Method for rapidly detecting four soybean seed-borne viruses on site

Abstract

The invention relates to a method for rapidly detecting four soybean seed-borne viruses on site, which combines a rapid RNA release technology and a one-step RT-PCR (Reverse Transcription-Polymerase Chain Reaction) to detect bean pod mottle virus (BPMV), tobacco ringspot virus (TRSV), southern bean mosaic virus (SBMV) and tomato ringspot virus (ToRSV) on site in real time. A soybean sample to be detected is added into the plant extraction-free nucleic acid releasing agent and shaken for 1 minute to release viral nucleic acid, and then RT-PCR amplification reaction is directly carried out. The designed specific primers and TaqMan probes are adopted, and different fluorophores (FAM, HEX, ROX and CY5) are marked, so that four viruses can be simultaneously detected in the same reaction system. According to the method, real-time PCR amplification is carried out on an iFlashdx portable detection platform, and a detection result is rapidly obtained. Compared with a traditional method, the method has the advantages that the operation process is simplified, the detection time is shortened, a complicated nucleic acid extraction step is avoided, an accurate virus detection result can be quickly obtained on site, and the method has high sensitivity and high specificity.

Description

Technical Field

[0001] The invention relates to the technical field of plant virus biological detection, and more particularly to a method for rapid on-site detection of four soybean seed-borne viruses. Background Art

[0002] Soybean is one of the most important crops in the world and my country, and occupies an important position in the world agricultural product trade. Soybean virus disease is one of the important factors affecting soybean production. Infected seeds are the main way for soybean viruses to spread over long distances, causing significant losses to soybean production. The risk of soybean seed-borne viruses being introduced into my country with imported soybeans is increasing. Therefore, it is of great significance to strengthen the rapid and accurate detection of seed-borne viruses in imported soybeans. Currently, the commonly used virus detection methods include enzyme-linked immunosorbent assay (ELISA), reverse transcription-polymerase chain reaction (RT-PCR) and semi-nested RT-PCR, and constant temperature amplification technology (Wei, 2012). These methods need to be tested in professional laboratories, and the sample processing process is complicated, and the test results cannot be obtained quickly. In addition, the cost is high and the time is long, which can no longer meet the needs of rapid customs clearance at ports. Summary of the invention

[0003] In view of this, the present invention provides a method for rapid on-site detection of four soybean seed-borne viruses. For soybean seed-borne viruses such as bean pod mottle virus (BPMV), southern bean mosaic virus (SBMV), tobacco ringspot virus (TRSV) and tomato ringspot virus (ToRSV), an on-site detection method of a multiplex RT-PCR system for four soybean viruses is established, which improves the detection efficiency and provides technical guarantee for the rapid detection of multiple soybean viruses.

[0004] To achieve the above object, the present invention provides the following technical solutions:

[0005] A method for rapid on-site detection of four soybean seed-borne viruses comprises the following steps:

[0006] S1. Sample processing: Select a sample from the soybean to be tested, add the sample to the plant non-extraction nucleic acid releaser, shake the sample upside down to ensure that the sample is fully mixed and the viral nucleic acid is released;

[0007] S2. Primer probe and RT-PCR system configuration:

[0008] Reaction system configuration:

[0009] According to the instructions of the plant extraction-free high-sensitivity detection kit, prepare 20 μL of the amplification system; it includes:

[0010] 2×RT-qPCR Mix 10μL

[0011] Sample treatment solution 1μL

[0012] Specific primer, Forward: 0.8μL, Reverse: 0.8μL

[0013] Probe 0.4μL

[0014] Sterile purified water 1 μL;

[0015] Primer and probe configuration: Specific primers and TaqMan probes for four viruses, BPMV, TRSV, SBMV, and ToRSV, were designed and labeled with different fluorescent groups;

[0016] S3.RT-PCR amplification process: Place the sample and amplification system into a portable detection platform for real-time fluorescence RT-PCR reaction, including reverse transcription and amplification processes;

[0017] S4. Analyze the amplification results and conduct positive and negative analysis on the soybean samples;

[0018] In one embodiment, in S1, the plant extraction-free nucleic acid releasing agent comprises detergent SDS 0.05%, surfactant Tween-20 0.1%, Triton X-100 0.2%, PCR stabilizer BSA 0.4%, glycerol 1%, and preservative Proclin 3000 0.005%.

[0019] In one embodiment, in S2, specific primers and probes are designed for four soybean seed-borne viruses: BPMV, TRSV, SBMV, and ToRSV;

[0020] Bean Pod Mottle Virus (BPMV)

[0021] Primers:

[0022] Forward primer (SJ-BPMV-F): TGTATGCTATGGTGCATGATAG;

[0023] Reverse primer (SJ-BPMV-R1): GAACCTGAAATACCAGGATT;

[0024] Probe:

[0025] Probe (SJ-BPMV-P): FAM-ACAATACCAGGTGATT-MGB (FAM fluorescent label);

[0026] Tobacco Ringspot Virus (TRSV)

[0027] Primers:

[0028] Forward primer (SJ-TRSV-F): GTGTGCTGTGACGGTTGTTCC;

[0029] Reverse primer (SJ-TRSV-R1): AGTTCCAAGATGCTTTCCTT;

[0030] Probe:

[0031] Probe (SJ-TRSV-P): HEX-ATCCCACTTGTTGTGG-MGB (HEX fluorescent label);

[0032] Southern bean mosaic virus (SBMV)

[0033] Primers:

[0034] Forward primer (SJ-SBMV-F): CCGTATCCGTTAACCAGTTAT;

[0035] Reverse primer (SJ-SBMV-R): TAGCACAAKCCAGAGGATCC;

[0036] Probe:

[0037] Probe (SJ-SBMV-P): ROX-CAACCTTAGAGG-MGB (ROX fluorescent label);

[0038] Tomato Ringspot Virus (ToRSV)

[0039] Primers:

[0040] Forward primer (SJ-ToRSV-F): TTGAAGCCGTTGTCAAAGGT;

[0041] Reverse primer (SJ-ToRSV-R): TTCTCCAACACCTTAGACGG;

[0042] Probe:

[0043] Probe (SJ-ToRSV-P): CY5-CTTCTGAAGGCTACC-MGB (CY5 fluorescently labeled).

[0044] In one embodiment, in S3, the reverse transcription process: incubate at 52°C for 3 minutes to perform RNA reverse transcription; the amplification process: heat at 95°C for 1 minute to activate the reaction system; then perform PCR cycles at 95°C for 5 seconds and 60°C for 15 seconds, for a total of 40 cycles, and collect fluorescence signals; select the FAM channel for fluorescence signal detection.

[0045] In one embodiment, the method further includes setting up a negative soybean control group, treating negative soybeans according to S1-S4 as a control, and taking 1 μL of the sample processing solution as a template to perform RT-PCR on the iF l ashdx Q16S portable detection platform.

[0046] It can be seen from the above technical solutions that, compared with the prior art, the present invention discloses a method for rapid on-site detection of four soybean seed-borne viruses, which has the following beneficial effects:

[0047] 1. Improve detection efficiency and sensitivity

[0048] Rapid response: This method combines rapid RNA release technology and one-step RT-PCR, greatly shortening the detection time. Traditional virus detection methods such as ELISA and RT-PCR usually require professional laboratory equipment, complex sample processing and a long time, while the on-site operation of this method can produce results in a short time (e.g., hours), meeting the needs of on-site rapid detection.

[0049] High sensitivity: The design of primers and probes is highly specific and can accurately identify the nucleic acid sequence of the target virus, reducing the occurrence of false negative or false positive results and improving the sensitivity and accuracy of detection.

[0050] 2. Portability and field detection capabilities

[0051] Portable testing platform: By using the iFlashdx Q16S portable testing platform, the testing equipment can be brought to the site for real-time PCR reactions. This allows testers to quickly obtain results on site without having to send samples to the laboratory, further improving the timeliness of testing.

[0052] On-site application: This method is very suitable for ports, soybean production bases, farms and other scenarios. It can detect viruses anytime and anywhere, greatly enhancing the prevention and control capabilities of soybean seed-borne viruses.

[0053] 3. Multiple virus detection capabilities

[0054] Multiplex PCR detection: This method uses multiplex RT-PCR technology, which can detect four viruses (BPMV, TRSV, SBMV, ToRSV) simultaneously in the same reaction system. This not only improves the efficiency of detection, but also reduces the amount of reagents and operation steps required for the reaction, reducing the cost of detection.

[0055] Different fluorescent markers: By using different fluorescent markers (such as FAM, HEX, ROX, CY5), different viruses can be distinguished in one PCR reaction, making the test results clearer and easier to interpret.

[0056] 4. Fast and accurate result analysis

[0057] Real-time fluorescence detection: During the PCR amplification process, the fluorescence signal is collected and analyzed in real time, so that the tester can quickly obtain real-time test results. Selecting the FAM channel for fluorescence signal detection can accurately distinguish the amplification of each virus and ensure the accuracy of the results.

[0058] Positive / negative testing: By setting up a negative control group (soybean samples that are not infected with the virus), it can be compared with the samples to be tested to further ensure the reliability of the test results. BRIEF DESCRIPTION OF THE DRAWINGS

[0059] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0060] Figure 1 The attached figure is a detection diagram of BPMV, TRSV, ToRSV and SBMV virus positive samples in the present invention.

[0061] Figure 2 The accompanying drawing is a negative sample detection control diagram in the present invention.

[0062] In the figure: 1-BPMV; 2-TRSV; 3-ToRSV; 4-SBMV. DETAILED DESCRIPTION

[0063] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0064] It should be noted that all directional indications in the embodiments of the present invention (such as up, down, left, right, front, back, etc.) are only used to explain the relative position relationship, movement status, etc. between the components under a certain specific posture (as shown in the accompanying drawings). If the specific posture changes, the directional indication will also change accordingly.

[0065] In the present invention, unless otherwise clearly specified and limited, the terms "connection", "fixation", etc. should be understood in a broad sense. For example, "fixation" can be a fixed connection, a detachable connection, or an integral connection; it can be a mechanical connection or an electrical connection; it can be a direct connection or an indirect connection through an intermediate medium, it can be the internal connection of two elements or the interaction relationship between two elements, unless otherwise clearly defined. For ordinary technicians in this field, the specific meanings of the above terms in the present invention can be understood according to specific circumstances.

[0066] In addition, if there are descriptions involving "first", "second", etc. in the embodiments of the present invention, the descriptions of "first", "second", etc. are only used for descriptive purposes and cannot be understood as indicating or implying their relative importance or implicitly indicating the number of technical features indicated. Therefore, the features defined as "first" and "second" may explicitly or implicitly include at least one of the features. In addition, the meaning of "and / or" appearing in the full text includes three parallel schemes. Taking "A and / or B" as an example, it includes scheme A, or scheme B, or a scheme that satisfies both A and B. In addition, the technical solutions between the various embodiments can be combined with each other, but it must be based on the ability of ordinary technicians in this field to implement. When the combination of technical solutions is contradictory or cannot be implemented, it should be deemed that such a combination of technical solutions does not exist and is not within the scope of protection required by the present invention.

[0067] Embodiment 1

[0068] Please refer to the attached Figure 1-2 , which is a method for rapid on-site detection of 4 soybean seed-borne viruses disclosed in the present invention.

[0069] Sample processing: Take 4-6 soybean samples to be tested and add them directly into the plant-free extraction nucleic acid releaser (containing detergent SDS 0.05%, surfactant Tween-20 0.1%, Triton X-100 0.2%, PCR stabilizer BSA 0.4%, glycerol 1%, preservative Proclin 3000.005%), shake upside down for 1 minute. If the sample contains positive virus particles, the nucleic acid releaser can release the nucleic acid in the virus and use it as a template for RT-PCR.

[0070] Take the synthesized primers and probes, dilute them with sterile purified water, and make the final concentration 10μmol / μL. Prepare the amplification system (20μL) according to the instructions of the plant extraction-free high-sensitivity detection kit: 2×RT-qPCR Mix 10μL, the above sample treatment solution 1μL, F 0.8μL, R 0.8μL, P 0.4μL, sterile purified water 1μL. Extraction-free nucleic acid fluorescence quantitative RT-PCR amplification program: 52℃3min, 95℃1min, 95℃5s, 60℃15s (collect fluorescence signal, select FAM channel), 40 cycles. At the same time, use purified water as a control. Mix well, centrifuge briefly, and place in Q16S fluorescence PCR instrument for amplification.

[0071] Specific primers and TaqMan probes, the probes are labeled with different fluorescent groups at 5' and quenching groups at 3'.

[0072]

[0073] The probe is a short DNA fragment labeled with a fluorescent group, which is used to monitor the amplification of the target DNA sequence in real time during the PCR reaction. The probe binds to a specific region in the target DNA sequence, and both ends of the probe are labeled with fluorescent groups (such as FAM, HEX, etc.). The probe binds to the target DNA sequence during the PCR amplification process. When the probe is cut by DNA polymerase, the fluorescent group will be released and emit a signal, so that the amplification of the target DNA can be detected in real time by the fluorescence detection equipment.

[0074] Fluorophore: Fluorophores are chemical substances that emit light when exposed to light of a specific wavelength. Common fluorescent groups include FAM, HEX, ROX, CY5, etc. Each fluorescent group has a different emission wavelength, so that different probes can be used to detect multiple target sequences at the same time (i.e., multiplex PCR detection).

[0075] Quencher: The 3' end of the probe is usually connected to a quencher, which inhibits the emission of the fluorescent group. When the probe binds to the target DNA sequence, the 3' to 5' exonuclease activity of the DNA polymerase will cut the probe, causing the fluorescent group to separate from the quencher, and the fluorescent signal is released.

[0076] Primers help initiate DNA synthesis and provide the "starting point" required for PCR amplification.

[0077] The probe monitors amplification in real time during the PCR process, increasing the specificity and sensitivity of the experiment. The fluorescent signal of the probe can increase as the target DNA increases, so the amount of target DNA can be detected and quantified in real time.

[0078] In multiplex PCR, multiple probes can be designed to detect different target sequences simultaneously by using different fluorescent markers (such as FAM, HEX, ROX, CY5, etc.). The primers and probes for each virus will target its specific gene sequence, ensuring that the detection of each virus can be accurate.

[0079] In this application, specific primers and probes for four soybean seed-borne viruses (BPMV, TRSV, SBMV, ToRSV) were designed. The primers and probes for each virus were designed based on its specific gene sequence.

[0080] 1. Bean Pod Mottle Virus (BPMV)

[0081] Primers:

[0082] Forward primer (SJ-BPMV-F): TGTATGCTATGGTGCATGATAG

[0083] Reverse primer (SJ-BPMV-R1): GAACCTGAAATACCAGGATT

[0084] Probe:

[0085] Probe (SJ-BPMV-P): FAM-ACAATACCAGGTGATT-MGB (FAM fluorescent label)

[0086] 2. Tobacco Ringspot Virus (TRSV)

[0087] Primers:

[0088] Forward primer (SJ-TRSV-F): GTGTGCTGTGACGGTTGTTCC

[0089] Reverse primer (SJ-TRSV-R1): AGTTCCAAGATGCTTTCCTT

[0090] Probe:

[0091] Probe (SJ-TRSV-P): HEX-ATCCCACTTGTTGTGG-MGB (HEX fluorescent labeling)

[0092] 3. Southern bean mosaic virus (SBMV)

[0093] Primers:

[0094] Forward primer (SJ-SBMV-F): CCGTATCCGTTAACCAGTTAT

[0095] Reverse primer (SJ-SBMV-R): TAGCACAAKCCAGAGGATCC

[0096] Probe:

[0097] Probe (SJ-SBMV-P): ROX-CAACCTTAGAGG-MGB (ROX fluorescent label)

[0098] 4. Tomato Ringspot Virus (ToRSV)

[0099] Primers:

[0100] Forward primer (SJ-ToRSV-F): TTGAAGCCGTTGTCAAAGGT

[0101] Reverse primer (SJ-ToRSV-R): TTCTCCAACACCTTAGACGG

[0102] Probe:

[0103] Probe (SJ-ToRSV-P): CY5-CTTCTGAAGGCTACC-MGB (CY5 fluorescent label)

[0104] 5. Fluorescent Labeling and Multiplex Detection

[0105] Each virus probe is labeled with a different fluorescent group (FAM, HEX, ROX, CY5, etc.). The purpose of this is to detect multiple targets (i.e., four viruses) at the same time and distinguish them through different fluorescent signals. For example, the fluorescent signals of FAM and HEX have different emission wavelengths, so even if they are in the same PCR reaction system, they can be monitored separately by selecting different detection channels.

[0106] The specific experimental data are as follows:

[0107] 1. Test samples

[0108] Positive soybean samples carrying bean pod mottle virus (BPMV), tobacco ringspot virus (TRSV), tomato ringspot virus (ToRSV), and southern bean mosaic virus (SBMV) were all provided by the laboratory of Nanjing Customs Animal, Plant and Food Inspection Center.

[0109] 2. Detection Method

[0110] Take 5 soybean samples to be tested and add them directly into the plant extraction-free nucleic acid releaser, shake them upside down for 1 minute, and treat the negative soybeans in the same way as the control. Pipette 1 μL of the above sample treatment solution and use it as a template to perform RT-PCR on the iF l ashdx Q16S portable detection platform.

[0111] 3. Test results

[0112] The designed specific primers and probes can be used to specifically amplify the virus-carrying soybean seeds ( Figure 1 ), while the negative soybean seeds and blank controls did not amplify and were negative ( Figure 2 ), indicating that the established on-site rapid detection method can effectively detect bean pod mottle virus, southern bean mosaic virus, tobacco ringspot virus, and tomato ringspot virus.

[0113] The specific embodiments of the present invention illustrate various implementations of structures and functions, but are not limited thereto. Any implementations having the same or equivalent technical effects should be included in the protection scope of the present invention.

[0114] In this specification, each embodiment is described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same or similar parts between the embodiments can be referred to each other. For the device disclosed in the embodiment, since it corresponds to the method disclosed in the embodiment, the description is relatively simple, and the relevant parts can be referred to the method part.

[0115] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A method for rapid on-site detection of four soybean seed-borne viruses, characterized in that: The steps include: S1. Sample processing: Select a sample from the soybean to be tested, add the sample to the plant non-extraction nucleic acid releaser, shake the sample upside down to ensure that the sample is fully mixed and the viral nucleic acid is released; S2. Primer probe and RT-PCR system configuration: Reaction system configuration: According to the instructions of the plant extraction-free high-sensitivity detection kit, prepare 20 μL of the amplification system; it includes: 2×RT-qPCR Mix 10μL Sample treatment solution 1μL Specific primer, Forward: 0.8μL, Reverse: 0.8μL Probe 0.4μL Sterile purified water 1 μL; Primer and probe configuration: Specific primers and TaqMan probes for four viruses, BPMV, TRSV, SBMV, and ToRSV, were designed and labeled with different fluorescent groups; S3.RT-PCR amplification process: Place the sample and amplification system into a portable detection platform for real-time fluorescence RT-PCR reaction, including reverse transcription and amplification processes; S4. Analyze the amplification results and conduct positive and negative analysis on the soybean samples.

2. The method for rapid detection of four soybean seed-borne viruses according to claim 1, characterized in that: In S1, the plant extraction-free nucleic acid release agent contains detergent SDS 0.05%, surfactant Tween-20 0.1%, Triton X-100 0.2%, PCR stabilizer BSA 0.4%, glycerol 1%, and preservative Proclin 3000 0.005%.

3. The method for rapid detection of four soybean seed-borne viruses according to claim 1, characterized in that: In S2, specific primers and probes were designed for four soybean seed-borne viruses: BPMV, TRSV, SBMV, and ToRSV; Bean Pod Mottle Virus (BPMV) Primers: Forward primer (SJ-BPMV-F): TGTATGCTATGGTGCATGATAG; Reverse primer (SJ-BPMV-R1): GAACCTGAAATACCAGGATT; Probe: Probe (SJ-BPMV-P): FAM-ACAATACCAGGTGATT-MGB (FAM fluorescent label); Tobacco Ringspot Virus (TRSV) Primers: Forward primer (SJ-TRSV-F): GTGTGCTGTGACGGTTGTTCC; Reverse primer (SJ-TRSV-R1): AGTTCCAAGATGCTTTCCTT; Probe: Probe (SJ-TRSV-P): HEX-ATCCCACTTGTTGTGG-MGB (HEX fluorescent label); Southern bean mosaic virus (SBMV) Primers: Forward primer (SJ-SBMV-F): CCGTATCCGTTAACCAGTTAT; Reverse primer (SJ-SBMV-R): TAGCACAAKCCAGAGGATCC; Probe: Probe (SJ-SBMV-P): ROX-CAACCTTAGAGG-MGB (ROX fluorescent label); Tomato Ringspot Virus (ToRSV) Primers: Forward primer (SJ-ToRSV-F): TTGAAGCCGTTGTCAAAGGT; Reverse primer (SJ-ToRSV-R): TTCTCCAACACCTTAGACGG; Probe: Probe (SJ-ToRSV-P): CY5-CTTCTGAAGGCTACC-MGB (CY5 fluorescently labeled).

4. The method for rapid detection of four soybean seed-borne viruses according to claim 1, characterized in that: In S3, reverse transcription process: incubate at 52°C for 3 minutes to perform RNA reverse transcription; amplification process: heat at 95°C for 1 minute to activate the reaction system; then perform PCR cycles at 95°C for 5 seconds and 60°C for 15 seconds, for a total of 40 cycles, and collect fluorescence signals; select 4 fluorescence channels for fluorescence signal detection.

5. The method for rapid detection of four soybean seed-borne viruses according to claim 1, characterized in that: The method also includes setting up a negative soybean control group, treating negative soybeans according to S1-S4 as a control, and aspirating 1 μL of the sample processing solution as a template to perform RT-PCR on the iFlashdx Q16S portable detection platform.

Images