Co-separation molecular marker of rice hybrid male sterility site HMS10 and application of co-separation molecular marker

Abstract

The invention belongs to the technical field of crop genetic breeding, and particularly relates to a rice hybrid male sterility site HMS10 co-segregation molecular marker and application thereof. The method comprises the following steps: hybridizing and backcrossing an anti-thermo-sensitive type genic male sterile line Yannong S serving as a female parent with a normal fertile material Yannong HB (serving as a recurrent male parent), finely positioning to a site HMS10 for controlling hybrid male sterility of rice in a physical interval of-60kb of a chromosome 10 of the rice by utilizing a high-generation backcross large population, and developing a co-separation molecular marker IDHMS10. The molecular marker IDHMS10 is utilized, through a molecular breeding strategy, a positive temperature-sensitive male genic male sterile line Quan 211S with excellent comprehensive agronomic traits is transformed into a practical rice hybrid male sterile line Quan 211HS with fertility not affected by light and temperature, and the IDHMS10 is used for purity identification of the hybrid male sterile line, so that the molecular marker IDHMS10 has great significance in solving the seed production risk of two-line hybrid rice and improving the yield of the hybrid male sterile line. And the method has important significance in enriching practical sterile resource types and the like.

Description

Technical Field

[0001] The invention belongs to the technical field of crop genetic breeding, and in particular relates to a co-segregation molecular marker of a rice heterozygous male sterile site HMS10 and an application thereof. Background Art

[0002] The invention and promotion of two-line hybrid rice technology based on the gene resources of rice light- and temperature-sensitive male sterility (i.e., two-line sterile resources) have made significant contributions to ensuring my country's rice production and food security. However, the promotion of two-line hybrid rice also faces many difficulties, such as high risk of seed production, narrow breeding area of ​​sterile lines, and relatively single type of practical sterile resources. In recent years, the global climate has been complex and changeable, the risk of two-line hybrid rice seed production has remained high, and seed production failures have occurred frequently. The issue of seed production safety has become the main obstacle to the healthy and sustainable development of two-line hybrid rice. Therefore, in production, there is an urgent need for a new male sterile resource with a wide recovery spectrum, sterility that is not affected by the environment, and can be reproduced, so as to overcome the technical difficulties of potential seed production risks of two-line hybrid rice.

[0003] The trait of heterozygous male sterility (HMS) in rice has the significant advantages of stable fertility and relatively free pairing. The breeding and utilization of this trait is expected to solve the above-mentioned technical problems. Therefore, heterozygous male sterile lines have broad prospects for breeding applications. Ni Jinlong and others from the Rice Research Institute of Anhui Academy of Agricultural Sciences have developed a series of designed breeding technologies (ZL201911258959.4, ZL202211640849.6 and ZL202310044830.3) that can reproduce heterozygous male sterile lines for different types of materials, and created heterozygous male sterile lines 1829HS and Yannong HS, whose fertility is not affected by the environment and has relatively free pairing. Ni Jinlong and others used a gene carrying rtms10 RS The reverse thermosensitive male sterile line (derived from Yannong S) and the carrier rtms10 HB ( rtms10 RS When the alleles in 1892F were crossed with fertile materials, the F1 showed HMS. rtms10 The gene has not been cloned. Is HMS caused by rtms10 RS and rtms10 HB Direct genetic interaction also needs further verification. Therefore, it is necessary to conduct in-depth genetic analysis of HMS, precisely locate the genetic loci that control HMS, and develop related molecular markers to provide reliable technical support for molecular breeding of heterozygous male sterile lines. Summary of the invention

[0004] In view of the problems existing in the prior art, the present invention provides a rice heterozygous male sterility locus HMS10 Fine positioning and co-segregation molecular markers thereof aim to solve some of the problems in the prior art or at least alleviate some of the problems in the prior art.

[0005] In one aspect of the present invention, the present invention provides a fine mapping of a rice heterozygous male sterility locus HMS10, wherein HMS10 The locus was finely mapped within a ~60 kb physical interval on rice chromosome 10.

[0006] In one aspect of the present invention, the present invention provides a molecular marker, wherein the molecular marker is a rice heterozygous male sterility locus HMS10 The co-isolated molecular marker IDHMS10, whose forward and reverse primer sequences are shown as SEQ ID NO: 1 and SEQ ID NO: 2, respectively.

[0007] The molecular marker IDHMS10 is HMS10 RS The amplified fragment size of the reverse thermosensitive male sterile line RS resource (Yannong S or its isotype and derived reverse thermosensitive male sterile line) is 364 bp, and the sequence is shown in SEQ ID NO: 3; The molecular marker IDHMS10 is HMS10 HB The amplified fragment size of the genotype heterozygous male sterility maintenance line HB resources (including but not limited to positive temperature-sensitive male sterile lines such as 1892S, Y58S, P88S and Tsuen 211S and fertile resources such as 1892F and Nipponbare and similar materials derived therefrom) is 283 bp, and the sequence is shown in SEQ ID NO: 4; The molecular marker IDHMS10 is HMS10 R The target band cannot be amplified from the rice resources of the same genotype (including but not limited to Yuehe Si Miao, Wushan Si Miao, Lunhui 422, R608 and R498 and similar materials derived therefrom); The molecular marker IDHMS10 is HMS10 RS HMS10 HB The bands amplified from the heterozygous male sterile line of heterozygous genotype were in heterozygous state (heterozygous bands of 364 bp and 263 bp).

[0008] In one aspect of the present invention, the present invention provides a heterozygous male sterility locus HMS10 Application of its co-segregating molecular marker IDHMS10 in molecular breeding and purity identification of rice heterozygous male sterile lines.

[0009] In one embodiment, the rice heterozygous male sterility locus HMS10 The method for applying the molecular marker IDHMS10 in breeding rice heterozygous male sterile lines is as follows: HMS10 HB The genotype of positive thermosensitive male sterile line Quan 211S and the HMS10 RS Reverse thermosensitive male sterile line resources RS and carriers HMS10 R The rice resource with the R genotype was hybridized, backcrossed and selfed. Through molecular breeding methods, the materials Tsuen 211RS and Tsuen 211HB with the same genetic background as Tsuen 211S were bred respectively. Under short-day and low temperature conditions, the selected reverse temperature-sensitive male sterile line Tsuen 211RS was used as the female parent and hybridized with the heterozygous male sterile maintainer line Tsuen 211HB for seed production, and the heterozygous male sterile line Tsuen 211HS was propagated.

[0010] In one embodiment, the carrying HMS10 RS The genotype of the reverse thermosensitive male sterile line resource RS is Yannong S or its isotype line and the derived reverse thermosensitive male sterile line.

[0011] In one embodiment, the carrying HMS10 HB The genotype heterozygous male sterility maintenance line resources HB include but are not limited to positive temperature-sensitive male sterile lines such as 1892S, Y58S, P88S and Tsuen 211S, and fertile resources such as 1892F and Nipponbare and similar materials derived therefrom.

[0012] In one embodiment, the carrying HMS10 R The genotype rice resources include but are not limited to Yuehe Silk Rice, Wushan Silk Rice, Lunhui 422, R608 and R498 and similar materials derived therefrom.

[0013] In one embodiment, the present invention discloses a heterozygous male sterility locus HMS10 And the application of molecular marker IDHMS10 in the purity identification of heterozygous male sterile line HS seeds.

[0014] The present invention carries HMS10 RS The genotype of the reverse thermosensitive male sterile nuclear resource RS is Yannong S or its isotype line and the derived reverse thermosensitive male sterile nuclear line; the carrying HMS10 HB The genotype heterozygous male sterility maintenance line resources HB include but are not limited to 1892S, Y58S, P88S and Tsuen 211S positive temperature-sensitive male sterile lines and 1892F and Nipponbare, and other fertile resources and similar materials derived therefrom; the carrying HMS10 R The genotype rice resources include but are not limited to Yuehe Silk Rice, Wushan Silk Rice, Lunhui 422, R608 and R498 and similar materials derived therefrom.

[0015] The present invention finely locates the genetic loci that control HMS traits HMS10 , developed the co-segregating molecular marker IDHMS10 and applied it to the molecular breeding and purity identification of heterozygous male sterile lines, providing technical support for the safe production of hybrid rice seeds. Beneficial Effects

[0016] In summary, the advantages and positive effects of the present invention are: The present invention organically combines the molecular marker technology of modern molecular biology with various selection technologies such as hybridization, backcrossing, and test cross in traditional crop genetic breeding, providing a fast, accurate, and predictable practical method for the selection and breeding of new crop varieties and the creation of new materials. HMS10 RS The genotype of the reverse thermosensitive male sterile line resource Yannong S (YnS) and the carrier HMS10 HB The genotype of the fertile material Yannong HB (YnHB) was hybridized and backcrossed, and the locus controlling rice heterozygous male sterility was precisely located within the ~60 kb physical interval of rice chromosome 10 using extremely sterile plants in a large population of high-generation backcrosses. HMS10 , and developed a co-segregating molecular marker IDHMS10. Using the molecular marker IDHMS10, through molecular breeding strategies, the positive temperature-sensitive male sterile line Quan 211S with excellent comprehensive agronomic traits was transformed into a practical rice heterozygous male sterile line Quan 211HS whose fertility is not affected by light and temperature; at the same time, the molecular marker IDHMS10 of the present invention can also be used to identify the purity of the heterozygous male sterile line, providing technical support for the safe production of hybrid rice seeds. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 Fine mapping results of the heterozygous male sterility locus HMS10.

[0018] Figure 2 Molecular marker IDHMS10 HMS10 Amplification results of different functional haplotypes at the locus.

[0019] M: DNA marker (the bands are 100, 200, 300, 400, 500 and 600 bp from small to large); YnS( HMS10 RS genotype); YnHB ( HMS10 HB genotype); YnR ( HMS10 R genotype); YnHS ( HMS10 RS HMS10 HB genotype).

[0020] Figure 3 Amplification results of molecular marker IDHMS10 in different rice materials.

[0021] M: DNA marker (bands from small to large are 100, 200, 300, 400, 500 and 600 bp); 1892RS carries HMS10 RS Genotype: 1829S, Y58S, P88S, Tsuen 211S, 1892F and NIP (Nipponbare) materials carry HMS10 HB Genotype: 1892HS carrier HMS10 RS HMS10 HB Genotype: YHSM (Yuehe Silky Seedling), WSSM (Wushan Silky Seedling), L422, R608 and R498 materials carry HMS10 R genotype.

[0022] Figure 4 YnS Background HMS10 Fertility performance of three haploid materials and their hybrid F1 under long-day high temperature conditions (plant Bars=30 cm) and artificial climate chamber conditions of 31℃ and 23℃ (pollen Bars=50 μm).

[0023] Figure 5 Fertility performance of YnS, Quan 211S and the selected heterozygous male sterile line Quan 211HS under different temperature conditions. Bars=100 μm.

[0024] Figure 6 Application of molecular marker IDHMS10 in seed purity identification of heterozygous male sterile line Yannong HS. RS:YnS; HB: YnHB; 1-92 represent different plants of Yannong HS hybrids, among which No. 89 marked with * represents pseudohybrid (YnS self-bred). DETAILED DESCRIPTION

[0025] In order to make the purpose, technical scheme and advantages of the present invention more clear, the present invention is further described in detail below in conjunction with the embodiments. The equipment and reagents used in each embodiment and test example can be obtained from commercial sources unless otherwise specified. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0026] The invention discloses a rice heterozygous male sterility locus HMS10 The fine positioning method and application of the co-separated molecular marker IDHMS10 are specifically shown in the following embodiments. Genetic analysis of HMS traits, HMS10 Fine positioning of the locus and application of IDHMS10 marker

[0027] In order to identify the loci controlling heterozygous male sterility in rice, the reverse temperature-sensitive male sterile line YnS was used as the female parent and hybridized and backcrossed with the normal fertile material YnHB. Among the 243 plants in the BC1F1 backcross generation population, 119 plants showed a heterozygous male sterile phenotype, and 124 plants showed complete male fertility. The segregation of sterile plants and fertile plants was consistent with 1:1 ( P =0.7484>0.05), indicating that the HMS trait is controlled by a single locus. The genotypes of 119 HMS plants were analyzed by molecular markers, and a major locus controlling HMS was identified on chromosome 10 of rice, named HMS10 , located between markers ID11087 and ID1329. Using the YnS / YnHB / / YnHB / / / YnHB BC2F1 large population, HMS10 was further fine-mapped to a ~60 kb physical interval between Y13187 and Y13247 ( Figure 1 ), and developed a HMS10 The forward and reverse primer sequences of the co-isolated molecular marker IDHMS10 are shown in SEQ ID NO: 1 and SEQ ID NO: 2.

[0028] IDHMS10-F: 5'-TCCGGTCTCCAGTCTTCTAT-3' (SEQ ID NO: 1) IDHMS10-R: 5'-AGTACACTTCTCCAGCTGTTG-3' (SEQ ID NO: 2) Example 2 Molecular identification of functional haplotypes at the HMS10 locus and analysis of the inheritance pattern of HMS

[0029] The present invention uses molecular breeding to obtain L422 rtms10 L422The haplotype was introduced into the YnS background. The specific breeding process was as follows: In the spring of 2016, YnS was used as the female parent and hybridized with the fertile material Lunhui 422 (L422) in Lingshui, Hainan. The F1 was planted in Hefei in the summer of 2016. At the heading and flowering stage, the F1 was used as the male parent and backcrossed with YnS. At the end of March 2017, the carrier was selected in the YnS / / YnS / L422 BC1F1 population in Lingshui, Hainan. rtms10 L422 The fertile plants were then backcrossed with YnS. The above steps were repeated until the BC5F1 population carrying rtms10 L422 Fertile single plant seeds. Harvest the BC5F2 population carrying homozygous rtms10 L422 Fertile single plant seeds. Harvested in Lingshui, Hainan at the end of March 2021, BC5F3 generation carrying homozygous rtms10 L422 The strain whose main agronomic traits were consistent with those of YnS was named YnR.

[0030] The molecular marker IDHMS10 was used to identify YnS, YnHB, YnR and Yannong HS (YnHS). The results showed that the size of the amplified fragment of the marker IDHMS10 primer pair in YnS was 364 bp ( Figure 2 ), the sequence is shown in SEQ ID NO: 3; the size of the amplified fragment in YnHB is 283 bp ( Figure 2 ), the sequence is shown in SEQ ID NO: 4; no band was amplified in YnR; hybrid bands of 364 bp and 263 bp were amplified simultaneously in YnHS ( Figure 2 ). Further, IDHMS10 was used to amplify 1892RS, 1892S, 1892HS, Y58S, P88S, Quan 211S, 1892F, Nipponbare, Yuehe Si Miao, Wushan Si Miao, Lunhui 422, R608, R498 and other materials. The results are as follows Figure 3 As shown in the figure, the 283 bp band type can be amplified in materials such as 1892S, Y58S, P88S, Quan 211S, 1892F and Nipponbare, and the F1 hybridized with YnS or 1892RS all showed the HMS phenotype; materials such as Yuehe Si Miao, Wushan Si Miao, Lunhui 422, R608, and R498 were similar to YnR, and no band could be amplified, and the F1 hybridized with YnS or 1892RS did not show HMS. Therefore, according to the differences in the size of the amplified fragments and the presence or absence of IDHMS10 in different types of materials, the present invention amplifies the YnS or its isotype lines and the derived reverse thermosensitive male sterile lines. HMS10 Haplotypes are named HMS10 RS, YnHB and positive temperature-sensitive male sterile lines including but not limited to 1892S, Y58S, P88S and Quan 211S, fertile resources such as 1892F and Nipponbare and similar materials derived therefrom HMS10 Haplotypes are named HMS10 HB , YnR and similar materials including but not limited to Yuehe Silky, Wushan Silky, Lunhui 422, R608 and R498 and their derivatives HMS10 Haplotypes are named HMS10 R .

[0031] IDHMS10-364 SEQ ID NO: 3, 364 bp TCCGGTCTCCAGTCTTCTATGTCAAGTGTGATTCTTCCTACACATTTTGCAGTAGGAAGATGAACATCCTTGGCCACTACAATAGTTAGAAGTAGAAAAAAGGCCATATCAGAGTTGAGAGATCACTACTTTCACTACCTTCAGTATCTTCTGAATCTGGATATCTCTGAGGCTCGTCCACC ATCATATTCTTCAATATCTTCTCCTGAATCTGGATATCTCTGATGCTCGTCCACCATCATATTCCTATTTGGTTGGTTGTCCTCCCTTGTGGGAGTTGGTGCCCAGTCTTCTGCAGCAAGCAGTGTTGTATTTAGTCGATAGATAATATATGTACATATATGCAACAGCTGGAGAAGTGTACT IDHMS10-283 SEQ ID NO: 4, 283 bp TCCGGTCTCCAGTCTTCTATGTCAAGTGTGATTCTTCCTACACATTTTGCAGTAGGAAGATGAACATCCTTGGCCACTACAATAGTTAGAAGTAGAAAAAAGGCCATATCAGAGTTGAGAGATCACTACTTTCACTACCTT CAGTATCGTCCCACCATCATATTCCTATTTGGTTGGTTGTCCTCCCTTGTGGGAGTTGGTGCCCAGTCTTCTGCAGCAAGCAGTGTTGTATTTAGTCGATAGATAATATATGTACATATATGCAACAGCTGGAGAAGTGTACT In order to explore the genetic pattern of HMS, the present invention hybridized YnS, YnHB, and YnR in Lingshui, Hainan in March 2022. YnS, YnHB, YnR, and the F1 hybridized between the three were planted in Hefei in the spring of 2022. Pollen fertility was observed under long-day high temperature conditions and in an artificial climate chamber (average temperatures were 31°C and 23°C, respectively). Microscopic examination results showed that only haplotype HMS10 RS and HMS10 HB The hybrid offspring showed male sterility under high and low temperature conditions ( Figure 4 ), indicating that the HMS phenotype is HMS10 RS and HMS10 HB Caused by genetic interaction.

[0032] PCR reaction system: 100 ng DNA, 10 μl 2×PCR Mix, 1 μl of each upstream and downstream primers with a concentration of 10 mM; add ddH2O to make up to 20 μl.

[0033] PCR amplification program: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 30 sec, annealing at 56°C for 30 sec, extension at 72°C for 30 sec, 32 cycles; extension at 72°C for 5 min. Example 3 Application of molecular markers in molecular breeding of heterozygous male sterile line Quan 211HS

[0034] The present invention uses molecular marker IDHMS10 and molecular breeding strategies to transform the positive temperature-sensitive male sterile line Quan 211S into a heterozygous male sterile line Quan 211HS. The specific breeding process is as follows: In the summer of 2019, Quan 211S was used as the recurrent parent in Hefei, and the line was crossed with the line carrying TMS5TMS5HMS10 RS HMS10 RS The genotype of the reverse thermosensitive male sterile line YnS and the TMS5TMS5HMS10 R HMS10 R Normal fertile materials of genotype 422 were crossed, backcrossed and selfed. HMS10 Three functional haplotypes at the locus HMS10 RS , HMS10 HB and HMS10 R according to Figure 2 The band spectrum of the amplified product was determined. HMS10 RS The amplified fragment size of the genotype is 364 bp, carrying HMS10 HBThe amplified fragment size of the genotype is 283 bp, carrying HMS10 R The target band cannot be amplified for the genotype. HMS10 RS HMS10 HB The bands amplified from the heterozygous genotype were in the heterozygous state (364 bp and 263 bp heterozygous bands). TMS5 Genotype selection was determined according to the amplification product band spectrum in (ZL202310044830.3). In the backcross population of Quan 211S and YnS, the molecular marker IDHMS10 was used to select the carrier TMS5tms5HMS10 RS HMS10 HB The sterile plants of heterozygous genotype were further backcrossed with Tsuen 211S (performed in Lingshui, Hainan every spring). After 3-4 generations of backcrossing, the sterile male plants with Tsuen 211S background were obtained ( TMS5tms5HMS10 RS HMS10 HB In the backcross population of Quan 211S and Hui 422, the molecular marker IDHMS10 was used to select TMS5tms5HMS10 HB HMS10 R The fertile plants of the genotype were further backcrossed with Tsuen 211S (which can be carried out in Lingshui, Hainan every spring and in Hefei in summer). After 3 to 4 generations of backcrossing, male fertile plants with Tsuen 211S background were obtained ( TMS5tms5HMS10 HB HMS10 R ). The male sterile plants of the 211S background ( TMS5tms5HMS10 RS HMS10 HB ) and male fertile plants in the Tsuen 211S background ( TMS5tms5HMS10 HB HMS10 R ) were hybridized, and the molecular marker IDHMS10 was used to screen the reverse thermosensitive male sterile line Tsuen 211RS ( TMS5TMS5HMS10 RS HMS10 RS ) and the heterozygous male sterile maintenance line Quan 211HB ( TMS5TMS5HMS10 HB HMS10 HB). In the spring of 2023, the hybrid of Quan 211RS and Quan 211HB was obtained in Lingshui, Hainan, and the heterozygous male sterile line Quan 211HS was obtained. The fertility of Quan 211HS was determined by observing self-fertilization and anther morphology in Hefei in the summer of 2023 and in Lingshui, Hainan in the spring of 2024. The results showed that Quan 211HS showed male sterility under both long-day high temperature and short-day low temperature conditions (see Figure 5 ). Example 4 Application of molecular marker IDHMS10 in seed purity identification of heterozygous male sterile line Yannong HS

[0035] In the spring of 2023, Yannong S was used as the female parent and hybridized with Yannong HB in Lingshui, Hainan to breed Yannong HS. A small amount of Yannong HS seeds were randomly selected to germinate in a 30°C light incubator. After the buds were 5-7 cm long, 92 plants were randomly selected to extract DNA. The purity of Yannong HS seeds was identified using the molecular marker IDHMS10. The PCR reaction system and amplification procedure were based on Example 2. The results showed that 91 of the 92 plants were heterozygous genotypes (364 bp and 283 bp heterozygous bands), and plant No. 89 was a pseudohybrid, with the same genotype as Yannong S (see Example 2). Figure 6 ), the results showed that the molecular marker IDHMS10 can be used for rapid identification of seed purity of heterozygous male sterile lines.

[0036] The above content is a further detailed description of the present invention in combination with specific implementation methods. It cannot be determined that the specific implementation of the present invention is limited to these descriptions. For ordinary technicians in the technical field to which the present invention belongs, several simple deductions or substitutions can be made without departing from the concept of the present invention, which should be regarded as belonging to the scope of protection determined by the claims submitted for the present invention.

Claims

1. A molecular marker, characterized in that: The molecular marker is a rice heterozygous male sterility locus HMS10 The co-isolated molecular marker IDHMS10, whose forward and reverse primer sequences are shown in SEQ ID NO: 1 and SEQ ID NO: 2, respectively.

2. The molecular marker according to claim 1, characterized in that The IDHMS10 carries HMS10 RS The amplified fragment size in the RS resource of the reverse thermosensitive male sterile line of the genotype is 364 bp, and the sequence is shown in SEQ ID NO: 3; preferably, the carrying HMS10 RS The genotype of the reverse thermosensitive male sterile line RS resource is Yannong S or its isotype lines and the derived reverse thermosensitive male sterile lines.

3. The molecular marker according to claim 1, characterized in that The IDHMS10 carries HMS10 HB The amplified fragment size of the heterozygous male sterile maintenance line HB resource of the genotype is 283 bp, and the sequence is shown in SEQ ID NO: 4; preferably, the carrying HMS10 HB The genotype heterozygous male sterility maintenance line HB resources are 1892S, Y58S, P88S and Tsuen 211S positive temperature-sensitive male sterile lines and 1892F and Nipponbare fertile resources and similar materials derived from them.

4. The molecular marker according to claim 1, characterized in that The IDHMS10 carries HMS10 R The target band cannot be amplified in the rice resources of the genotype; preferably, the HMS10 R The genotype rice resources include Yuehe Silk Rice, Wushan Silk Rice, Lunhui 422, R608 and R498 and similar materials derived from them.

5. The molecular marker according to claim 1, characterized in that The IDHMS10 carries HMS10 RS HMS10 HB The bands amplified from the heterozygous male sterile line HS of the heterozygous genotype were in a heterozygous state, that is, they contained heterozygous bands of 364 bp and 263 bp.

6. Use of the molecular marker according to claim 1 in molecular breeding and purity identification of rice heterozygous male sterile lines.

7. The use according to claim 6, characterized in that: The molecular breeding is to carry HMS10 HB The positive thermosensitive male sterile line Quan 211S was compared with the HMS10 RS Reverse thermosensitive male sterile line resources RS and carrying HMS10 R The rice resource with the R genotype was hybridized, backcrossed and selfed. Through molecular breeding strategies, the materials Tsuen 211RS and Tsuen 211HB with the same genetic background as Tsuen 211S were selected respectively. Under short-day and low temperature conditions, the selected reverse temperature-sensitive male sterile line Tsuen 211RS was used as the female parent to cross-breed with the heterozygous male sterile maintainer line Tsuen 211HB for seed production, and the heterozygous male sterile line Tsuen 211HS was propagated.

8. The use according to claim 7, characterized in that: The carrying HMS10 RS The genotype of the reverse thermosensitive male sterile line resource RS is Yannong S or its isotype line and the derived reverse thermosensitive male sterile line.

9. The use according to claim 7, characterized in that: The carrying HMS10 HB The genotype heterozygous male sterility maintenance line HB resources include but are not limited to positive temperature-sensitive male sterile lines such as 1892S, Y58S, P88S and Tsuen 211S, and fertile resources such as 1892F and Nipponbare and similar materials derived therefrom.

10. The use according to claim 7, characterized in that: The carrying HMS10 R The genotype rice resources include but are not limited to Yuehe Silk Rice, Wushan Silk Rice, Lunhui 422, R608 and R498 and similar materials derived therefrom.

Images