curve, obtaining the detection result of the target biological sample according to the fluorescent signal corresponding to the target biological sample.

[0103] As described above, the fluorescence signal of the target biological sample is converted into DNA concentration or copy number using the established standard curve, and the quantitative result of the target sequence in the target biological sample is obtained.

[0104] This step provides an accurate method to determine the presence of a specific DNA sequence in a target biological sample. The concentration of the target DNA in the sample can be calculated using linear regression or other mathematical models by comparing the fluorescent signal of the target biological sample to the standard curve.

[0105] For the construction of the standard curve, a linear regression model can be used: y=mx+b, where y is the CT value, x is the DNA copy number after log10 conversion, m is the slope, and b is the intercept.

[0106] For the quantification of the target biological sample, the above regression equation can be used, the CT value of the sample is substituted, and x, which is the target DNA copy number in the sample, is solved.

[0107] Through these steps, the method in this embodiment provides an accurate and sensitive national standard pig-derived component detection method, which can be applied to food safety testing and quality control of biological products.

[0108] It should be noted that the test results of the target biological sample can be qualitative results, i.e., whether the national standard pig component is present, or quantitative results, i.e., the determination of the amount of national standard pig DNA. Through the above detection process, a method for rapid and accurate DNA quantification is provided, which is helpful for evaluating the safety and quality of biological products.

[0109] Specifically, you can use qPCR data analysis software, input the fluorescence signal, calculate the DNA concentration according to the standard curve, and compare and analyze the quantities of different samples to ensure compliance with regulatory standards.

[0110] Furthermore, the nucleotide sequence of the single-stranded DNA molecule is shown in SEQ ID NO.4.

[0111] In the above, the nucleotide sequence of the single-stranded DNA molecule (SEQ ID NO.4) can be:

[0112] ATCTACATGATTCATTACAATTACATCAATAATTATAACATTATTTAT TTTATTCCAACTAAAAATCTCAAACTACTCATACCCAGCAAGCCCAGA ATCAACCGAACTCAAAACTCAAAAACATAG.

[0113] As mentioned above, the nucleotide sequence of the single-stranded DNA molecule must contain the conserved region of the national standard pig ATP8 gene to ensure that the primer pair can specifically bind to and amplify the target DNA sequence. The sequence must be complementary to the nucleotide sequence of the primer pair so that the primer can effectively anneal and bind to the single-stranded DNA molecule to initiate PCR amplification. The sequence of the single-stranded DNA molecule should contain the binding site of the DBQ double quenching probe to ensure that the probe can specifically bind to the target sequence during the qPCR process and release the fluorescent signal during the amplification process.

[0114] By meeting the above requirements, single-stranded DNA molecules can be used as effective template DNA to generate positive standards and produce reliable fluorescent signals in qPCR, thereby achieving accurate detection of national standard porcine-derived ingredients.

[0115] Furthermore, the step S3, performing absolute quantification on the positive standard, and constructing a standard curve based on the absolutely quantitative positive standard, comprises:

[0116] Step S31, dilute the positive standard by 10 1 Up to 10 8 times, to obtain the positive standard with different concentrations;

[0117] As mentioned above, in order to establish a standard curve for qPCR, a series of positive standards with known concentrations are required. The stored positive standards (materials known to contain the target DNA sequence) are diluted to the preset concentration required for the experiment to obtain the diluted positive standards as the basis for establishing the standard curve, ensuring that the concentration range of the standards covers the dynamic range of the experimental detection.

[0118] This step involves serial dilution of the obtained positive standard to create a series of standard solutions with different concentrations, covering from 10 1 Up to 10 8 A dilution range of 2.5 times was obtained to obtain a series of positive standards with different concentrations for subsequent qPCR experiments.

[0119] Serial dilutions can ensure that the standard curve covers a wide concentration range, improving the accuracy and reliability of quantitative analysis.

[0120] For specific dilution processing, a precise pipette can be used for dilution.

[0121] As described above, the concentration of the positive standard can be determined using a UV-visible spectrophotometer.

[0122] This step is to obtain a concentration gradient spanning multiple orders of magnitude for the purpose of establishing a standard curve. 1 ~10 8 The dilution is multiplied by 1:1 to obtain a series of dilution samples with different concentrations for qPCR analysis. A wide range of concentration gradients is generated in this step, which helps to draw an accurate standard curve. Specifically, the amount of diluent required to be added can be calculated by the dilution formula and operated using a pipette.

[0123] For example, dilutions can be performed using precise liquid handling equipment to ensure accurate concentrations.

[0124] For example, the step of gradient dilution may include:

[0125] (1) The concentration of linearized plasmid DNA measured by spectrophotometer was 4.5 ng / μL.

[0126] (2) Tube 1: Prepare tube 1 by taking 10 μL of 4.5 ng / μL (4500 pg / μL) DNA solution and adding 90 μL of DNA diluent to a final concentration of 450 pg / μL.

[0127] (3) Tube 2: To prepare Tube 2 (45 pg / μL), take 10 μL of the solution in Tube 1 (450 pg / μL) and add 90 μL of DNA diluent to a final concentration of 45 pg / μL.

[0128] (4) Tube 3: To prepare Tube 3 (4.5 pg / μL), take 10 μL of the solution in Tube 2 (45 pg / μL) and add 90 μL of DNA diluent to a final concentration of 4.5 pg / μL.

[0129] (5) Tube 4: Prepare Tube 4 (450 fg / μL), take 10 μL of the solution in Tube 3 (4.5 pg / μL), add 90 μL of DNA diluent, and the final concentration is 450 fg / μL.

[0130] (6) Tube 5: To prepare Tube 5 (45 fg / μL), take 10 μL of the solution in Tube 4 (450 fg / μL) and add 90 μL of DNA diluent to a final concentration of 45 fg / μL.

[0131] (7) Tube 6: To prepare Tube 6 (4.5 fg / μL), take 10 μL of the solution in Tube 5 (45 fg / μL) and add 90 μL of DNA diluent to a final concentration of 4.5 fg / μL.

[0132] (8) Tube 7: Prepare Tube 7 (0.45 fg / μL), take 10 μL of the solution in Tube 6 (4.5 fg / μL), add 90 μL of DNA diluent, and the final concentration is 0.45 fg / μL.

[0133] Step S32, take dilution 10 1 Up to 10 8 The positive standard is tested by qPCR at a concentration of times the positive standard, and a standard curve is drawn with the logarithm of the copy number obtained according to the concentration of the positive standard as the abscissa and the CT value measured by the positive standard as the ordinate to obtain the absolute quantitative result of the positive standard.

[0134] As mentioned above, select an appropriate dilution factor to ensure that it is within the sensitivity range of qPCR detection. Take the 10 dilution in step 22. 1 Up to 10 8 The samples were diluted to different times for qPCR detection, so as to obtain the fluorescence signal data at different dilution times for absolute quantification. This step is used to ensure that the concentration of the selected samples is suitable for qPCR detection, and to avoid inaccurate quantification due to too high or too low concentration.

[0135] Specifically, appropriate samples may be selected for qPCR according to a predetermined dilution range.

[0136] As mentioned above, the positive standard was quantified using a UV-visible spectrophotometer, and the selected samples were diluted 10 1 Up to 10 8 times the sample to obtain the copy number or concentration of the positive standard.

[0137] In the above, qPCR amplification is performed using diluted standards of different concentrations, and the CT value at each concentration is recorded to obtain the CT value of each dilution standard, which will be used to construct the standard curve. The data obtained through the experiment is closer to the actual operating conditions, which improves the practicality and accuracy of the experiment. Amplification can be performed in a qPCR instrument, and the CT value of each sample can be recorded.

[0138] Use the logarithmic value of the concentration of the standard (expressed in copy number) as the horizontal axis and the corresponding CT value as the vertical axis to draw a standard curve. Construct a standard curve that can be used to convert the CT value into the DNA copy number. The standard curve provides an intuitive method to predict the copy number of the target DNA sequence in an unknown sample.

[0139] As mentioned above, the exact copy number of each dilution standard is determined through the standard curve, thereby obtaining the absolute quantitative result, thereby obtaining the absolute copy number of each dilution standard and confirming the concentration of the standard. The absolute quantitative result provides an accurate DNA copy number and provides an accurate reference for subsequent experiments. The copy number corresponding to each CT value can be calculated using the standard curve equation.

[0140] Specific methods and algorithm examples: The construction of the standard curve can use a linear regression model: y = mx + b, where y is the CT value, x is the DNA copy number after log10 conversion, m is the slope, and b is the intercept. Absolute quantification can be achieved by substituting the experimentally obtained CT value into the standard curve equation and solving for x (DNA copy number).

[0141] Further, the step S4, using the primer pair and DBQ double extraction quenching probe in the primer set, respectively performs qPCR amplification reaction on the positive standard, the template DNA and the target biological sample for absolute quantification, including:

[0142] Step S41, preparing a template-free qPCR reaction mixture and performing a template-free qPCR reaction.

[0143] In the above steps, a qPCR reaction mixture that does not contain a DNA template needs to be prepared to detect and verify whether there is nonspecific amplification or contamination in the qPCR reaction system, so as to obtain the result of the no-template control, which is used to evaluate the specificity and background noise level of the qPCR reaction.

[0144] This step is used to ensure the reliability of the qPCR reaction system, eliminate the interference of non-specific amplification, and improve the accuracy of the experimental results. You can perform the qPCR reaction according to the formula of the qPCR reaction system, but without adding DNA template.

[0145] Step S42, preparing a qPCR amplification reaction system containing a DNA sample, and amplifying the positive standard and the template DNA based on the qPCR amplification reaction system to obtain fluorescence signal data corresponding to the positive standard; and using the qPCR amplification reaction system to amplify the target biological sample to obtain the fluorescence signal data of the target biological sample.

[0146] As described above, a qPCR reaction system containing DNA samples (positive standard and template DNA) is prepared, and qPCR amplification is performed to obtain fluorescence signal data of the positive standard and template DNA for analysis. By comparing the fluorescence signals of different samples, the efficiency and specificity of the qPCR reaction can be evaluated, providing benchmark data for subsequent detection of target biological samples.

[0147] As mentioned above, the qPCR amplification and fluorescence signal data of template DNA are crucial to ensure the accuracy, reliability and validity of the experiment, and they play multiple roles in the design, execution and result interpretation of qPCR experiments. By using template DNA for qPCR amplification, it can be verified whether the primer pair and DBQ double quenching probe can specifically recognize and amplify the target sequence. This helps to confirm whether the design of the primers and probes is correct and whether they can work effectively. The efficiency of the qPCR reaction can be evaluated. This is crucial for subsequent quantitative analysis because the qPCR efficiency will affect the accuracy of the CT value.

[0148] It should be noted that, using a qPCR reaction system comprising the primer pair in the primer set as described above and the DBQ double quenching probe, the positive standard and the template DNA after absolute quantification are subjected to qPCR amplification reactions respectively. At this time, the reaction system, reaction procedure and reaction conditions should remain consistent.

[0149] The advantage is that keeping the reaction conditions consistent helps ensure the repeatability of the experiment and the reliability of the results. Using the same system and procedure for qPCR of standards and samples can ensure that the quantitative results obtained from the standard curve are directly related to the sample results. Consistent conditions help reduce variables and thus improve the accuracy of the experiment. In qPCR experiments, using a unified reaction system and procedure can improve the efficiency of experimental operations. In addition, the unified conditions enable the standard curve established based on the fluorescence signal of the standard to be accurately applied to the quantitative analysis of the sample.

[0150] The specific method of performing qPCR amplification reaction on the positive standard after absolute quantification may include:

[0151] Performing gradient dilution on the positive standard after absolute quantification to obtain a positive standard dilution solution at a target concentration;

[0152] The positive standard dilutions at the target concentration are added to the reaction carrier (microplate) according to the qPCR reaction system to facilitate the qPCR amplification reaction.

[0153] As mentioned above, in qPCR (quantitative polymerase chain reaction), a standard curve is required to be established through a series of standards with known concentrations. This curve shows the relationship between the fluorescence signal intensity and the target DNA concentration, allowing the concentration of unknown samples to be accurately quantified. Through gradient dilution, the exact concentration of each standard can be ensured. Different experiments require the detection of target DNA in different concentration ranges. Through gradient dilution, a series of standards covering a wide concentration range can be created to meet different detection needs.

[0154] After the gradient dilution process, the final concentration was 450 pg / μL to 0.45 fg / μL as the target concentration.

[0155] As mentioned above, firstly, the required amount needs to be calculated, which can be calculated according to the carrier for the reaction. In the embodiment of the present application, a micro-reaction plate is used as the reaction carrier, such as a 96-well plate.

[0156] The total amount of Mix solution required is calculated according to the number of reaction wells. The calculation method can be:

[0157] Mix = (number of reaction wells + 3) × (10 + 0.4 + 0.4 + 0.2 + 1) μL; where number of reaction wells + 3 represents the loss of 3 wells. Three replicate wells were made for each test sample. The concentration of each tube for the specific gradient dilution process can be referred to Table 1.

[0158] Table 1. Serial dilution of positive standards

[0159] Dilution tube Dilution ratio Final concentration Tube 1 10μL positive standard + 90μL DNA dilution solution 450pg / μL Tube 2 10μL tube 1 + 90μL DNA dilution buffer 45 pg / μL Tube 3 10μL tube 2 + 90μL DNA dilution buffer 4.5 pg / μL Tube 4 10μL tube 3 + 90μL DNA dilution buffer 450fg / μL Tube 5 10μL tube 4 + 90μL DNA dilution buffer 45fg / μL Tube 6 10μL tube 5 + 90μL DNA dilution buffer 4.5 fg / μL Tube 7 10μL tube 6 + 90μL DNA dilution buffer 0.45 fg / μL

[0160] Furthermore, the qPCR amplification reaction system comprises:

[0161] 2×qPCR Mix UDG, 12.5 μL;

[0162] Forward primer 10 μM concentration, 0.5 μL;

[0163] Reverse primer 10 μM concentration, 0.5 μL;

[0164] DBQ dual quenching probe 10 μM concentration, 0.5 μL;

[0165] ddH2O, 9 μL;

[0166] DNA sample, 2 μL;

[0167] Wherein, the DNA sample includes the positive standard and the template DNA.

[0168] As mentioned above, 2×qPCR Mix (UDG) is a premixed qPCR reaction system, which usually contains PCR buffer, Mg2+, stabilizer, and one or more DNA polymerases. "2×" means that this is a double concentrated Mix, which needs to be diluted according to the instructions before use. The "UDG" in brackets refers to the inclusion of uracil-DNA glycosylase, which can prevent the re-amplification of PCR products and improve the specificity of qPCR.

[0169] Furthermore, the template-free qPCR reaction mixture comprises:

[0170] 2×qPCR Mix UDG, 12.5 μL;

[0171] Forward primer 10 μM concentration, 0.5 μL;

[0172] Reverse primer 10 μM concentration, 0.5 μL;

[0173] DBQ dual quenching probe 10 μM concentration, 0.5 μL;

[0174] ddH2O, 11 μL.

[0175] In addition, in the step, the reaction system of the qPCR reaction mixture without template is the same as the above reaction system, and the reaction procedure can be the same as the positive standard and the template DNA after absolute quantification.

[0176] In addition, an example of the present application also provides an application of a primer set as described in any of the aforementioned implementation modes in national standard pig detection.

[0177] The present invention is further described below by means of specific examples, but it should be understood that these examples are only used for more detailed description and should not be construed as limiting the present invention in any form.

[0178] Example 1: Preparation of national standard pig detection template

[0179] In this example, template DNA was prepared

[0180] Experimental methods:

[0181] (1) Using the synthesized single strand as a template for PCR amplification;

[0182] (2) Primers F / R were used as amplification primers and a PCR Mix kit was used to obtain the target fragment. The reaction system and reaction procedure are shown in Tables 2 and 3.

[0183] Table 2. Target gene amplification reaction system

[0184] Components Volume (μL) 2×PCR Mix 25 F1 2 R1 2 template 1 ddH2O 20

[0185] Table 3. Target gene amplification reaction procedure

[0186]

[0187] (3) After PCR amplification, 1% agarose gel was used to detect whether there was a target band and whether the target band was single. The target band was recovered using a gel recovery kit. The concentration of the template DNA was measured using a NanoDrop UV spectrophotometer and stored at -20°C for future use.

[0188] Example 2: Establishment of standard curve

[0189] In this example, a standard curve was established.

[0190] Experimental methods:

[0191] 1. Experimental group settings:

[0192] In this example, the technology in this application was compared with the conventional method, and different primer sets were used to set up different experimental groups (example group and comparative example group).

[0193] In the embodiment group, that is, the technology of the embodiment of the present application, the primer group in the reaction system used is:

[0194] (1) DBQ double quenching probe: 5'-FAM-ATCTCAAACTACTCATACCCA-DBQ1-3';

[0195] (2) Forward primer (detection primer-F): 5'-ATCTACATGATTCATTACAATTAC-3'

[0196] (3) Reverse primer (detection primer-R): 5'-CTATGTTTTTGAGTTTTGAGTTCA-3'.

[0197] The primer set used in the comparative example group is:

[0198] (1) National standard porcine TAMRA probe: 5'-ATCTCAAACTACTCATACCCA-TAMRA-3';

[0199] (2) Forward primer (detection primer-F): 5′-ATCTACATGATTCATTACAATTAC-3′;

[0200] (3) Reverse primer (detection primer-R): 5'-CTATGTTTTTGAGTTTTGAGTTCA-3'.

[0201] It should be noted that the following experiments were carried out for the example group and the comparative example group, including the preparation of the reaction system, and the reaction and detection under specific procedures to obtain the results.

[0202] 2. Prepare the reaction system:

[0203] 1) Prepare a template-free qPCR reaction mix. The reaction system is shown in Table 4. After mixing, dispense 25 μL / well into a 96-well plate.

[0204] Table 4. qPCR Mix reaction system

[0205] Components Volume (μL) 2×qPCR Mix (UDG) 12.5 Detection primer-F (10 μM) 0.5 Detection primer-R (10 μM) 0.5 DBQ dual quenching probe (10 μM) 0.5 <![CDATA[ddH2O]]> 11

[0206] 2) The template DNA obtained in Example 1 was also prepared using the reaction system in Table 4 and dispensed into a 96-well plate;

[0207] 3) Then dilute the positive template with DNA diluent in a gradient manner. The template dilution is shown in Table 1.

[0208] Add the diluted samples with concentrations ranging from 450 pg / μL to 0.45 fg / μL to the qPCR Mix in a 96-well plate, add 1 μL to each well, and perform 3 replicates for each concentration.

[0209] The total amount of Mix solution required needs to be calculated according to the number of reaction wells, and the calculation method can be: Mix solution = (number of reaction wells + 3) × (10 + 0.4 + 0.4 + 0.2 + 8) μL; the number of reaction wells + 3 represents the loss amount of 3 wells. Three replicate wells are made for each test sample.

[0210] (2) Program settings:

[0211] 1) Create a detection probe, select "FAM" as the reporter group, "None" as the quencher group, and "None" as the reference fluorescence.

[0212] 2) In the "Assign target(s) to the selected wells" panel, set the "Task" column of the standard curve wells to "Standard", and assign values ​​of 450000, 45000, 4500, 450, 450, 45, 2.5, and 0.45 in the "Quantity" column (meaning the DNA concentration of each well, in fg / μL), and name the corresponding "Sample name" column according to the corresponding concentration.

[0213] 3) Set the amplification program, see Table 5: reaction volume 20 μL, start the run after setting.

[0214] Table 5. Amplification procedures

[0215]

[0216] 3. Result analysis: Compare the experimental data of the embodiment group and the comparative example group.

[0217] In the example, firstly, a national standard pig detection standard curve is established using different probes, and then the results of the example group and the comparative group are compared from the dimensions of the linear relationship of the standard curve, the qPCR fluorescence increment and the probe basal fluorescence value.

[0218] Based on the comparative analysis of qPCR data, ΔRn was used to compare the fluorescence increments of the two probes, and Fluorescence was used to compare the basal fluorescence values ​​of the two probes.

[0219] (1)Reference Figure 1 to Figure 3 ( Figure 1 to Figure 3 Using TAMRA modified probe) and Figures 4 to 6 ( Figures 4 to 6 Using DBQ1 double quenching probe), it can be seen that the linear relationship of the standard curves established by the two probes is good, and the standard curves for national standard pig detection can be established for both.

[0220] (2) Figure 3 The quenching group of the probe in the comparative group has a fluorescent signal, and the base fluorescence value is high. Figure 6 The basal fluorescence value of the DBQ double-quenching probe in this application is significantly lower, and the light gain increment is also higher than that of the control group probe in the test group, which is more conducive to result analysis.

[0221] (3) Furthermore, the qPCR results at each concentration of the standard were analyzed separately, and the fluorescence increment and basal fluorescence values ​​of the two probes were compared, and the detection results from the concentration of 450 pg / μL standard to 0.45 fg / μL standard were obtained.

[0222] refer to Figure 7 to Figure 13 The results show that compared with the national standard porcine TAMRA probe in the comparative group, the DBQ double quenching probe in the embodiment group has a low basal fluorescence value and a significantly better fluorescence increment, which is better than the control group probe.

[0223] In summary, by comparing the standard curves, basal fluorescence values, fluorescence increments, etc. established for the two probes (example group and comparative example group), the DBQ double quenching probe in the example group has lower basal fluorescence and better fluorescence increment.

[0224] The detection results were analyzed and compared, and it was concluded that the DBQ double-quenching probe of the embodiment group was superior, and its higher fluorescence increment was more conducive to result analysis. When observing test samples of different concentrations, the comparison was obvious and easy to analyze, thereby improving the accuracy and sensitivity of the experiment.

[0225] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein by equivalents. However, these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A primer set, characterized in that: Includes primer pairs and DBQ double extraction probes; The primer pair is specific and complementary to the conserved region of the national standard pig ATP8 gene.

2. The primer set according to claim 1, characterized in that: The oligonucleotide sequence of the DBQ double quenching probe has a fluorescent group at the 5' end and a quenching group at the 3' end; Preferably, the fluorescent group is selected from at least one of FAM, HEX, VIC, TET and ROX; Preferably, the quenching group is DBQ1 and / or DBQ2; Preferably, the quencher group is DBQ1.

3. The primer set according to claim 1, characterized in that: The nucleotide sequence of the DBQ double quenching probe is shown in SEQ ID NO.

1.

4. The primer set according to claim 1, characterized in that: The primer pair includes a forward primer and a reverse primer; The nucleotide sequence of the forward primer is shown in SEQ ID NO.2; The nucleotide sequence of the reverse primer is shown in SEQ ID NO.

3.

5. A method for detecting the national standard pig-derived components based on the primer set according to any one of claims 1 to 4, characterized in that: include: Synthesize single-stranded DNA molecules as template DNA; Using the primer pair in the primer set to amplify the template DNA to obtain a positive standard; Absolutely quantifying the positive standard, and constructing a standard curve based on the absolutely quantitative positive standard; Using the primer pair and DBQ double quenching probe in the primer set, qPCR amplification reactions are performed on the positive standard, the template DNA and the target biological sample for absolute quantification, respectively, to obtain the fluorescence signals of the positive standard at different concentrations, and the fluorescence signals corresponding to the target biological sample; Based on the standard curve, obtaining a detection result of the target biological sample according to the fluorescent signal corresponding to the target biological sample; Preferably, the nucleotide sequence of the single-stranded DNA molecule is as shown in SEQ ID NO.

4.

6. The method for detecting the national standard porcine-derived components as claimed in claim 5, characterized in that: The absolute quantification of the positive standard and the construction of a standard curve based on the absolute quantification of the positive standard include: The positive standard was serially diluted 10 1 Up to 10 8 times, to obtain the positive standard with different concentrations; Take dilution 10 1 Up to 10 8 The positive standard is tested by qPCR at a concentration of times the positive standard, and a standard curve is drawn with the logarithm of the copy number obtained according to the concentration of the positive standard as the abscissa and the CT value measured by the positive standard as the ordinate to obtain the absolute quantitative result of the positive standard.

7. The method for detecting the national standard porcine-derived components as claimed in claim 5, characterized in that: The method of using the primer pair and DBQ double extraction quenching probe in the primer set to perform qPCR amplification reaction on the positive standard, the template DNA and the target biological sample for absolute quantification respectively comprises: Prepare a template-free qPCR reaction mixture and perform a template-free qPCR reaction; A qPCR amplification reaction system containing a DNA sample is prepared, and the positive standard and the template DNA are amplified based on the qPCR amplification reaction system to obtain fluorescence signal data corresponding to the positive standard; and the target biological sample is amplified using the qPCR amplification reaction system to obtain fluorescence signal data of the target biological sample.

8. The method for detecting the national standard porcine-derived components as claimed in claim 7, characterized in that: The qPCR amplification reaction system comprises: 2×qPCR Mix UDG, 12.5 μL; Forward primer 10 μM concentration, 0.5 μL; Reverse primer 10 μM concentration, 0.5 μL; DBQ dual quenching probe 10 μM concentration, 0.5 μL; ddH2O, 9 μL; DNA sample, 2 μL; Wherein, the DNA sample includes the positive standard and the template DNA.

9. The method for detecting the national standard porcine-derived components as claimed in claim 7, characterized in that: The template-free qPCR reaction mixture comprises: 2×qPCR Mix UDG, 12.5 μL; Forward primer 10 μM concentration, 0.5 μL; Reverse primer 10 μM concentration, 0.5 μL; DBQ dual quenching probe 10 μM concentration, 0.5 μL; ddH2O, 11 μL.

10. Use of the primer set according to any one of claims 1 to 4 in national standard pig detection.

Images