Detection method and application of GPR107 gene related to duck egg weight character

Abstract

The invention relates to a GPR107 gene detection method related to duck egg weight traits and application, and belongs to the technical field of biology. By detecting the genotype of the 7909242th basic group of the No.18 chromosome of the GPR107 gene, the egg weight of a T / T genotype individual is higher than that of a T / C genotype individual and that of a C / C genotype individual, the egg weight of the T / C genotype individual is higher than that of the C / C genotype individual, and the method is used for screening egg weight indexes of high-quality laying ducks, and has the beneficial effects that the duck egg weight character can be efficiently and quickly identified, and the quality of the high-quality laying ducks is improved. The seed selection accuracy is improved, the breeding progress is accelerated, and the breeding cost and the production cost are reduced. In addition, the detection method disclosed by the invention is simple and easy to operate, can be carried out in a laboratory, and can also be applied to a genome breeding technology.

Description

Technical Field

[0001] The invention relates to a GPR107 gene detection method and application related to duck egg weight traits, belonging to the field of biotechnology. Background Art

[0002] In poultry production, egg-laying performance is an extremely important main economic trait for both egg-laying and meat-laying poultry. Varieties with excellent egg-laying performance have more advantages in improving the seed supply capacity of breeding poultry, reducing seed production costs, and improving commercial production capacity and economic benefits. Egg-laying performance is mainly affected by multiple factors such as genetics, environment and nutrition, and is a low-heritability quantitative trait controlled by micro-effect polygenes. In the past, the selection and breeding of poultry egg-laying performance was mainly based on conventional phenotypic breeding. After nearly a century of breeding, the selection and breeding of important egg-laying performance such as egg production and egg weight has been greatly improved, especially in laying hens, where indicators such as egg number have reached their limits. With the improvement of poultry egg-laying performance and the development of breeding technology, traditional phenotypic selection can no longer meet the genetic breeding needs of egg-laying performance indicators such as egg weight; especially for waterfowl, due to the limitations of understanding of their biological characteristics such as water preference and courtship and mating, waterfowl breeding has been in a state of large-scale breeding, which has become one of the bottlenecks hindering the progress of waterfowl egg-laying performance breeding.

[0003] Egg weight has a significant impact on the economic value of laying duck production. In the market, duck eggs are usually sold in the form of different processed products such as salted duck eggs and preserved eggs. The price of the product is usually related to its weight. Heavier duck eggs indicate a higher product grade, and the market reflects a higher price and higher production economic benefits. In addition, the egg weight of duck eggs will also affect its hatching rate and the birth weight of ducklings. Studies have shown that appropriate egg weight can significantly improve the fertilization rate and hatching rate; the birth weight of ducklings is significantly positively correlated with egg weight. The egg weight index of laying ducks has complex genetic characteristics and is controlled by multiple genes. Studies have shown that the heritability of egg weight traits can reach 45-55%, which means that egg weight indicators can be selected through genetic markers; but the current egg weight selection and breeding is slow under the traditional breeding technology, and it is urgent to develop new related genes to provide multiple ways for the selection and breeding of egg weight traits. Summary of the invention

[0004] The purpose of the present invention is to address the defects of the prior art and to propose a GPR107 gene detection method and application related to duck egg weight traits, which can quickly and accurately identify duck egg weight traits.

[0005] The present invention measured the egg weight of Jinding ducklings at 43 weeks of age, used whole genome resequencing technology for SNP genotyping, and screened the GPR107 gene molecular marker significantly associated with duck egg weight through whole genome association analysis, providing new gene and molecular marker resources for the egg weight trait selection of ducks. The GPR107 gene is a member of the G protein-coupled receptor (GPCR) family. GPCR is a class of receptors widely present in organisms and is also the core of the HPG axis function. In the hypothalamus, GPCR can respond to different neurotransmitters and hormones, such as dopamine, norepinephrine and 5-hydroxytryptamine, etc., affecting the activity of hypothalamic neurons, regulating the release of GnRH, promoting the secretion of LH and FSH, and ultimately affecting reproductive function and regulating egg-laying traits.

[0006] The present invention solves the technical problem through the following technical scheme: The present invention first provides a method for detecting the GPR107 gene related to the duck egg weight trait, comprising the following steps: The first step is to use duck DNA samples to perform PCR using duck DNA specific primers. amplification to obtain an amplification product; The second step is to perform Sanger sequencing on the amplified product; Step 3: Determine the SNP molecular marker of the target site based on the sequencing results of the second step genotype.

[0007] In the first step of the above method, the deoxyribonucleotide sequence of the duck DNA specific primer pair is composed of the upstream primer: 5'-CCCAGACACCCGAAATAG-3' (SEQ ID NO: 1) The downstream primer is composed of 5'-AGCAAAGAAGAGCGAGGA-3' (SEQ ID NO: 2). The molecular marker corresponding to the duck DNA specific primer is located at the 7909242nd base of chromosome 18 of the duck reference genome GCF_015476345.1_ZJU1.0 version. The base mutation is T or C, and the genotype is T / T, T / C and C / C.

[0008] The final concentration of the PCR reaction system is calculated based on 25 μl: Duck DNA to be tested 50 ng 2 x Accurate Taq Master Mix 12.5μl Upstream primer 1 μl Downstream primer 1 μl Add sterile water to 25 μl. The reaction conditions for PCR amplification were as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 sec, annealing at 55°C for 30 sec, extension at 72°C for 60 sec, for a total of 30 cycles; extension at 72°C for 2 min; and storage at 20°C.

[0009] The amplified product is 190 bp in length and contains the 7909242nd base on chromosome 18 of the duck reference genome GCF_015476345.1_ZJU1.0 version. The sequence of the amplified product is shown in SEQ ID NO: 3 or SEQ ID NO: 4.

[0010] In the third step, the judgment standard is that the egg weight of ducks with T / T genotype at the SNP site is higher than that of ducks with T / C genotype and ducks with C / C genotype, and the egg weight of ducks with T / C genotype is higher than that of ducks with C / C genotype.

[0011] The present invention further provides an application of a GPR107 gene detection method associated with duck egg weight traits, which is used to detect the egg weight traits of 43-week-old Jinding ducks.

[0012] The present invention detects the genotype of the 7909242nd base of chromosome 18 of the GPR107 gene, and obtains that the egg weight of the T / T genotype individual at 43 weeks of age is higher than that of the T / C genotype and C / C genotype individuals, and the egg weight of the T / C genotype individual is higher than that of the C / C genotype individual. The genomic DNA of the duck to be tested is used as a template, a specific primer pair is used for PCR amplification, and then the PCR amplification product is subjected to Sanger sequencing and SNP molecular marker genotyping, and the genotype based on the SNP molecular marker can be used to select the duck egg laying performance. In breeding, according to the breeding goal, by eliminating the T / C genotype individuals, retaining the T / T genotype or C / C genotype individuals, they are used to screen the high-quality duck egg weight index, and the beneficial effect is that the duck egg weight trait can be identified efficiently and quickly, providing a scientific basis for the early selection of high-quality ducks, helping to accelerate breeding progress, improve breeding accuracy, reduce breeding costs and production costs, and having great application value and breeding value for high-quality ducks. In addition, the detection method disclosed in the present invention is simple and easy to operate, can be carried out in the laboratory, and can also be applied to genome breeding technology. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 This is the Manhattan plot of the GWAS analysis of duck egg weight at 43 weeks of age.

[0014] Figure 2 These are the Sanger sequencing results of the PCR amplification products of the three genotypes.

[0015] Figure 3 This is the phenotypic distribution diagram of individuals with three genotypes of the chr18:7909242 molecular marker. DETAILED DESCRIPTION

[0016] Suitable for breeding of Jinding duck.

[0017] Example 1 In this example, the egg weight of Jinding ducks at 43 weeks of age was measured, and SNP genotyping was performed using whole genome resequencing technology. The GPR107 gene molecular marker significantly associated with egg weight was screened through whole genome association analysis. The results are as follows: Figure 1 shown.

[0018] In this example, the following experiments were performed to identify and apply the GPR107 gene molecular marker related to duck egg weight. 1. Phenotypic and genotypic testing (1) Experimental materials and egg weight phenotype determination 536 Jinding female ducks were selected as experimental animals and raised under the same feeding conditions with free access to food and water. At 43 weeks of age, the egg weight of each duck was recorded in turn as the phenotypic data of duck egg weight.

[0019] (2) Extraction of genomic DNA Blood was collected from the subwing vein of the individual to be tested, lysed after anticoagulation, digested with proteinase K, extracted with saturated sodium chloride method, dissolved in TE and stored at -20℃.

[0020] (3) PCR amplification The above-extracted genomic DNA was used as a template to amplify a fragment containing the SNP molecular marker at base 7909242 of duck chromosome 18.

[0021] Upstream primer: 5'-CCCAGACACCCGAAATAG-3' (SEQ ID NO: 1) Downstream primer: 5'-AGCAAAGAAGAGCGAGGA-3' (SEQ ID NO: 2) The final concentration of the reaction system (25 μl) is: DNA to be tested 50 ng 2 x Accurate Taq Master Mix 12.5 μl Upstream primer 1 μl Downstream primer 1 μl Add sterile water to 25 μl.

[0022] The reaction conditions of PCR amplification were as follows: 94°C pre-denaturation for 5 min; 94°C denaturation for 30 sec, 55°C annealing for 30 sec, 72°C extension for 60 sec, 30 cycles in total; 72°C extension for 2 min; 20°C storage; 10 μl was taken for agarose detection, and a single target band with a length of 190 bp was obtained, containing the 7909242nd base of duck chromosome 18, and its sequence is as follows: SEQ ID NO: 3 CCCAGACACCCGAAATAGGGGAGAAAAGAAAGGAGGCACCAAAGCCAGCTTGTGGCAGCCAGTGACAGCCACACTGAGCCCGAAACTGCTCACCCAGCCCCAAAACCCACAGGATTTGGTCAAACTCCGAGGGAACATTTCCAAAGGAAACCCCATCCACCTCCACACCCACCTCCTCGCTCTTCTTTGCT SEQ ID NO: 4 CCCAGACACCCGAAATAGGGGAGAAAAGAAAGGAGGCACCAAAGCCAGCTTGTGGCAGCCAGTGACAGCCACACTGAGCCCGAAACTGCTCACCCAGCCCCAAAACCCACAGGATTTGGTCAAACTCCGAGGGAACATTTCCAAAGGAAACCTATCCACCTCCACACCCACCTCCTCGCTCTTCTTTGCT (4) Sequencing verification and genotyping The PCR products of each sample were subjected to Sanger sequencing, and the sequencing peak graph was as follows: Figure 2 shown.

[0023] 2. Results Analysis 514 43-week-old Jinding female ducks with clear egg weight phenotype records were selected for correlation analysis. The t.test test function of R 4.0 software was used for statistical testing, and the pairwise mean comparison mode was selected to perform statistical tests on the genotype and egg weight of the experimental duck group. P<0.05 indicated a significant difference, and P<0.01 indicated an extremely significant difference. The results are shown in Table 1 and Figure 3As shown in the data, among the tested individuals, there were 289 T / T genotypes, 126 T / C genotypes, and 99 C / C genotypes. The egg weights of the three genotypes at 43 weeks of age were significantly different (p<0.01). The average egg weight of T / T genotype individuals at 43 weeks of age was 78.48, which was significantly higher than that of T / C and C / C genotype individuals (p<0.01), 3.6 higher than that of T / C genotype individuals, and 7.87 higher than that of C / C genotype individuals. The average egg weight of T / C genotype individuals was 74.88, which was significantly higher than that of C / C genotype individuals (p<0.01), and 4.27 higher than that of C / C genotype individuals. The results showed that the duck GPR107 gene molecular marker was significantly correlated with duck egg weight. According to the actual breeding goals, T / T genotype individuals can be selected to increase duck egg weight, or C / C genotype individuals can be selected to reduce duck egg weight, to meet the egg weight requirements of different markets and improve breeding efficiency.

[0024] Table 1 Association analysis between the molecular marker at base 7909242 on chromosome 18 and egg weight genotype Number / piece Egg weight at 43 weeks Standard Deviation CV T / T 289 <![CDATA[78.48 a ]]> 2.2 2.80% T / C 126 <![CDATA[74.88 b ]]> 1.9 2.54% C / C 99 <![CDATA[70.61 c ]]> 2.1 2.97% Note: Data in the same column with the same letters on their shoulders indicate no significant difference, while data with different letters on their shoulders indicate significant difference (P<0.05).

[0025] In addition to the above implementations, the present invention may also have other implementations. Any technical solution formed by equivalent replacement or equivalent transformation falls within the protection scope required by the present invention.

Claims

1. A method for detecting the GPR107 gene associated with duck egg weight, characterized in that: The method comprises the following steps: first, performing PCR amplification on a duck DNA sample to be tested using a duck DNA specific primer pair to obtain an amplified product; second, performing Sanger sequencing on the amplified product; The third step is to determine the SNP molecular marker genotype of the target site based on the sequencing results of the second step.

2. The method for detecting the GPR107 gene associated with duck egg weight according to claim 1, characterized in that: The deoxyribonucleotide sequence of the duck DNA specific primer pair in the first step consists of an upstream primer SEQ ID NO: 1 and a downstream primer SEQ ID NO: 2, and the molecular marker corresponding to the duck DNA specific primer is located at the 7909242nd base of chromosome 18 of the duck reference genome GCF_015476345.1_ZJU1.0 version, the base mutation is T or C, and the genotype is T / T, T / C and C / C.

3. The method for detecting the GPR107 gene related to duck egg weight trait according to claim 2, characterized in that: The final concentration of the PCR reaction system is calculated based on 25 μl: Duck DNA to be tested 50 ng 2 x Accurate Taq Master Mix 12.5μl Upstream primer 1 μl Downstream primer 1 μl Add sterile water to 25 μl. The reaction conditions for PCR amplification were as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 sec, annealing at 55°C for 30 sec, extension at 72°C for 60 sec, for a total of 30 cycles; extension at 72°C for 2 min; and storage at 20°C.

4. The method for detecting the GPR107 gene related to duck egg weight trait according to claim 3, characterized in that: The amplified product is 190 bp in length and contains the 7909242nd base on chromosome 18 of the duck reference genome GCF_015476345.1_ZJU1.0 version. The sequence of the amplified product is shown in SEQ ID NO: 3 or SEQ ID NO:

4.

5. The method for detecting the GPR107 gene related to duck egg weight trait according to claim 2, characterized in that: In the third step, the judgment standard is that the egg weight of ducks with T / T genotype at the SNP site is higher than that of ducks with T / C genotype and ducks with C / C genotype, and the egg weight of ducks with T / C genotype is higher than that of ducks with C / C genotype.

6. An application of a method for detecting the GPR107 gene associated with duck egg weight, characterized in that: Used to detect the egg weight traits of 43-week-old Jinding ducks.

Images