ABCA4 trans-splicing molecules

Abstract

Provided herein are nucleic acid trans-splice molecules (e.g., mRNA precursor trans-splice molecules (RTM); rNA exon editing molecules). Such molecules can be used in the treatment of diseases such as ABCA4-related retinal dystrophy (e.g., Strike's disease or cone-rod dystrophy). Also described herein are methods of using the nucleic acid trans-splice molecules described herein to correct mutations in ABCA4, thereby treating conditions associated with mutations in ABCA4, and the use of the nucleic acid trans-splice molecules described herein to treat conditions associated with mutations in ABCA4 and to prepare medicaments for treating conditions associated with mutations in ABCA4.

Description

[0001] Cross Reference

[0002] This application claims the benefit of U.S. Provisional Patent Application No. 63 / 341,665 filed on May 13, 2022 and U.S. Provisional Patent Application No. 63 / 478,472 filed on January 4, 2023, which are incorporated herein by reference in their entirety.

[0003] Sequence Listing

[0004] This application contains a sequence listing, which has been submitted electronically in XML format and is hereby incorporated by reference in its entirety. This XML copy was created on May 10, 2023, is named 61313-703_601_SL.xml, and is 1,315,456 bytes in size. Technical Field

[0005] Described herein are compositions, methods, and uses directed to trans-splicing molecules for correcting mutations in ABCA4 (ATP-binding cassette subfamily A member 4). Background Art

[0006] Recessive inherited mutations in ABCA4 are responsible for progressive blindness, including Stargardt Disease and cone-rod dystrophy. ABCA4 is located in the marginal region of the optic disc membrane of the outer segment of photoreceptor cells and acts as a transporter (or "flipase") that transports N-retinyl-phosphatidylethanolamine (N-Ret-PE) from the lumen to the cytoplasmic leaflet of the optic disc membrane. ABCA4 protein defects lead to the accumulation of toxic retinoic acid compounds, ultimately leading to the death of photoreceptors and retinal pigment epithelial cells. The 6882bp coding sequence of ABCA4 is too large to be delivered intact by a single AAV vector. In addition, since hundreds of pathogenic mutations have been found throughout the gene, a single base editing approach cannot solve the problem for a large number of patients. Therefore, there is a need in the art for alternative strategies to correct mutations in the ABCA4 gene. Summary of the invention

[0007] ABCA4-related retinopathy, such as Stargardt disease, are severe rare inherited retinal diseases that affect adults and children and are caused by biallelic pathogenic mutations in the ABCA4 gene. Stargardt disease is estimated to affect 1 in 8,000 to 10,000 people worldwide and accounts for approximately 7% of retinal dystrophies. ABCA4 is identified as the gene that causes autosomal recessive Stargardt disease, however several other retinal phenotypes have also been associated with mutations in the ABCA4 gene. In fact, ABCA4-related retinopathy is collectively considered the most common cause of retinal degeneration due to Mendelian inheritance. Individuals with ABCA4-related retinopathy are usually diagnosed within the first two decades of life and, depending on the severity of the specific mutation, may have complete loss of central visual field by adulthood.

[0008] Currently, there are no approved treatments for ABCA4-related retinopathy. Therefore, there is a significant unmet medical need to develop disease-modifying therapies for adults and children affected by loss-of-function ABCA4 mutations.

[0009] Through extensive research, the present inventors have identified nucleic acid elements that impart properties to incorporated nucleic acid trans-splicing molecules that address technical challenges associated with, for example, increasing trans-splicing efficiency and the levels of trans-splicing proteins produced thereby. Thus, the inclusion of the identified elements in nucleic acid trans-splicing molecules (e.g., RNA trans-splicing molecules) provides a variety of solutions to problems associated with implementing nucleic acid trans-splicing molecules in the past, including problems associated with low trans-splicing efficiency. Thus, the present inventors have designed nucleic acid trans-splicing molecules that achieve the long-sought goal of providing options for therapeutic intervention for diseases associated with genetic mutations, such that correcting those genetic mutations at the RNA level can provide tremendous benefits to patients. Many patients suffering from diseases associated with genetic mutations have few treatment options, and therefore their needs are largely unmet. For example, patients suffering from progressive blindness associated with mutations in the ABCA4 gene represent a patient population with unmet needs.

[0010] To meet these unmet needs, a trans-splicing solution (also known as exon editing) is described herein, which includes delivering a therapeutic nucleic acid trans-splicing construct encoding an RNA exon editor designed to trans-splice into an endogenous ABCA4 mRNA precursor comprising at least one mutation, wherein trans-splicing replaces exons in the endogenous ABCA4 mRNA precursor (wherein at least one exon comprises at least one mutation) with exons encoding functional (e.g., wild-type) amino acid sequences from the therapeutic RNA exon editor, thereby correcting at least one mutation in the endogenous ABCA4 mRNA precursor. In some embodiments, the RNA exon editor can be delivered directly to a cell. The terms "nucleic acid trans-splicing molecule," "RNA exon editing molecule," "RNA exon editor," "exon editor," and "RNA trans-splicing construct" are used interchangeably herein.

[0011] In some embodiments, described herein is a nucleic acid trans-splicing molecule comprising: (a) a sequence (CDS) comprising an ABCA4 exon; (b) a linker domain comprising SEQ ID NO: 27 or a sequence having at least 90% identity to SEQ ID NO: 27; and (c) a binding domain annealing to a binding site within an endogenous ABCA4 mRNA precursor, wherein the CDS, linker domain, and binding domain are operably linked in the 5' to 3' direction. Also described herein is its use in treating retinopathy associated with ABCA4 mutations and in the preparation of a medicament for treating retinopathy associated with ABCA4 mutations, as well as methods of treating retinopathy associated with ABCA4 mutations.

[0012] In some embodiments, described herein is a nucleic acid trans-splicing molecule comprising: (a) a CDS comprising, consisting essentially of, or consisting of a variant of any one of SEQ ID NOs: 53-55, wherein the variant of any one of SEQ ID NOs: 53-55 comprises at least one nucleotide variation in at least one cryptic splice site listed in Table 3, wherein the at least one nucleotide variation reduces usage of the cryptic splice site at each of the at least one cryptic splice site comprising the at least one nucleotide variation; and (b) optionally, a linker domain; and (c) optionally, a binding domain that anneals to a binding site within an endogenous ABCA4 mRNA precursor, wherein the CDS; the linker domain, when present; and the binding domain, when present; are operably linked in the 5′ to 3′ direction. In some embodiments, the variant of SEQ ID NO: 55 comprises any one of SEQ ID NOs: 56-59. In some embodiments, the variant of SEQ ID NO: 55 comprises SEQ ID NO: 56. Also described herein are uses thereof for treating retinopathy associated with ABCA4 mutations and uses thereof for preparing medicaments for treating retinopathy associated with ABCA4 mutations, as well as methods for treating retinopathy associated with ABCA4 mutations.

[0013] In one aspect, the present invention provides a nucleic acid trans-splicing molecule (or a vector containing or encoding a nucleic acid trans-splicing molecule), wherein the nucleic acid trans-splicing molecule contains the following operably linked in the 5' to 3' direction: (a) a 5' regulatory domain, the 5' regulatory domain comprising, for example, a native 5' ABCA4 untranslated region; (b) a CDS comprising a functional sequence of a 5' ABCA4 exon; (c) a splicing domain, the splicing domain being configured to mediate trans-splicing; and (d) a binding domain, the binding domain being configured to bind to a binding site within an endogenous ABCA4 mRNA precursor, wherein the nucleic acid trans-splicing molecule is configured to trans-splice the CDS to endogenous ABCA4, thereby replacing the endogenous 5' ABCA4 exon sequence with the functional sequence of the 5' ABCA4 exon. In some embodiments, the 5' regulatory domain also includes a constitutive promoter, such as a CMV / CMV promoter (CMV enhancer and promoter) or a variant thereof. In some embodiments, the native 5′ ABCA4 untranslated region comprises a nucleic acid sequence having at least 80% sequence identity to SEQ ID NO: 12 or 13 (e.g., at least 85% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to SEQ ID NO: 12 or 13). In some embodiments, the 5′ regulatory domain comprises a nucleic acid sequence having at least 80% sequence identity to SEQ ID NO: 14 or 15 (e.g., at least 85% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to SEQ ID NO: 14 or 15).

[0014] In some embodiments, the binding site is within ABCA4 intron 22. In some embodiments, the binding site comprises any one or more of nucleotides 1 to 510 or 880 to 1,350 of SEQ ID NO: 16 (e.g., any six or more, any eight or more, any 10 or more, any 12 or more, any 18 or more, any 20 or more, any 24 or more, any 50 or more, any 100 or more, or any 150 or more (e.g., 150) of nucleotides 1 to 510 or 880 to 1,350 of SEQ ID NO: 16). In some embodiments, the binding site comprises any one or more of nucleotides 1160 to 1309 of SEQ ID NO: 16 (e.g., any six or more, any eight or more, any 10 or more, any 12 or more, any 18 or more, any 20 or more, any 24 or more, any 50 or more, any 100 or more, or any 150 or more (e.g., 150) of nucleotides 1160 to 1309 of SEQ ID NO: 16). In some embodiments, the binding domain that binds to the binding site has at least 80% sequence identity to the binding site within SEQ ID NO: 16 (e.g., at least 85% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to the binding site within SEQ ID NO: 16. In some embodiments, the binding domain comprises SEQ ID NO: 17 or 18.

[0015] In some embodiments, the splicing domain comprises GTAAGT, GUAAGT, GTAAGG, GUAAGG, GTAAGC, GUAAGC, GTAACT, or GUAACU.

[0016] In some embodiments, the nucleic acid trans-splicing molecule further comprises a linker domain. In some embodiments, the linker domain is more than 25 nucleotides in length (e.g., between 25 and 50 nucleotides in length, between 35 and 45 nucleotides in length, or about 40 nucleotides in length (e.g., a 40-mer linker). In some cases, the linker domain is or comprises a nucleic acid sequence having at least 80% identity (e.g., at least 85% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity) with CTGGTGCCCGCGGGCCGCGGAACCGGTTGGGGGCATGTAC (SEQ ID NO: 27). In other cases, the linker domain is or comprises a nucleic acid sequence that is at least 80% identical (e.g., at least 85% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity) to CCGAATACGACACGTACAAGATCT (SEQID NO: 29). In other cases, the linker domain is or comprises a nucleic acid sequence that is at least 80% identical (e.g., at least 85% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity) to GCTGCTGCTCAGTCTCCTGGGCTGG (SEQ ID NO: 31).

[0017] In another aspect, a nucleic acid trans-splicing molecule is provided, comprising in the 5′ to 3′ direction operably linked: (a) a CDS comprising a functional sequence of a 5′ ABCA4 exon; (b) a splicing domain configured to mediate trans-splicing, wherein the splicing domain comprises GTAAGT, GUAAGT, GTAAGG, GUAAGG, GTAAGC, GUAAGC, GTAACT, or GUAACU; and (c) a binding domain configured to bind to a binding site within endogenous ABCA4 intron 22, wherein the nucleic acid trans-splicing molecule is configured to trans-splice the CDS to endogenous ABCA4 exon 23, thereby replacing the endogenous 5′ ABCA4 exon sequence with the functional sequence of the 5′ ABCA4 exon. In some embodiments, the nucleic acid trans-splicing molecule comprises a 5′ regulatory domain operably linked to the CDS at 5′. In some embodiments, the 5' regulatory domain comprises a native 5' ABCA4 untranslated region, such as a native 5' ABCA4 untranslated region having at least 80% sequence identity to SEQ ID NO: 12 or 13 (e.g., at least 85% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to SEQ ID NO: 12 or 13). In some embodiments, the 5' regulatory domain further comprises a constitutive promoter, such as a CMV promoter.

[0018] In some embodiments, the nucleic acid trans-splicing molecule further comprises a linker domain. In some embodiments, the linker domain is more than 25 nucleotides in length (e.g., between 25 and 50 nucleotides in length, between 35 and 45 nucleotides in length, or about 40 nucleotides in length (e.g., a 40-mer linker). In some cases, the linker domain is or comprises a nucleic acid sequence having at least 80% identity (e.g., at least 85% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity) with CTGGTGCCCGCGGGCCGCGGAACCGGTTGGGGGCATGTAC (SEQ ID NO: 27). In other cases, the linker domain is or comprises a nucleic acid sequence that is at least 80% identical (e.g., at least 85% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity) to CCGAATACGACACGTACAAGATCT (SEQID NO: 29). In other cases, the linker domain is or comprises a nucleic acid sequence that is at least 80% identical (e.g., at least 85% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity) to GCTGCTGCTCAGTCTCCTGGGCTGG (SEQ ID NO: 31).

[0019] In some embodiments, the binding site comprises any one or more of nucleotides 1 to 510 or 880 to 1,350 of SEQ ID NO: 16 (e.g., any six or more, any eight or more, any 10 or more, any 12 or more, any 18 or more, any 20 or more, any 24 or more, any 50 or more, any 100 or more, or any 150 or more (e.g., 150) of nucleotides 1 to 510 or 880 to 1,350 of SEQ ID NO: 16). In some embodiments, the binding site comprises any one or more of nucleotides 1160 to 1309 of SEQ ID NO: 16 (e.g., any six or more, any eight or more, any 10 or more, any 12 or more, any 18 or more, any 20 or more, any 24 or more, any 50 or more, any 100 or more, or any 150 or more (e.g., 150) of nucleotides 1160 to 1309 of SEQ ID NO: 16). In some embodiments, the binding domain that binds to the binding site has at least 80% sequence identity to SEQ ID NO: 17 or 18 (e.g., at least 85% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to SEQ ID NO: 17 or 18). In some embodiments, the binding domain comprises SEQ ID NO: 17 or 18.

[0020] In another aspect, a nucleic acid trans-splicing molecule is provided, comprising in the 5′ to 3′ direction operably linked: (a) a CDS comprising a functional sequence of a 5′ ABCA4 exon; (b) a splicing domain configured to mediate trans-splicing; (c) a linker domain between 25 and 50 nucleotides in length; and (d) a binding domain configured to bind to a binding site within endogenous ABCA4 intron 22, wherein the nucleic acid trans-splicing molecule is configured to trans-splice the CDS to endogenous ABCA4 exon 23, thereby replacing the endogenous 5′ ABCA4 exon sequence with the functional sequence of the 5′ ABCA4 exon. In some embodiments, the linker domain is between 35 and 45 nucleotides in length or is about 40 nucleotides in length (e.g., a 40-mer linker). In some cases, the linker domain is or comprises a nucleic acid sequence that is at least 80% identical (e.g., at least 85% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity) to CTGG TGCCCGCGGGCCGCGGAACCGGTTGGGGGCATGTAC (SEQ ID NO: 27). In other cases, the linker domain is or comprises a nucleic acid sequence that is at least 80% identical (e.g., at least 85% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity) to CCGAATACGACACGTACAAGATCT (SEQ ID NO: 29). In other cases, the linker domain is or comprises a nucleic acid sequence that is at least 80% identical (e.g., at least 85% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity) to GCTGCTGCTCAGTCTCCTGGGCTGG (SEQ ID NO: 31).

[0021] In some embodiments, the nucleic acid trans-splicing molecule comprises a 5′ regulatory domain operably linked to the CDS at 5′. In some embodiments, the 5′ regulatory domain comprises a native 5′ ABCA4 untranslated region, such as a native 5′ ABCA4 untranslated region having at least 80% sequence identity to SEQ ID NO: 12 or 13 (e.g., at least 85% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to SEQ ID NO: 12 or 13). In some embodiments, the 5′ regulatory domain further comprises a constitutive promoter, such as a CMV / CMV promoter.

[0022] In some embodiments, the splicing domain comprises GTAAGT, GUAAGT, GTAAGG, GUAAGG, GTAAGC, GUAAGC, GTAACT, or GUAACU.

[0023] In some embodiments, the binding site comprises any one or more of nucleotides 1 to 510 or 880 to 1,350 of SEQ ID NO: 16 (e.g., any six or more, any eight or more, any 10 or more, any 12 or more, any 18 or more, any 20 or more, any 24 or more, any 50 or more, any 100 or more, or any 150 or more (e.g., 150) of nucleotides 1 to 510 or 880 to 1,350 of SEQ ID NO: 16). In some embodiments, the binding site comprises any one or more of nucleotides 1160 to 1309 of SEQ ID NO: 16 (e.g., any six or more, any eight or more, any 10 or more, any 12 or more, any 18 or more, any 20 or more, any 24 or more, any 50 or more, any 100 or more, or any 150 or more (e.g., 150) of nucleotides 1160 to 1309 of SEQ ID NO: 16). In some embodiments, the binding domain that binds to the binding site has at least 80% sequence identity to SEQ ID NO: 17 or 18 (e.g., at least 85% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to SEQ ID NO: 17 or 18). In some embodiments, the binding domain comprises SEQ ID NO: 17 or 18.

[0024] In some embodiments of any of the foregoing aspects, the nucleic acid trans-splicing molecule comprises a 3' transcription terminator domain. In some embodiments, the 3' transcription terminator domain forms a triple helical structure that effectively blocks the 3' end of the trans-splicing molecule. In some embodiments, the 3' transcription terminator domain comprises a wild-type MALAT1 sequence. In some embodiments, the 3' transcription terminator domain comprises a nucleic acid sequence having at least 80% sequence identity with SEQ ID NO: 32 or 33 (e.g., at least 85% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity or 100% sequence identity).

[0025] In some embodiments of any of the foregoing aspects, the CDS comprises ABCA4 exons 1-22 or a variant thereof (eg, a codon-optimized variant thereof).

[0026] In some embodiments of any of the foregoing aspects, the nucleic acid trans-splicing molecule comprises a nucleic acid sequence having at least 80% sequence identity to any one of SEQ ID NOs: 40-50 (e.g., at least 85% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to any one of SEQ ID NOs: 40-50).

[0027] In some embodiments of any of the foregoing aspects, the endogenous ABCA4 mRNA precursor has at least one mutation associated with an ABCA4-related retinal dystrophy (e.g., a recessively inherited ABCA4-related retinal dystrophy, such as Stargardt's disease or cone-rod dystrophy). In some embodiments, the mutation is expressed in photoreceptor cells and / or retinal pigment epithelial cells.

[0028] In another aspect, a nucleic acid trans-splicing molecule is described, comprising in the 5′ to 3′ direction operably linked: (a) a CDS comprising a functional sequence of a 5′ ABCA4 exon; (b) a splicing domain configured to mediate trans-splicing; and (c) a binding domain that binds to SEQ ID Any of NOs: 17-24 has at least 80% sequence identity (e.g., at least 85% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity or 100% sequence identity), wherein the nucleic acid trans-splicing molecule is configured to trans-splice the CDS to endogenous ABCA4 exon 23, thereby replacing the endogenous 5′ ABCA4 exon sequence with the functional sequence of the 5′ ABCA4 exon.

[0029] In another aspect, provided herein is an isolated DNA molecule comprising SEQ ID NO: 18 or a vector thereof.

[0030] In another aspect, provided herein is an isolated RNA molecule comprising SEQ ID NO: 17 or a vector thereof.

[0031] In another aspect, provided herein is an isolated nucleic acid (eg, DNA or RNA) encoding the nucleic acid trans-splicing molecule of any preceding embodiment or any preceding aspect, such as a vector encoding the nucleic acid trans-splicing molecule of any preceding embodiment or any preceding aspect.

[0032] In another aspect, provided herein is a proviral plasmid comprising the nucleic acid trans-splicing molecule of any preceding embodiment or any preceding aspect.

[0033] On the other hand, an adeno-associated virus (AAV) is provided herein, comprising a sequence encoding a nucleic acid trans-splicing molecule of any of the foregoing embodiments or any of the foregoing aspects. In some embodiments, AAV preferentially targets photoreceptor cells and / or retinal pigment epithelial cells. In some embodiments, AAV is AAV8, AAV5 or AAV2.

[0034] In another aspect, provided herein is a composition comprising the nucleic acid trans-splicing molecule, vector, proviral plasmid or AAV of any preceding embodiment or any preceding aspect. In some embodiments, the composition includes a pharmaceutically acceptable excipient.

[0035] In another aspect, provided herein is a method of expressing functional ABCA4 in a target cell (e.g., in vitro or in vivo). In some embodiments, the method comprises transducing the target cell with a nucleic acid trans-splicing molecule, vector, AAV or composition of any of the preceding aspects. In some embodiments, the method replaces 20% or more of the target ABCA4 mRNA in the target cell (e.g., in cultured human cells, for example, as measured by trans-spliced ​​ABCA4 RNA or the corresponding protein produced by translation of the trans-spliced ​​RNA). In some embodiments, the method replaces 38% or more of the target ABCA4 mRNA in the target cell (e.g., in cultured human cells, for example, as measured by trans-spliced ​​ABCA4 RNA or the corresponding protein produced by translation of the trans-spliced ​​RNA). In some embodiments, the functional ABCA4 (the corresponding protein produced by translation of the trans-spliced ​​RNA) is a full-length ABCA4 protein.

[0036] In another aspect, provided herein is a method of reducing ABCA4 retinopathy-associated lipofuscin and / or A2E accumulation in a subject (e.g., a mammal, e.g., a primate, e.g., a human). In some embodiments, the method comprises transducing a target retinal cell in the subject with a nucleic acid trans-splicing molecule, vector, AAV, or composition of any of the foregoing embodiments or any of the foregoing aspects. In some embodiments, the subject is a non-human primate or a human (e.g., a human who has been diagnosed with ABCA4-associated retinal dystrophy). In some embodiments, the nucleic acid trans-splicing molecule, vector, or AAV is administered to the subject by ocular administration (e.g., by subretinal administration).

[0037] In another aspect, provided herein is a method of correcting at least one mutation in a 5′ ABCA4 exon sequence in a target cell of a subject (e.g., a mammal, e.g., a primate, e.g., a human). In some embodiments, the method comprises administering to the subject a nucleic acid trans-splicing molecule, vector, composition, or AAV of any of the foregoing embodiments or any of the foregoing aspects. In some embodiments, the subject is a non-human primate or a human (e.g., a human who has been diagnosed with ABCA4-related retinal dystrophy). In some embodiments, the nucleic acid trans-splicing molecule, vector, or AAV is administered to the subject by ocular administration (e.g., by subretinal administration).

[0038] In another aspect, provided herein is a method of treating ABCA4-associated retinal dystrophy in a subject (e.g., a mammal, e.g., a primate, e.g., a human). In some embodiments, the method comprises administering to the subject a therapeutically effective amount of a nucleic acid trans-splicing molecule, vector, AAV, or composition of any preceding embodiment or any preceding aspect. In some embodiments, the ABCA4-associated retinal dystrophy is associated with a mutation in a 5′ ABCA4 exon sequence (e.g., a mutation in any one or more of ABCA4 exons 1-22). In some embodiments, the ABCA4-associated retinal dystrophy is Stargardt's disease or cone-rod dystrophy. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 is a graph showing the trans-splicing efficiency of ABCA4 trans-splicing molecules with various arrangements of splicing domains (SS), linkers, and binding domains (BD).

[0040] Figure 2 is a graph showing the trans-splicing efficiency of ABCA4 trans-splicing molecules having various splicing domain sequences.

[0041] Figure 3A and 3BThe trans-splicing efficiency of various ABCA4 trans-splicing molecules transduced by AAV in cultured human cells is shown. Figure 3A Results of RT-qPCR are shown. Figure 3B and 3C The results of Western blotting are shown. Figure 3D It is quantitative Figure 3C Result graph.

[0042] Figure 4 Western blots of AAV8 trans-splicing molecular preparations are shown, showing VP1, VP2, and VP3 bands.

[0043] Figures 5A-5C Shown is the expression of GFP protein in African green monkey (AGM) nonhuman primates (NHP) following subretinal injection of a GFP trans-splicing molecule. Figure 5A is a real-time image showing the GFP protein. Figure 5B are photomicrographs showing anti-GFP immunohistochemistry (IHC) staining of retinal sections in day 28 negative control (photoreceptors and choroid are labeled). Figure 5C is a micrograph showing anti-GFP IHC staining of retinal sections (photoreceptors and choroid are labeled) from animals treated with GFP trans-splicing molecules on day 28.

[0044] Figure 6 is a set of cSLO, OCT images after subretinal injection at baseline, day 14, and day 28. Blisters are marked on the “after injection” panel.

[0045] Figure 7 is a set of color fundus images (anterior view, posterior view, superior view, and inferior view) of NHP eyes treated with vehicle, exon editor 443, and exon editor 274 on day 28.

[0046] Fig. 8A Schematic diagram showing the RT-qPCR assay for trans-splicing molecules. A 5′-tagged trans-splicing molecule (exon editor RNA) is trans-spliced ​​into the AGM mRNA precursor, and the edited (eg, trans-spliced) full-length mRNA is quantified by its resulting unique sequence. Figure 8B Quantitative RT-qPCR results are shown for exon editors 443, 274, 497, and 505. As shown, each of exon editors 443, 274, 497, and 505 trans-spliced ​​with endogenous AGM mRNA precursor in AGM retina in vivo at a statistically significant frequency as determined by quantifying the number of edited copies per 10 ng of RNA.

[0047] Fig. 9is a Western blot showing full-length chimeric (human / AGM) ABCA4 protein produced by trans-splicing of exon editors 443, 274, 497, and 505 into the AGM mRNA precursor in AGM retina. Protein tag was detected in membrane extracts of the retina.

[0048] Fig. 10A and 10B are mass spectrometry results showing the detection of unique peptides for human and AGMABCA4 proteins. Fig. 10A Results for negative control (vehicle treated) retinal tissue are shown. The top row shows control samples lacking a spike where the human protein spike should appear; the second row shows control samples to which a standard has been added to show where the human protein spike should appear; the third row shows control samples containing a spike representing the AGM protein; and the bottom row shows samples to which a standard has been added, which contain an AGM protein spike. Fig. 10B Results from retinal tissue treated with an exon editor are shown, showing detection of both human and AGM peptides. The top row shows a control sample, which exhibits a human peptide spike, reflecting the presence of human / AGM chimeric protein (with Fig. 10A The second row shows control samples with added standards; the third row shows control samples containing a spike representing AGM protein; and the bottom row shows samples with added standards, which contain a spike in AGM protein.

[0049] Figures 11A-11F is a bar graph showing the ocular health of AGMs after treatment with subretinal administered AAV8 exon editors or vehicle. Data are shown as mean ± SD for vehicle and exon editors 443, 274, 497, and 505. Fig.11A Retinal thickness at baseline, day 14, and day 28 is shown. Fig. 11B Intraocular pressure measured by tonometer at baseline, day 7, day 14, day 21, and day 28 are shown. Figures 11C-11F Results for ocular inflammation markers are shown. Fig. 11C Total clinical scores at baseline, day 7, day 14, day 21, and day 28 are shown; Fig.11D Vitreous cell scores at baseline, day 7, day 14, day 21, and day 28 are shown; Fig.11E Aqueous humor cell scores at baseline, day 7, day 14, day 21, and day 28 are shown; and Fig.11F Inflammatory corneal granules at baseline, day 7, day 14, day 21, and day 28 are shown.

[0050] Fig. 12A and 12BShown are results for general health indicators of AGMs following treatment with subretinal administered AAV8 exon editor or vehicle. Fig. 12A Body weight measurements at baseline, day 7, day 14, day 21, and day 28 are shown. Fig. 12B Baseline and day 28 heart rate (beats per minute (bpm)) are shown.

[0051] Fig.13Elements of an exemplary RNA exon editor are depicted, which is designed to trans-splice exons 1-22 of the human ABCA4 gene of the exon editor to exons 23-50 of the endogenous ABCA4 pre-mRNA transcript. The exemplary exon editor is designed to treat subjects carrying mutations spanning ABCA4 exons 1-22. The numerical labels are as follows: 1: AAV2-based inverted terminal repeats (ITRs) for AAV packaging of ABCA4 RNA exon editors; 2: Cytomegalovirus (CMV) promoter (CMV immediate early enhancer and CMV immediate early promoter) drives expression of ABCA4 RNA exon editors in photoreceptor cells; 3: The native 5′ untranslated region (UTR) from human ABCA4 mRNA maintains native 5′ regulation; 4: ABCA4 exons 1-21, which contain synonymous codon changes, replace the corresponding endogenous coding sequence by trans-splicing. Synonymous codon changes can be used, for example, to remove cryptic splice acceptor sites to reduce potential alternative splicing reactions; 5: ABCA4 exon 22, which contains synonymous codon changes that enable sequence-based quantification; 6: The splice donor (also referred to herein as the splice domain) is trans-spliced ​​into the endogenous ABCA4 intron 22 splice acceptor site, causing the upstream sequence of the endogenous ABCA4 mRNA precursor to be replaced by the ABCA4 RNA exon editor coding domain sequence (CDS) including exon 22; 7: The stop codon (double stop) reduces / prevents the translation of amino acids downstream of exon 22 (e.g., linker, 3×U1, ARE, BD domain region) from the ABCA4 exon editor; 8: The linker provides structural flexibility and accessibility for the splice domain site; 9: Three tandem U1 binding sites (3×U1), which are predicted to associate with the U1 snRNP and are shown herein to enhance ABCA4 RNA exon editor-mediated activity; 10: AU-rich elements (AREs), which are shown herein to reduce the stability of any unspliced ​​ABCA4 RNA exon editors that enter the cytoplasm; 11: Binding domains (BDs) mediate targeting of ABCA4 RNA exon editors to endogenous ABCA4 mRNA precursor intron 22 through sequence complementarity; 12: MALAT1 terminator promotes efficient trans-splicing; 13: AAV2-based ITRs for AAV packaging of exon editor cassettes. An exemplary sequence corresponding to the depicted exemplary RNA exon editor is presented in SEQ D NO: 90 (ABCA4-01). SEQ ID NO: 90 corresponds to nucleotides 4284-9073 of SEQ ID NO: 82.SEQ ID NO:90 includes SEQ ID NO:78 (spanning from the 5'UTR to the end of the MALAT1-Masc RNA containing anti-mut1) and SEQ ID NO:69 (spanning from the ATG within the 5'UTR to the end of the MALAT1-Masc RNA containing anti-mut1). SEQ ID NO:82 encodes SEQ ID NO:90.

[0052] Fig.14A and 14B RNA trans-splicing and cis-splicing reactions are depicted. (A) shows a schematic diagram of RNA trans-splicing reactions, in which the general mechanism of exon editing by trans-splicing is presented for the ABCA4 RNA exon editor. An exemplary ABCA4 exon editor RNA is depicted above the targeted ABCA4 mRNA precursor. The binding domain (BD) complementary to intron 22 associates the exon editor with the mRNA precursor and causes the spliceosome-mediated trans-splicing reaction to occur between the splicing donor (SD) site (or splicing domain) of the exon editor and the native intron 22 splicing acceptor (SA) site, thereby replacing the upstream region of the targeted mRNA precursor with the coding sequence (CDS) provided by the exon editor. The mRNA precursor molecule gradually undergoes a common cis-splicing process, removing any residual downstream introns and producing mature mRNA, which can then be translated to form a functional (biologically active) ABCA4 protein. The red “x” mutations in the endogenous pre-mRNA diagram depict representative individual allele mutations present in the ABCA4 gene on a single pre-mRNA transcript. The SD and SA sites are indicated by red arrows. The exon-exon junction formed by trans-splicing is circled in red. (B) Depiction of RNA cis-splicing and trans-splicing mechanisms. Both RNA cis-splicing and trans-splicing rely on endogenous spliceosome-mediated splicing and begin with the formation of a covalent bond between the branch point (BP) located upstream of the polypyrimidine tract (Py) and the first nucleotide of the SD site. A lariat is formed during cis-splicing, while a Y-branch is formed during trans-splicing. Next, the spliceosome mediates the joining of the upstream exon to the downstream exon, while the lariat and Y-branch molecules are rapidly degraded.

[0053] Fig.15A schematic diagram of RT-qPCR analysis of individual RNA exon editor activity is presented. After RNA is extracted from cells or tissues treated with RNA exon editors, the RNA is reverse transcribed and subjected to qPCR or ddPCR. In the schematic diagram, the purple forward primer (labeled 1) and the green reverse primer (labeled 2) are used to measure RNA exon editor RNA copy number. The blue forward (labeled 3) and reverse (labeled 4) primer pairs can be used to specifically quantify native ABCA4 RNA. Due to a synonymous codon change in the terminal exon 22 of the ABCA4 RNA exon editor, the blue forward primer (labeled 3) has low complementarity to this position and is replaced by the purple forward primer (labeled 1) in order to quantify the exon-edited ONT RNA product. The purple forward (labeled 1) and reverse (labeled 5) primer pairs are used to quantify RNA exon editors, ONT, and OFT RNA molecules together.

[0054] Fig.16 Screening and identification of exemplary ABCA4 exon editors are depicted. BD117 was identified as an exemplary position in intron 22 of the ABCA4 gene that guides exon editors using an NGS library-based approach (top) and a single exon editor bioluminescence-based approach (bottom).

[0055] Fig.17A and 17B The 40-mer adaptor is shown to significantly outperform the LinkD adaptor. (A) A histogram depicting the percentage of ABCA4 RNA replacement for each of the constructs shown or an untransfected negative control is presented. Exon editors containing the 40-mer adaptor exhibited a statistically significant increase in the percentage of ABCA4 RNA replacement compared to exon editors containing the precursor adaptor (LinkD). (B) Western blots are depicted showing that the 40-mer adaptor promotes higher trans-splicing activity relative to the LinkD adaptor, as reflected by significantly higher levels of protein translated from on-target (ONT) trans-spliced ​​RNA. In transfection experiments using HEK293T 17+06 cells engineered to overexpress mutant ABCA4 mRNA, exon editors containing the 40-mer adaptor had significantly higher levels of trans-spliced ​​ABCA4 protein (ONT) and significantly lower levels of non-spliced ​​protein (NSP) compared to exon editors containing the LinkD adaptor. Western blots were probed with an anti-ABCA4 antibody specific for the C-terminus of ABCA4 (upper panel), an anti-V5 epitope tag antibody specific for the V5 epitope tag incorporated into the N-terminus of trans-spliced ​​proteins and NSPs (middle panel), and an antibody specific for sodium / potassium ATPase (Na+ / K+ ATPase) as a protein loading control.

[0056] Fig.18 Cartoons show full-length protein and NSP. The C-terminal Ab only immunoprecipitated full-length ABCA4 protein.

[0057] Fig.19A and 19B The activity of each of the RTM elements shown, alone and in combination, in the context of an exemplary ABCA4 5′RTM is shown. (A) A histogram is presented depicting the percentage of ABCA4 RNA replacement for each of the constructs shown. The percentage replacement for each construct ranged from approximately 20-30%. Interestingly, the combination of 40mer + 3x repeated U1 binding site (3×UBS) showed a trend of increased percentage replacement of ABCA4 RNA relative to the 40mer alone. (B) Western blots are depicted showing that the constructs shown, 40mer, 40mer + 3×UBS, 40mer + AU-rich element (ARE), and 40mer + 3×UBS + ARE, express trans-spliced ​​ABCA4 protein (ONT), and that these RTM elements combined together show a trend of increased ONT levels relative to the 40mer alone. Western blots also showed that each combination of 40mer + 3×UBS, 40mer + ARE, and 40mer + 3×UBS + ARE exhibited a combined effect on the reduction of non-splicing proteins (NSPs) relative to 40mer alone. The combined effect of 40mer + 3×UBS + ARE on the reduction of NSPs was particularly pronounced relative to 40mer alone. In the context of minimal NSPs (containing a stop codon, immediately following the slicing donor sequence in the exon editor), the combination of two independent strategies to reduce NSP levels - including 3×UBS and AU-rich elements - showed a synergistic effect on reducing NSP levels. Compared to 40mers alone, this combination reduced NSP levels by approximately 70%, to the level seen in exon editors without termination. Exemplary constructs include SEQ ID NO: 84 (40-mer lane); SEQ ID NO: 85 (40-mer + 3XUBS lane); SEQ ID NO: 86 (40-mer + ARE); SEQ ID NO: 87 (40-mer + 3XUBS + ARE).

[0058] Fig. 20A and 20BIt is shown that the MALAT1 terminator (triple helix + mascRNA) significantly improves ONT trans-splicing in the exemplary ABCA4 5' exon editor, and the anti-mut1 MALAT1 terminator exhibits similar activity to the MALAT1 terminator in terms of ONT protein and NSP expression. (A) A histogram is presented depicting the relative trans-splicing conferred by the MALAT1 terminator compared to the precursor terminator in the context of the exemplary ABCA4 5' exon editor. The MALAT1 terminator increased trans-splicing by 23-fold relative to the precursor terminator. (B) Western blots are depicted showing that for three different ABCA4 5' exon editors, MALAT1 and anti-mut1 MALAT1 exhibit similar activity in terms of expression levels of trans-spliced ​​ABCA4 protein (ONT) and non-splicing protein (NSP). The ABCA4 protein was expressed using an anti-ABCA4 antibody specific for the N-terminus of ABCA4 (upper panel), an anti-ABCA4 antibody specific for the C-terminus of ABCA4 (middle panel), and an anti-Na / K ATPase (Na + / K + Western blots were probed with antibodies specific for ATPase.

[0059] Fig.21A and 21B Shown is the dose response of an exemplary AAV2-ABCA4 RNA exon editor construct transduced into HEK293T 17+06 cells engineered to overexpress mutant ABCA4 mRNA, where the ABCA4 RNA exon editor is depicted in FIG. Fig.13 Figure 7: AAV2-ABCA4 exon editor (spanning from 5′UTR to the end of the anti-mut1 MALAT1 terminator; SEQ ID NO: 78) and containing a 40-mer linker + 3XUBS + ARE cassette (SEQ ID NO: 73). AAV2-ABCA4 exon editor was transduced into HEK293T17+06 cells in biological replicates at a range of multiplicity of infection (MOI): 0, 1k, 10k (1e4), 100k (1e5), 1M (1e6) and then (A) subjected to RNA extraction for ddRT-PCR RNA replacement %, or (B) subjected to membrane protein extraction and Western blotting probed with ABCA4-specific antibody. Western blots probed with anti-ABCA4 antibody specific for the N-terminus of ABCA4 (upper panel) showed that ONT protein and NSP were detectable at MOI 1e4 and increased until MOI 1e6. The ABCA4 protein was loaded using an anti-ABCA4 antibody specific for the N-terminus of ABCA4 (upper panel; 20 s exposure) and an antibody specific for the sodium / potassium ATPase (Na + / K +ATPase; 5 sec exposure) were probed on Western blots. These results demonstrate the expected dose-response effect of increasing MOI in terms of ABCA4 RNA % and protein replacement levels.

[0060] Figure 22 shows ABCA4 RNA exon editing in vivo. Exon editing in AGM retina was measured by RT-qPCR. Neural retinal perforations in treated areas were analyzed by RT-qPCR. (A) RNA replacement % is shown as a percentage of total ABCA4 (native and edited). (B) Exon editor copy number per 10 ng RNA is normalized to RNF20. The exemplary AAV8 RNA exon editor construct (AAV8-REEC) used in this in vivo study includes an RNA exon editor comprising SEQ ID NO: 77. Results are shown for 1 month (4 weeks) and 3 months (12 weeks) time points.

[0061] Fig.23 A schematic diagram of the AAV vector plasmid (SEQ ID NO: 82) encoding ABCA4-01 (SEQ ID NO: 90) is shown.

[0062] Fig.24 Functional activity of proteins translated from exon-edited ABCA4 RNA is depicted. These results provide evidence confirming the functional activity of ABCA4 protein rescued by ABCA4 RNA exon editing. ATPase activity of ABCA4 protein enriched by immunoprecipitation from ABCA4 KO cells after untreated (negative control) or transfection with a V5 epitope-tagged version of the exon editor comprising SEQ ID NO: 78 (V5-tagged REEC), with the activity of the V5 epitope-tagged version (SEQ ID NO: 81) shown. ABCA4 ATPase activity measurements without ATR (baseline) or with the addition of 40 μM ATR (+ATR) are shown. Data are single biological replicates with technical duplicates or triplicates.

[0063] Fig.25 Depicted are RNA species captured by OFT-seq. GSP targets codon optimized (CO) sequences in exon 22 (Ex22) of exon editors. The red dashed area is sequenced by the Illumina sequencing platform. The purple area shows the ABCA4 CDS provided by the exon editor. For illustration purposes, three putative OFT junctions (A, B, C) and two putative self-splicing exon editor sequences are provided.

[0064] Fig.26Results depicting cryptic splice sites identified in HEK17+06 cells for exemplary ABCA4 constructs comprising the indicated elements and their frequency of usage are presented. A similar set of cryptic splice sites was identified and characterized in vivo in the NHP retina. The cryptic splice site frequency was experimentally determined for an ABCA4 construct comprising a precursor sequence before (SEQ ID NO: 46) (upper panel) and after (lower panel) introduction of a synonymous mutation in the identified cryptic splice site, which resulted in a splice site resistance sequence (SEQ ID NO: 79), as evidenced by a significant reduction in splicing frequency.

[0065] Fig.27A and 27B The activity of each RTM element shown alone and in combination in the context of the 5′RTM of an exemplary intron (Intron A) of a target mRNA precursor examined in vitro is shown. (A) A histogram is presented depicting the percentage of target RNA replacement for each of the constructs shown. Interestingly, the combination of 40mer+3×UBS, the combination of 40mer+ARE, or the combination of 40mer+3×UBS+ARE showed a trend toward a decrease in the percentage of target RNA replacement relative to the 40mer alone. (B) Western blots are depicted showing that the constructs shown, 40mer, 40mer+3×UBS, 40mer+ARE, and 40mer+3×UBS+ARE, express trans-splicing on-target proteins (ONTs), and each combination exhibits a combined effect on the reduction of NSPs relative to the 40mer alone. More specifically, compared to 40mer alone, the combination of 40mer+3×UBS reduced NSP levels by about 75%; the combination of 40mer+ARE reduced NSP levels by about 40%; and the combination of 40mer+3×UBS+ARE reduced NSP levels by about 88%.

[0066] Fig.28A and 28BThe activity of each RTM element shown alone and in combination in the context of the 5′RTM of an exemplary intron (intron B) of the target mRNA precursor examined in vitro is shown. (A) A histogram is presented depicting the percentage of target RNA replacement for each of the constructs shown. Interestingly, the combination of 40mer+3×UBS or the combination of 40mer+ARE showed a trend of increasing the percentage of target RNA replacement relative to the 40mer alone. (B) Western blots are depicted showing that the constructs shown, 40mer, 40mer+3×UBS, 40mer+ARE, and 40mer+3×UBS+ARE, express the trans-splicing target protein (ONT), and each combination of 40mer+3×UBS, 40mer+ARE, and 40mer+3×UBS+ARE exhibits a combined effect on the reduction of NSP relative to the 40mer alone. The combined effect of 40mer+3×UBS+ARE on the reduction of NSP is particularly evident relative to the 40mer alone. More specifically, compared to 40mer alone, the combination of 40mer+3×UBS reduced NSP levels by about 38%; the combination of 40mer+ARE reduced NSP levels by about 33%; and the combination of 40mer+3×UBS+ARE reduced NSP levels by about 66%.

[0067] Fig.29 Depicted is the activity of each RTM element shown alone and in combination in the context of the 5′RTM of an exemplary intron (intron C) of the target mRNA precursor examined in vitro. Briefly, HEK293T cells were transfected with RTMs containing: non-binding domain (NBD) + 40-mer; BD34 (specific binding to intron C) + 40-mer; BD34 + 40-mer + 3×UBS; or no RTM (transfection control). Cells were harvested 48 hours after transfection and the trans-splicing efficiency was determined by RT-qPCR. The replacement percentage of BD34 + 40-mer was about 1%, while for RTMs containing BD34 + 40-mer + 3×UBS, the replacement percentage increased to about 3%. Therefore, in the exemplary RTM targeting intron C shown, the replacement percentage of the 3×UBS element increased by about 3 times.

[0068] Figures 30A-30CResults demonstrating robust ABCA4 RNA and protein replacement in vivo in NHPs following six (6) months of treatment with an exemplary AAV8 RNA exon editor construct are presented. (A) Viral genome copy number (VGC) (x-axis) and exon editor RNA copy number (y-axis); (B) ABCA4 RNA replacement %; and (C) protein replacement in n=3 cynomolgus macaque animals following 6 months of treatment with ABCA4-01 (3.5E11 vg / eye). In A and B, DNA and RNA levels were assessed using a droplet digital polymerase chain reaction (ddPCR)-based assay. In C, total protein percentage (edited ABCA4 relative to the sum of edited and NHP native protein) was quantified using a qualified IA MS assay. The exemplary AAV8 RNA exon editor construct used in this in vivo study included an RNA exon editor comprising SEQ ID NO: 90. Results for four (4) NHPs are shown in (B) and (C) and designated 1-4: 1 (treated with vehicle); 2-4 (treated with 3.5E11 vg / eye).

[0069] Fig.31 Results demonstrating that exemplary AAV8 RNA exon editor constructs edit ABCA4 RNA in ex vivo human retina are presented. The exemplary AAV8 RNA exon editor constructs used in this ex vivo study include an RNA exon editor comprising SEQ ID NO: 90. The graph depicts the percentage of ABCA4 RNA replacement in human retinal explants from 3 independent donors after 21 days of treatment with vehicle or an exemplary AAV8 RNA exon editor construct comprising SEQ ID NO: 90. DETAILED DESCRIPTION

[0070] The compositions and methods described herein relate to trans-splicing molecules (e.g., pre-mRNA trans-splicing molecules) for treating diseases or conditions caused by mutations in the ABCA4 gene. The compositions and methods described herein employ pre-mRNA trans-splicing molecules for gene therapy (e.g., in vivo gene therapy, e.g., delivered by adeno-associated virus) to treat diseases caused by at least one mutation in ABCA4, such as Stargardt's disease or cone-rod dystrophy.

[0071] ABCA4 is approximately 6.8 kb in size, contains 50 exons, and encodes a 250 kDa ATP-binding cassette transporter that is expressed in photoreceptor cells and RPE cells. ABCA4 is a transmembrane protein that is specifically localized to the margins and incisions of the outer segment discs of rod and cone photoreceptor cells. In the retina, ABCA4 transports N-retinylidene-phosphatidylethanolamine from the lumen to the cytoplasmic leaflet of the disc membrane of the photoreceptor disc, a process that, combined with chemical isomerization, helps to remove potentially toxic retinoid compounds. In contrast, impaired ABCA4 function leads to the accumulation of diretinoids (such as the diretinal conjugate A2E) in the retinal pigment epithelium (RPE). This fragment, also known as lipofuscin, is thought to disrupt RPE metabolism and ultimately lead to cell death. Current genotype-phenotype models correlate the degree of residual ABCA4 activity with the severity of retinal disease phenotypes. Since ABCA4-related retinopathy is usually inherited in an autosomal recessive manner, individuals with 50% ABCA4 levels in photoreceptors are expected to have normal retinal function. Data from Abca4 knockout mice suggest that correction of ABCA4 levels in the range of 10-25% is sufficient to achieve relevant therapeutic effects, including reduced accumulation of toxic lipids in the retina.

[0072] Notably, the inventors have demonstrated complete rescue of ABCA4 protein levels in an in vitro engineered human ABCA4 protein knockout (KO) cell line carrying a disease-mimicking premature stop codon mutation, and achieved in vivo therapeutically relevant levels of RNA exon editing in NHP retina and human retinal explants. More specifically, the inventors have observed that AAV-ABCA4 exon editor treatment that results in >20% ABCA4 RNA exon editing efficiency (% RNA replacement) is sufficient to achieve 100% rescue of ABCA4 protein levels in vitro in an ABCA4 protein KO cell line. See, e.g. Figure 3C The parental ABCA4 knock-in (KI) cell line contains a strong CAG promoter knocked into the upstream of the endogenous ABCA4 locus, which is used as a reference for comparing the rescue efficiency of the ABCA4 protein. As described herein, an in vitro engineered human ABCA4 protein KO cell line was obtained from the parental ABCA4 KI cell line by introducing a disease-mimicking premature stop codon mutation into the ABCA4 gene. Therefore, the in vitro engineered human ABCA4 protein knockout cell line can be used as an in vitro model system to predict the therapeutic effect of the ABCA4 RNA exon editor (nucleic acid trans-splicing molecule) described herein.

[0073] In addition, the inventors have shown that a single subretinal administration of an exemplary AAV8-based ABCA4 exon editing molecule can cause up to 37% RNA replacement in vivo at a 3 month (12 week) time point in NHP eyes. See, e.g., Figure 22. As used herein, 37% replacement means that 37% of the total ABCA4 mRNA quantified from the treated cells or tissue is present in exon-edited form. The exemplary AAV8-based ABCA4 exon editing molecule used in this study comprises SEQ ID NO: 77, which shares the same regulatory elements and double stop codons present in SEQ ID NO: 90. This study also demonstrated that RNA trans-splicing causes translation of full-length human / NHPABCA4 protein expression, and that the expression level trend is consistent with the RNA replacement %. Additional NHP studies used a variety of other AAV8-based ABCA4 exon editing molecules, examined at different time points after treatment, and demonstrated that RNA trans-splicing causes persistent RNA exon editing and human / NHPABCA4 protein expression. See, e.g. Fig. 9 and 10B . Thus, the inventors achieved therapeutically relevant RNA exon editing via spliceosome-mediated trans-splicing and thus achieved full-length ABCA4 protein expression mediated by a single AAV vector in NHPs. These studies demonstrate that selected regulatory elements and the 40-mer linker and BD shared with ABCA4-01 (SEQ ID NO: 90) confer sustained expression and exon editing activity in NHPs up to the 3-month time point. See, e.g. Fig.22A and 22B .

[0074] Additional evidence presented herein indicates that ABCA4-01 (SEQ ID NO: 90), an exemplary AAV8-packaged RNA exon editor encoded by an AAV vector plasmid comprising SEQ ID NO: 82, can mediate trans-splicing of endogenous RNA precursors to an extent sufficient to at least partially restore ABCA4 biological activity in cells in vitro and in vivo. ABCA4-01 (SEQ ID NO: 90) is depicted in Fig.13 and spans the length of the RNA exon editor from 5′ITR to 3′ITR. In some embodiments, SEQ D NO: 78 [SEQ ID NO: 90, the portion spanning from 5′UTR to the end of MALAT1-MascRNA (antimut1); see Fig.13 ] can be used as an RNA exon editor. In some embodiments, Fig.13A portion of SEQ ID NO: 78 (e.g., SEQ ID NO: 69) spanning from exon 1-22 CDS to the end of the MALAT1-MascRNA containing anti-mut1 depicted in can be combined with different 5′UTRs in ABCA4 RNA exon editors and reasonably expected to successfully achieve comparable restoration of ABCA4 biological activity.

[0075] In addition to the above, Figures 30A-30C Also presented are results demonstrating that robust ABCA4 RNA and protein replacement was achieved in vivo in NHPs following six (6) months of treatment with an exemplary AAV8 RNA exon editor construct (ABCA4-01; SEQ ID NO: 90). Briefly, the inventors treated wild-type cynomolgus monkeys with a single subretinal dose of ABCA4-01 (3.5E11 vg / eye). The biodistribution of AAV vector genomic DNA copies (VGC), exon editor RNA expression, and the percentage of edited ABCA4 RNA and protein at the 6-month time point were then assessed. Exon editor RNA expression correlated well with VGC ( Fig. 30A ), and generated a robust RNA replacement % (conversion of native ABCA4 RNA copies to edited copies), which was calculated as the percentage of edited ABCA4 RNA in the total (edited + native) ABCA4 RNA population present in the neural retina sample ( Fig. 30B ).like Fig. 30B As shown, for this dose of ABCA4-01, the percentage of RNA replacement ranged from approximately 40% to 60%. This resulted in therapeutic levels of the resulting human-NHP chimeric ABCA4 protein, as measured by a qualified IA-MS assay ( Fig. 30C ). More specifically, human-NHP chimeric ABCA4 protein generated by ABCA4 RNA editing in these animals was found to account for 20-40% of the total (human-NHP+NHP) ABCA4 protein in the tested samples. In addition, the inventors also demonstrated up to 66% RNA replacement and up to 45% human / NHP chimeric ABCA4 protein in wild-type cynomolgus monkeys treated with higher doses of ABCA4-01 delivered by a single subretinal injection. These results indicate that ABCA4-01 achieves therapeutically relevant levels of edited ABCA4 protein expression in NHPs, levels that exceed the levels of rescued ABCA4 protein previously shown to confer therapeutic benefit in the Abca4 KO mouse model.

[0076] The inventors also evaluated ABCA4 exon editing in human photoreceptors by treating human donor retinal explants with ABCA4-01, an exemplary AAV8 RNA exon editor construct comprising SEQ ID NO: 90. As described in detail herein, the inventors treated explants from multiple donors with ABCA4-01 (3.9E11 vg / retinal punch), incubated the cells for 21 days, and then extracted RNA. Analysis of the extracted RNA indicated that approximately 20-30% of endogenous exons 1-22 were replaced by RNA encoded by ABCA4-01 with the same corresponding exons ( Fig.31 ).

[0077] The inventors also demonstrated that the rescued ABCA4 protein in ABCA4 protein KO cells transfected with an overexpression plasmid encoding an N-terminal V5 epitope-tagged version of the RNA exon editor of ABCA4-01 (SEQ ID NO: 81) exhibited ATPase activity. As described herein, after immunoprecipitation of ABCA4 protein, the activity of the rescued ABCA4 protein after trans-splicing mediated by the V5 epitope-tagged version of the RNA exon editor of ABCA4-01 (SEQ ID NO: 81) was evaluated in the presence or absence of 40 μM all-trans retinal (ATR). The results showed that the rescued ABCA4 protein in ABCA4 protein KO cells exhibited ATPase activity, which was reflected in the increase in the basal level of ATPase activity after the addition of 40 μM all-trans retinal. See Fig.24 These results demonstrate that exon-edited ABCA4 protein produced by treatment with ABCA4-01 (SEQ ID NO: 90) exhibits functional ATPase activity required for clearance of ATR and 11-cis-retinal from photoreceptors. These results depict restoration of ABCA4 biological activity following expression of an exemplary ABCA4 RNA exon editor.

[0078] Therefore, the results presented herein demonstrate the therapeutic potential of the ABCA4 RNA exon editors described herein (e.g., an RNA exon editor comprising any one of SEQ ID NO: 90, SEQ ID NO: 78, or SEQ ID NO: 69) and compositions comprising the same for treating ABCA4-related retinopathy and for preparing medicaments for treating ABCA4-related retinopathy, as well as in methods for treating subjects with ABCA4-related retinopathy. ABCA4-related retinopathies that can be treated using the ABCA4 RNA exon editors described herein (e.g., an RNA exon editor comprising any one of SEQ ID NO: 90, SEQ ID NO: 78, or SEQ ID NO: 69) and compositions comprising the same include Stargardt's disease-1 (STGD1; fundus yellow spot disease, retinitis pigmentosa-19 (RP19); cone-rod dystrophy-3 (CORD3); and age-related macular degeneration-2 (ARMD2). In some embodiments, an ABCA4 RNA exon editor described herein (e.g., an RNA exon editor comprising any one of SEQ ID NO: 90, SEQ ID NO: 78, or SEQ ID NO: 69) and compositions comprising the same can be used to treat ABCA4. NO: 69) and compositions comprising the same include inherited retinal diseases with two alleles of pathogenic mutations spanning exons 1-22 in the ABCA4 gene, which present a phenotype consistent with cone-rod dystrophy, Stargardt's macular dystrophy, or fundus yellow spot disease. According to existing data, approximately 60% of known ABCA4 mutations can be corrected using the ABCA4 RNA exon editor described herein (e.g., an RNA exon editor encoded by a nucleic acid trans-splicing molecule comprising any one of SEQ ID NO: 90, SEQ ID NO: 78, or SEQ ID NO: 69), and 70-85% of patients diagnosed with ABCA4-related retinopathy will benefit from treatment using the ABCA4 RNA exon editor described herein (e.g., an RNA exon editor comprising any one of SEQ ID NO: 90, SEQ ID NO: 78, or SEQ ID NO: 69).

[0079] In addition to the above, those skilled in the art recognize that new mutations are often identified in the ABCA4 gene and that these mutations are not necessarily attributed to a specific phenotype. The skilled artisan also recognizes that CORD3→STGD1→RP19 appears to represent a phenotypic spectrum based on the severity of the mutation. Therefore, RNA exon editors and constructs encoding the same and compositions comprising them can be used to advantageously treat conditions / diseases associated with any and all mutations identified in exons 1-22 of the ABCA4 gene, with the understanding that the phenotype subsequently attributed can be characterized as knowledge about ABCA4 retinopathy develops.

[0080] In some embodiments, the subject / patient is identified as having at least one mutation in exons 1-22 of the ABCA4 gene. In some embodiments, the subject / patient is genotyped to identify a subject / patient having at least one mutation in exons 1-22 of the ABCA4 gene. In some embodiments, a subject / patient who has been genotyped to identify a subject / patient having at least one mutation in exons 1-22 of the ABCA4 gene is obtained. Under any model, the subject / patient is selected based on having at least one mutation in exons 1-22 of the ABCA4 gene, regardless of the timing of the genotyping based on which the selection process is based relative to the recommended treatment of such subject / patient using the RNA exon editor described herein. Such subjects / patients will benefit from the use of the ABCA4 RNA exon editor described herein to treat ABCA4-related retinopathy, the drug comprising the ABCA4 RNA exon editor described herein to treat ABCA4-related retinopathy, and the method of treating ABCA4-related retinopathy requiring the administration of the ABCA4 RNA exon editor described herein or a composition comprising the same.

[0081] Stargardt's disease-1 (STGD1) is caused by homozygous or compound heterozygous mutations in the ABCA4 gene (OMIM#601691) on chromosome 1p22. More than 900 different mutations in the ABCA4 gene, including missense, splicing, truncating, and frameshift changes, have been reported and have been shown to be associated with retinal degeneration. Many of these mutations alter single amino acids in the ABCA4 protein, resulting in absent or reduced ABCA4 activity in photoreceptor cells. Reduced ABCA4 activity leads to the accumulation of vitamin A derivatives and lipofuscin in retinal cells, which is toxic to the retinal pigment epithelium and photoreceptors. Stargardt's macular degeneration is an inherited eye disorder that affects the retina, more specifically, an area called the macula that is responsible for sharp central vision, which is essential for a variety of visual tasks including reading, driving, and facial recognition. In addition to central vision loss, patients with Stargardt's macular degeneration experience impaired night vision, and some affected individuals also experience impaired color vision. Later in the course of the disease, moderate to extensive limitations in peripheral visual field may also occur. Signs and symptoms of Stargardt's macular degeneration typically appear in childhood to early adulthood, with patients experiencing progressive bilateral vision loss over time, typically to 20 / 200 or worse.

[0082] Fundus yellow spots (FFM) is an allelic subtype of Stargardt's disease, associated with mutations in the ABCA4 gene and the peripherin 2 (PRPH2) gene. Fundus yellow spots is a form of macular fundus disease, named for the presence of many white-yellow spots widely distributed on the fundus due to lipofuscin deposition. FFM is characterized by atrophy of the retinal pigment epithelial network and atrophy of the choroidal vessels. Central vision loss, color vision loss, photophobia, paracentral scotomas, and slow dark adaptation are typical features of FFM. FFM develops later than other Stargardt's disease subtypes and progresses more slowly. If vision loss begins within the first 20 years of life, patients are usually diagnosed with Stargardt's disease, while if the disease appears later in life and progresses more slowly, patients are usually diagnosed with FFM.

[0083] Retinitis pigmentosa-19 (RP19) may be caused by homozygous or compound heterozygous mutations in the ABCA4 gene on chromosome 1p22. Retinitis pigmentosa is an inherited eye disorder characterized by progressive loss of peripheral vision and impaired night vision. Many genes have been implicated in retinitis pigmentosa. Retinitis pigmentosa-19 is characterized by night blindness, peripheral vision loss, progressive retinal degeneration, tunnel vision, progressive visual loss, decreased vision at night or in low light, advanced central vision loss, and mottling of the retinal pigment epithelium (RPE). Clinically, the fundus shows widespread outer retinal degeneration, spicule pigmentation, vascular attenuation, waxy optic disc pallor and severe atrophic changes and macular choroidal scarring.

[0084] Cone-rod dystrophy-3 (CORD3) is caused by homozygous or compound heterozygous mutations in the ABCA4 gene on chromosome 1p22. ABCA4 is one of the four major pathogenic genes implicated in the pathogenesis of cone-rod dystrophy, and ABCA4 mutations are associated with 30% to 60% of autosomal recessive cone-rod dystrophy. CORD3 is an autosomal recessive, clinically heterogeneous retinal disorder typically characterized by symptomatic, rapidly progressive visual loss and initial manifestations of photophobia and loss of color discrimination, followed by night blindness and progressive visual field loss. Cone degeneration occurs early in life, affecting the center of the retina, followed by rod degeneration several years later. The diagnosis of cone-rod dystrophy is based on clinical history, fundus examination, and electroretinography. Cone-rod dystrophy typically presents earlier and progresses much more rapidly than other ABCA4 retinopathy, and extensive macular atrophy may not develop until years after onset. There are currently no therapies that can halt disease progression or restore vision, and the prognosis for vision loss is poor. Management aims to slow the degenerative process, treat complications, and help patients prepare for the challenges of coping with the social and psychological impacts of blindness.

[0085] Mutations in the ABCA4 gene on chromosome 1p22 cause susceptibility to age-related macular degeneration-2 (ARMD2). ARMD2 is a complex disorder characterized by accumulation of drusen (yellow deposits) in and under the RPE and progressive atrophy of the macula RPE. These changes lead to loss of light sensitivity and visual impairment. AMD is the leading cause of vision loss in older adults in developed countries. Vision loss usually becomes noticeable when a person is in their 60s or 70s and gets worse over time. AMD primarily affects central vision, which is essential for detailed tasks such as reading, driving, and facial recognition. Two main types of AMD have been described: dry and wet. Dry AMD is more common, accounting for 85% to 90% of all AMD cases. It is characterized by accumulation of drusen under the retina, atrophy of the macula, and gradual, slow loss of vision. The condition usually affects both eyes. Wet AMD is associated with sudden, severe vision loss that can worsen rapidly. This form of the disease is characterized by the growth of abnormal, fragile blood vessels beneath the macula due to overexpression of VEGF. These vessels leak blood and fluid, which damage the macula, blurring and distorting central vision. Wet macular degeneration can be treated with a variety of therapies. There is only one available treatment for dry AMD, a C3 inhibitor, which is only for patients who develop geographic atrophy. Currently, there is no treatment for the early forms of ARMD where only drusen deposits occur without atrophy or fluid leakage.

[0086] I. Definitions

[0087] As used herein, "trans-splicing" means that a first RNA molecule containing one or more exons (e.g., exogenous exons or exons that are part of the CDS of a trans-splicing molecule) is joined to a second RNA molecule (e.g., an mRNA precursor molecule, such as an endogenous mRNA precursor molecule) through a spliceosome-mediated mechanism, and a portion of the second RNA molecule is replaced with a portion of the first RNA molecule. Fig. 14B The general mechanism of RNA trans-splicing reaction is illustrated.

[0088] A "nucleic acid trans-splicing molecule" or "trans-splicing molecule" has three major elements: (a) a binding domain that confers specificity by tethering the trans-splicing molecule to its target gene (e.g., a pre-mRNA); (b) a splicing domain (e.g., a splicing domain with a 3' or 5' splicing site); and (c) a CDS that is configured to trans-splice onto a target nucleic acid, which can replace one or more exons (e.g., one or more mutated exons) in the target nucleic acid. A "pre-mRNA trans-splicing molecule" or "RTM" refers to a nucleic acid trans-splicing molecule that targets a pre-mRNA. The terms "nucleic acid trans-splicing molecule" and "trans-splicing molecule" refer to (1) a DNA encoding an RNA, wherein the RNA transcript is an effector molecule that is physically associated with the target pre-mRNA; and (2) the RNA transcript itself. For clarity, the term "coding sequence" (e.g., a trans-splicing molecule coding sequence) is used herein to specify a subject encoding an effector (e.g., the coding sequence is DNA and the effector is RNA). In some embodiments, the trans-splicing molecule coding sequence can include a cDNA, for example, as part of a functional exon (eg, a functional ABCA4 exon) for use in replacing a mutated ABCA4 exon.

[0089] As used herein, the term "exon editor" may be used to refer to a trans-splicing molecule or a vector comprising the same (e.g., an AAV vector comprising DNA encoding an RNA transcript that is a trans-splicing molecule).

[0090] As used herein, "trans-splicing efficiency" refers to the ratio of the expression level of the desired trans-splicing RNA product detected (i.e., a chimeric RNA molecule comprising a functional exon of a trans-splicing molecule operably linked to an endogenous target mRNA precursor produced by an RNA trans-splicing reaction) to the amount of DNA or RNA (or reference molecule) introduced for the trans-splicing molecule. In some cases, the expression level of the trans-splicing RNA product is detected in RNA isolated from cells or tissues using RNA-seq.

[0091] As used herein, "RNA replacement %" refers to the portion of the total target mRNA population that has been successfully trans-splicing (TS) and is calculated by the following formula: On-target (ONT) TS % = 100 x (ONT copy number / (ONT copy number + native copy number)).

[0092] As used herein, "relative trans-splicing efficiency" refers to the ratio of a test trans-splicing efficiency to a reference trans-splicing efficiency, wherein the test trans-splicing efficiency is the trans-splicing efficiency of a trans-splicing molecule (e.g., a nucleic acid trans-splicing molecule described herein), and the reference trans-splicing efficiency is the trans-splicing efficiency of a reference molecule (e.g., a reference molecule having the same elements as the nucleic acid trans-splicing molecule, but with the binding domain replaced with a scrambled binding domain (e.g., a binding domain comprising or consisting of SEQ ID NO: 1, such as a binding domain comprising or consisting of SEQ ID NO: 2). The relative trans-splicing efficiency of a trans-splicing molecule can be expressed as the ratio (also known as the fold increase) of the test trans-splicing RNA efficiency tested under similar conditions to the reference trans-splicing efficiency.

[0093] As used herein, the term "operably linked" or "operably connected" refers to an arrangement of elements in which the described components are configured to perform their usual functions. A nucleic acid is "operably linked" to another nucleic acid sequence when it has a functional relationship with the other nucleic acid sequence. Elements do not need to be adjacent to be operably linked. Thus, for example, an intervening sequence can be present between sequences that are operably linked (e.g., a binding domain and a coding sequence can be separated by an intervening sequence, and the binding domain is still considered to be "operably linked" to the coding sequence).

[0094] As used herein, the term "CDS" refers to a nucleic acid sequence (e.g., an RNA sequence, a DNA sequence, or a combination of RNA and DNA) encoding a portion of a protein (e.g., a target protein that is correcting a mutation). Thus, a CDS may include one or more functional exons (e.g., a functional exon sequence). In some cases, one or more functional exons of a CDS are not separated by introns (e.g., in an endogenous mRNA precursor), but are adjacent to each other (e.g., as a cDNA). In some cases, a CDS may include one or more introns (e.g., natural introns) or an untranslated region (UTR, such as a natural UTR) located between or adjacent to (e.g., upstream or downstream of) an exon.

[0095] As used herein, "native 5'ABCA4 untranslated region" or "native 5'ABCA4 UTR" refers to a sequence greater than 20 nucleotides in length that has at least 90% sequence identity to the region of a native ABCA4 gene (e.g., a human ABCA4 gene) located 5' to the ATG start codon. An example of a native 5'ABCA4 untranslated region is given by the DNA sequence of SEQ ID NO: 13 or the RNA sequence of SEQ ID NO: 12. Variants of the native 5'ABCA4 untranslated region are also encompassed herein, such as the DNA sequence of SEQ ID NO: 64 or the RNA sequence of SEQ ID NO: 65.

[0096] As used herein, "functional sequence of 5' ABCA4 exon" refers to a nucleic acid sequence comprising one or more of ABCA4 exons 1-22 that encodes a functional (biologically active) portion of an ABCA4 protein. The functional sequence of 5' ABCA4 exon can express a functional ABCA4 protein (e.g., a non-mutated ABCA4 protein) when trans-spliced ​​3' to an endogenous ABCA4 exon at the binding site. In some cases, the functional sequence of 5' ABCA4 exon includes exon sequences adjacent to the exon being trans-spliced ​​by the trans-splicing molecule (e.g., a trans-splicing molecule that binds ABCA4 intron 22 and trans-splices with endogenous ABCA4 exon 23 can include functional sequences of 5' ABCA4 exon comprising exons 22, 21, 20, 19, etc.).

[0097] As used herein, the term "functional" when used in the context of a protein refers to a biologically active protein. The term "functional" may also be used to refer to the amount of protein activity necessary to support normal cellular function. With respect to ABCA4, the term "functional" may be used to refer to the amount of ABCA4 protein activity necessary to restore ABCA4 activity levels to support normal cellular function in the context of, for example, photoreceptor cells and / or retinal epithelial cells. Such levels are sufficient to reduce or prevent the accumulation of bi-retinoid compounds to toxic levels in photoreceptor cells and / or retinal epithelial cells. More specifically, defective (non-functional) ABCA4 protein results in accumulation of 11-cis and all-trans retinal in photoreceptors, and accumulation of lipofuscin in the retinal pigment epithelium. In the context of treating a condition associated with reduced or negligible ABCA4 activity or using a therapeutic agent comprising a nucleic acid trans-splicing molecule as described herein, functionality refers to restoring an amount of ABCA4 protein sufficient to eliminate one or more symptoms of a condition associated with reduced ABCA4 activity levels (e.g., ABCA4-associated retinal dystrophy). ABCA4-related retinal dystrophies include, for example, Stargardt's macular dystrophy (Stargardt's disease), fundus yellow spots, and ABCA4-related cone-rod dystrophy. In some embodiments, such methods or uses result in an increase in ABCA4 protein activity (functional biologically active ABCA4 protein activity). In some embodiments, such an increase in ABCA4 protein activity restores the level of ABCA4 activity to at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% (e.g., 96%, 97%, 98%, 99%, or 100%) of the activity of ABCA4 relative to cells in which ABCA4 is present at normal wild-type levels, such as the levels present in cells expressing non-mutated ABCA4 (e.g., photoreceptors and / or retinal epithelial cells).

[0098] As used herein, "correcting cryptic splice sites", "reducing cryptic splice sites" or "anti-cryptic splice sites" refers to a nucleic acid trans-splicing molecule or a portion thereof (e.g., a coding domain sequence therein) that has been modified to change individual nucleotides therein, thereby reducing the frequency of splicing occurring at a cryptic splice site identified in the context of the nucleic acid trans-splicing molecule. In some embodiments, the modification does not result in any change in the amino acid sequence encoded thereby. In some embodiments, the modification results in a change in the amino acid sequence encoded thereby. In some embodiments, the anti-cryptic splice site nucleic acid sequence within the nucleic acid trans-splicing molecule is a coding domain sequence (CDS). In some embodiments, the anti-cryptic splice site ABCA4 CDS comprises, consists essentially of, or consists of exons 1-22 of the ABCA4 gene, wherein cryptic splice sites have been identified in the context of the nucleic acid trans-splicing molecule, and wherein at least one cryptic splice site has been modified to reduce the frequency of splicing at at least one site without changing the amino acid encoded thereby. Exemplary cryptic splice sites identified in ABCA4 exons 1-22 and the splicing frequencies of these sites are presented in Table 3. The nucleotide positions shown in the columns with the rtm_pos heading in the table refer to the position of the last nucleotide shown in column 3 or 4 relative to the ATG codon (translation start site), with the A in the codon being designated as position 1. Exemplary cryptic splice-resistant ABCA4 exon 1-22 sequences comprise, consist essentially of, or consist of any one of SEQ ID NOs: 56-59. In some embodiments, the exemplary cryptic splice-resistant ABCA4 exon 1-22 sequence comprises, consists essentially of, or consists of SEQ ID NO: 56.

[0099] As used herein, "splicing domain" refers to a nucleic acid sequence having a motif that is recognized by the spliceosome and mediates trans-splicing. The splicing domain includes a splicing site (e.g., a single splicing site, i.e., there is and only one splicing site), which can be a 3' splicing site or a 5' splicing site. The splicing domain may include other regulatory elements. For example, in some embodiments, the splicing domain includes a splicing enhancer (e.g., an exon splicing enhancer (ESE) and an intron splicing enhancer (ISE)). In some embodiments, the splicing domain comprises GUAAGT or GTAAGT. In some embodiments, the splicing site is mainly composed of GUAAGT or GTAAGT. In some embodiments, the splicing site is mainly composed of GUAAGT or GTAAGT.

[0100] As used herein, a "binding domain" of a trans-splicing molecule is a polynucleotide sequence that binds to a target gene at a binding site by hybridization (ie, fully or partially complementary to the binding site).

[0101] As used herein, the term "binding site" refers to an endogenous polynucleotide sequence in a target mRNA (e.g., an mRNA of an endogenous gene such as ABCA4) that binds to a binding domain of a nucleic acid trans-splicing molecule. The binding site extends from the 5'-most nucleotide to which the binding domain binds to the 3'-most nucleotide to which the binding domain binds. In some embodiments, the length of the binding site is the same as the length of the binding domain. In other embodiments, the binding site is 1-10 residues longer or shorter than the binding domain (i.e., some residues of the binding site or the binding domain are not hybridized). In embodiments involving a binding domain having at least two non-overlapping sequences and having at least 80% complementarity with the binding site, the binding site can be significantly shorter than the binding domain.

[0102] As used herein, "complementarity" and its grammatical variants refer to the percentage of nucleotide bases of a given sequence that pair with a reference sequence through hydrogen bonds. In the absence of a given percentage of complementarity, the terms "complement" and "complementary" refer to 100% complementarity.

[0103] As used herein, a given sequence (e.g., a binding domain sequence) is "100% complementary" to, or has "100% complementarity" with, a reference sequence if each nucleotide base of the sequence (e.g., a binding domain sequence) is paired with a reference sequence (e.g., an endogenous pre-mRNA binding site) by hydrogen bonding, thereby hybridizing to form a double-stranded sequence (e.g., by Watson-Crick base-pairing, e.g., each A is paired with a T or U, and each C is paired with a G). For example, a binding domain that is oriented antisense to a binding site is complementary to the binding site. RNA pairing includes G and U pairing (wobble base pairing); thus, an RNA binding domain that is GU paired with a binding site can be 100% complementary to the binding site. Thus, a binding domain that is completely reverse complementary to a binding site (i.e., an A of the binding domain is paired with a U of the binding site) can be modified to replace any one or more A's with G's without significantly affecting binding.

[0104] As used herein, a given sequence (e.g., a binding domain sequence) is "at least X% complementary" to, or has "X% complementarity" with, a reference sequence (e.g., an endogenous pre-mRNA binding site) if X% of its nucleotide bases are paired with a reference sequence (e.g., an endogenous pre-mRNA binding site) by hydrogen bonding, e.g., hybridizing to form a double-stranded sequence (e.g., by Watson-Crick base pairing, e.g., A pairs with T or U, and C pairs with G). For example, if at least 135 of the 150 residues of a 150-base binding domain sequence are paired with a 150-base binding site by hydrogen bonding by Watson-Crick base pairing, leaving 15 or fewer mismatched nucleotides, then the binding domain sequence is at least 90% complementary to the binding site.

[0105] As used herein, "binding" between a binding domain and an intron refers to the formation of hydrogen bonds (e.g., double helix formation or Watson-Crick pairing) between the binding domain and the target intron to an extent sufficient to mediate trans-splicing by associating the trans-splicing molecule with the target (e.g., mRNA precursor). In some embodiments, the hydrogen bonds between the binding domain and the target intron are between nucleotide bases that are complementary and in an antisense orientation to each other (e.g., hybridized to each other).

[0106] The sequence of the binding domain can be at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% complementary to the target sequence of the target sequence (e.g., mRNA precursor). In some embodiments, the sequence of the binding domain can be 100% complementary to the target sequence of the mRNA precursor transcript.

[0107] In some embodiments, the sequence of the binding domain may have 4 or fewer mismatches relative to the target sequence of the pre-mRNA transcript. In some embodiments, the sequence of the binding domain may have 3 or fewer mismatches relative to the target sequence of the pre-mRNA transcript. In some embodiments, the sequence of the binding domain may have 2 or fewer mismatches relative to the target sequence of the pre-mRNA transcript. In some embodiments, the sequence of the binding domain may have 1 or fewer mismatches relative to the target sequence of the pre-mRNA transcript. In some embodiments, the sequence of the binding domain may have no mismatches relative to the target sequence of the pre-mRNA transcript.

[0108] The binding domain can specifically hybridize with the target sequence of the mRNA precursor transcript. For example, the binding domain can have 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 100% sequence complementarity with the target sequence of the mRNA precursor transcript. In some embodiments, hybridization can be carried out under physiological hybridization conditions (in vitro or in vivo cells). In some embodiments, hybridization can be carried out under high stringency hybridization conditions.

[0109] In some embodiments, the binding domain "specifically hybridizes" or is "specific" to a target sequence of a mRNA precursor. Such hybridization typically occurs at a Tm significantly above 37°C, more particularly at least 50°C, and typically between 60°C and about 90°C. Such hybridization more specifically corresponds to stringent hybridization conditions. At a given ionic strength and pH value, Tm is the temperature at which 50% of the target sequence hybridizes to a complementary oligonucleotide.

[0110] As used herein, "artificial intron" refers to a non-coding nucleic acid sequence that connects a binding domain (directly or indirectly) to a CDS. An artificial intron includes a splicing domain and may also include one or more spacer sequences and / or other regulatory elements.

[0111] As used herein, the term "mutation" can be used to refer to any abnormal nucleic acid sequence that results in a defective protein product (e.g., a non-functional protein product, a non-biologically active protein, a protein product with reduced function, a protein product with abnormal function, and / or a protein product produced in an amount less than the normal amount or more than the normal amount). Mutations include base pair mutations (e.g., single nucleotide polymorphisms), missense mutations, frameshift mutations, deletions, insertions, and splice mutations. In some embodiments, a mutation refers to a nucleic acid sequence in which one or more portions of the sequence are different from the corresponding wild-type nucleic acid sequence or a functional variant thereof. In some embodiments, a mutation refers to a nucleic acid sequence encoding a protein having an amino acid sequence different from the corresponding wild-type protein or a functional variant thereof. A "mutated exon" (e.g., a mutated ABCA4 exon) refers to an exon containing a mutation or an exon sequence that reflects a mutation in a different region, such as a cryptic exon caused by an intron mutation.

[0112] Unless otherwise indicated, the term "ABCA4" (ATP-binding cassette subfamily A member 4) refers to any native ABCA4 (also known as ARMD2, CORD3, ABCR, FFM, retina-specific phospholipid transporting ATPase ABCA4, Stargardt's disease protein, RIMABC transporter, RIMProteinv, STGD1, RP19 or STGD) from any vertebrate source, including mammals, such as primates (e.g., humans, African green monkeys and cynomolgus monkeys) and rodents (e.g., mice and rats), and functionally equivalent or improved variants (e.g., natural or synthetic variants), mutants, muteins, analogs, subunits, receptor complexes, isoforms, splice variants and fragments thereof. Functionally equivalent and improved variants can be determined based on known ABCA4 signaling. ABCA4 encompasses full-length unprocessed ABCA4, as well as any form of ABCA4 produced by natural processing within the cell. An exemplary human ABCA4 sequence is provided as the National Center for Biotechnology Information (NCBI) reference sequence NG_009073.1. In some cases, ABCA4 is encoded by a therapeutic gene having at least 95% sequence identity to SEQ ID NO: 11 (e.g., at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 11, a functional portion thereof, and / or a codon-optimized variant thereof).

[0113] As used herein, "variant" refers to a polynucleotide that differs from a reference polynucleotide sequence (e.g., a naturally occurring polynucleotide sequence) at at least one nucleic acid residue, or a polypeptide (e.g., an AAV capsid sequence) that differs from a reference polypeptide sequence (e.g., a naturally occurring polypeptide sequence or, for example, any rAAV sequence described herein) at at least one amino acid residue. In this context, the difference in at least one residue may include, for example, a substitution, deletion, or insertion of one nucleic acid residue by another nucleic acid, or a substitution of one amino acid residue by another amino acid. A variant may be a homologue, isomer, or transcript variant of a polynucleotide as defined herein, wherein a homologue, isoform, or transcript variant is characterized by a degree of identity or homology, respectively, as defined herein.

[0114] In some cases, the variant of a polynucleotide or polypeptide includes at least one nucleic acid substitution (e.g., 1-100 nucleic acid or amino acid substitutions, 1-50 nucleic acid or amino acid substitutions, 1-20 nucleic acid or amino acid substitutions, 1-10 nucleic acid or amino acid substitutions, such as 1 nucleic acid or amino acid substitution, 2 nucleic acid or amino acid substitutions, 3 nucleic acid or amino acid substitutions, 4 nucleic acid or amino acid substitutions, 5 nucleic acid or amino acid substitutions, 6 nucleic acid or amino acid substitutions, 7 nucleic acid or amino acid substitutions, 8 nucleic acid or amino acid substitutions, 9 nucleic acid or amino acid substitutions or 10 nucleic acid or amino acid substitutions). Nucleic acid substitutions that cause the expressed polypeptide to have exchange amino acids from the same class are referred to herein as conservative substitutions. Specifically, these are amino acids with aliphatic side chains, positively or negatively charged side chains, amino acids with aromatic groups in the side chains, or amino acids whose side chains can form hydrogen bridges, such as amino acids with side chains of hydroxyl functional groups. By conservative construction, for example, an amino acid having a polar side chain can be replaced by another amino acid having a corresponding polar side chain, or, for example, an amino acid characterized by a hydrophobic side chain can be replaced by another amino acid having a corresponding hydrophobic side chain (e.g., serine (threonine) is replaced by threonine (serine), or leucine (isoleucine) is replaced by isoleucine (leucine)).

[0115] In some cases, the term variant also encompasses insertions, deletions and / or non-conservative substitutions, such as insertions, deletions and / or non-conservative substitutions at positions that do not result in substantial changes in the three-dimensional structure of the protein. Those skilled in the art can easily determine the modifications to the three-dimensional structure by insertion or deletion, such as using CD spectroscopy (circular dichroism spectroscopy).

[0116] The term "homology" refers to the degree of identity between two nucleic acid sequences. The homology of a sequence is determined by comparing two sequences aligned under standard conditions over the length of the sequence to be compared. The sequence to be compared herein may have additions or deletions (e.g., gaps, etc.) in the optimal alignment of the two sequences. In some embodiments, sequence homology is calculated by creating an alignment using, for example, the ClustalW algorithm (Nucleic Acid Res., 1994, 22 (22): 46734680). Common sequence analysis software, such as Vector NTI, GENETYX, BLAST, or analysis tools provided by public databases, may also be used.

[0117] As used herein, the term "AAV" or "AAV serotype" refers to dozens of naturally occurring and available adeno-associated viruses and artificial AAVs. Among the AAVs isolated or engineered from humans or non-human primates (NHPs) and well characterized, human AAV2 is the first AAV developed as a gene transfer vector; it has been widely used to conduct effective gene transfer experiments in different target tissues and animal models.

[0118] As used herein, in relation to AAV, the term variant means any AAV sequence derived from a known AAV sequence, including sequences that share at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% or greater sequence identity in amino acid or nucleic acid sequence. In another embodiment, the AAV capsid includes a variant that may include up to about 10% variation with any described or known AAV capsid sequence. That is, the AAV capsid shares about 90% identity to about 99.9% identity, about 95% to about 99% identity, or about 97% to about 98% identity with the AAV capsid provided herein and / or known in the art. In one embodiment, the AAV capsid has at least 95% identity with the AAV capsid. When determining the percent identity of the AAV capsid, any variable protein (e.g., vp1, vp2, or vp3) can be compared.

[0119] ITRs or other AAV components can be easily isolated or engineered from AAV using techniques available to those skilled in the art. Such AAVs can be isolated, engineered or obtained from academic, commercial or public sources (e.g., American Type Culture Collection (Manassas, Va.)). Alternatively, AAV sequences can be engineered by synthesis or other suitable means with reference to published sequences (e.g., sequences available in the literature or in databases such as GenBank, PubMed, etc.). AAV viruses can be engineered by conventional molecular biology techniques, so that these particles can be optimized to achieve cell-specific delivery of nucleic acid sequences, minimize immunogenicity, adjust stability and particle lifespan, effectively degrade, accurately deliver to the cell nucleus, etc.

[0120] As used herein, the terms "subject," "individual," or "patient" include any mammal in need of these treatment or prevention methods, including primates, such as humans. Other mammals in need of such treatment or prevention include non-human primates (NHPs; e.g., cynomolgus monkeys and African green monkeys), dogs, cats or other domesticated animals, horses, livestock, laboratory animals (e.g., mice, rats, or rabbits), and the like. The individual can be male or female. In one embodiment, the individual suffers from a disease or condition caused by a mutation in the ABCA4 gene (e.g., ABCA4-associated retinal dystrophy). In another embodiment, the individual is at risk of developing a disease or condition caused by a mutation in the ABCA4 gene. In another embodiment, the individual has shown clinical signs of a disease or condition caused by a mutation in the ABCA4 gene, such as ABCA4-associated retinal dystrophy. The individual can be of any age for which a therapeutic or preventive therapy may be beneficial. For example, in some embodiments, the individual is 0-5 years old, 5-10 years old, 10-20 years old, 20-30 years old, 30-50 years old, 50-70 years old, or over 70 years old. In another embodiment, the individual is 12 months or older, 18 months or older, 2 years or older, 3 years or older, 4 years or older, 5 years or older, 6 years or older, 7 years or older, 8 years or older, 9 years or older, or 10 years or older. In another embodiment, the individual has viable retinal cells (e.g., viable retinal cells sufficient to maintain partial visual function or full visual function).

[0121] As used herein, the term "disorder associated with a mutation" or "mutation associated with a disorder" refers to the correlation between a disease and a mutation. In some embodiments, a disorder associated with a mutation is known or suspected to be caused in whole or in part, or directly or indirectly, by the mutation. For example, an individual with a mutation may be at risk for developing the disorder, and the risk may also depend on other factors, such as other (e.g., independent) mutations (e.g., in the same or different gene) or environmental factors.

[0122] As used herein, the term "treatment" or its grammatical derivatives are defined as reducing the progression of the disease, reducing the severity of disease symptoms, delaying the progression of disease symptoms, eliminating disease symptoms, or delaying the onset of the disease. In some embodiments, the term "treatment" is used to refer to the sustained or lasting effect of a therapeutic agent (e.g., an RNA exon editor described herein). For example, evidence demonstrating the lasting therapeutic effect of an RNA exon editor described herein is presented in Figures 22 and 31. In some embodiments, the therapeutic effect provided herein lasts for at least 1, 2, 3, 4, 5, 6 months or longer. In some embodiments, the nucleic acid trans-splicing molecule is administered only once in a lifetime.

[0123] As used herein, the term "preventing" a condition or its grammatical derivatives is defined as reducing the risk of developing a disease, e.g., prophylactically treating an individual at risk for developing a condition associated with a mutation. An individual may be characterized as "at risk for developing a condition" by identifying a mutation associated with the condition according to any suitable method known in the art or described herein. In some embodiments, an individual at risk for developing a condition has one or more ABCA4 mutations associated with the condition. Additionally or alternatively, an individual may be described as "at risk for developing the condition" if the individual has a family history of the condition.

[0124] As used herein, the term "ABCA4-associated retinopathy" includes diseases / disorders associated with ABCA4 mutations, including, for example, Stargardt's disease-1 (STGD1); fundus yellow spots, retinitis pigmentosa-19 (RP19); cone-rod dystrophy-3 (CORD3); and age-related macular degeneration-2 (ARMD2).

[0125] The disorder in the individual can be treated or prevented by directly administering a trans-splicing molecule or RNA exon editor to the individual (e.g., in a vector, such as an AAV vector or AAV particle). Alternatively, a host cell containing the trans-splicing molecule can be administered to the individual.

[0126] As used in the methods described herein, the term "administering" or its grammatical derivatives refers to delivering a trans-splicing molecule or RNA exon editor (e.g., in a vector, such as an AAV vector or AAV particle) or a composition thereof, or cells treated ex vivo, to an individual in need, such as an individual with an ABCA4 mutation or defect. For example, in one embodiment targeting ocular cells (e.g., photoreceptors), the method involves delivering a trans-splicing molecule or RNA exon editor (e.g., in a vector, such as an AAV vector or AAV particle) or a composition thereof to an individual by subretinal injection. In another embodiment, administration may be performed by intravitreal injection or trans-eyelid intravenous injection. In another embodiment, the composition is administered systemically (e.g., intravenously). In view of the present disclosure, those skilled in the art may also select other methods of administration.

[0127] As used herein, "modulating ABCA4 expression" refers to reducing the expression of endogenous mutant (non-functional) ABCA4 and / or increasing the expression of trans-spliced ​​ABCA4. Modulating the expression of ABCA4 can be used to refer, for example, to reducing the expression of endogenous (e.g., mutant) ABCA4 and / or increasing the expression of trans-spliced ​​ABCA4 (e.g., an ABCA4 transcript or protein product having a trans-splicing molecule-mediated corrected mutation site relative to the endogenous mutant transcript or protein product). After replacing the endogenous ABCA4 exon constituting the mutation site by trans-splicing, a functional ABCA4 protein is expressed.

[0128] As used herein, "codon optimization" refers to modifying a nucleic acid sequence to change individual nucleic acids without causing any changes in the encoded amino acids. Sequences modified in this manner are referred to herein as "codon optimized". This process can be performed on any sequence described in this specification to enhance expression or stability. Codon optimization can be performed in a manner described in, for example, U.S. Patent Nos. 7,561,972, 7,561,973, and 7,888,112, each of which is incorporated herein by reference in its entirety. The sequence surrounding the translation start site can be converted to a consensus Kozak sequence according to known methods. See, for example, Kozak et al., 1987. Nucleic Acids Res. 15 (20): 8125-8148, which is incorporated herein by reference in its entirety.

[0129] The term "pharmaceutically acceptable" means safe for administration to mammals (e.g., humans). In some embodiments, pharmaceutically acceptable compositions are approved by federal regulatory agencies or state governments or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeias for use in animals and more particularly in humans.

[0130] The term "carrier" refers to a diluent, adjuvant, excipient or vehicle with which a therapeutic molecule (e.g., a trans-splicing molecule of the invention or a vector or cell comprising a trans-splicing molecule) is administered. Examples of suitable pharmaceutical carriers are described in "Remington's Pharmaceutical Sciences," Mack Publishing Co., Easton, PA., 18th edition.

[0131] The terms "a" and "an" mean "one or more". For example, "a gene" is understood to represent one or more such genes. Therefore, the terms "a" and "an", "one or more (or one)" and "at least one (or one)" are used interchangeably herein.

[0132] Unless otherwise indicated, the left end of a single-stranded nucleic acid (e.g., mRNA precursor transcript, oligonucleotide, etc.) sequence is the 5′ end, and the left direction of a single-stranded or double-stranded nucleic acid sequence is referred to as the 5′ direction. Similarly, the right end or direction of a nucleic acid sequence (single-stranded or double-stranded) is the 3′ end or direction. In general, the region or sequence in a nucleic acid that is 5′ relative to a reference point is referred to as “upstream,” and the region or sequence in a nucleic acid that is 3′ relative to a reference point is referred to as “downstream.” In general, the 5′ direction or end of an mRNA is where the start or initiation codon is located, and the 3′ end or direction is where the termination codon is located.

[0133] Unless otherwise specified, as used herein, the term "about" refers to a value within a variation range of ±10% relative to a reference value.

[0134] II. Trans-splicing molecules

[0135] Exon editor design and discovery employed a combined approach that included next-generation sequencing (NGS)-based screening of exon editor libraries followed by computational analysis, as well as transfection of individual exon editors followed by RT-qPCR analysis to assess RNA replacement efficiency and Western blot analysis to assess protein rescue. The former approach leveraged rational design and accumulated knowledge gained from past screens and the power of multiple parallel throughput, while the latter approach was used to test new hypotheses and validate conclusions drawn from NGS-based approaches.

[0136] Provided herein are nucleic acid trans-splicing molecules that can be used to correct mutations in ABCA4 by replacing at least one mutated ABCA4 exon with a functional ABCA4 exon (e.g., an ABCA4 exon that is 5' relative to the binding site, such as exons 1-22 of ABCA4). In some embodiments, the nucleic acid trans-splicing molecule is a pre-RNA trans-splicing molecule (RTM). The design of the trans-splicing molecule allows for replacement of a defective or mutated portion of a pre-mRNA exon with a nucleic acid sequence, such as an exon that has a functional (e.g., normal) sequence without the mutation. The functional sequence can be a wild-type, naturally occurring sequence, or a corrected sequence that has undergone some other modification (e.g., codon optimization).

[0137] The trans-splicing molecule comprises a binding domain, a splicing domain, and a CDS. In some embodiments, the nucleic acid trans-splicing molecule has a 5' regulatory domain having a native 5' ABCA4 untranslated region (e.g., a sequence having at least 80% sequence identity to any one of SEQ ID NOS: 12-15). In some embodiments, the nucleic acid trans-splicing molecule has a splice site of GUAAGT or GTAAGT. In some embodiments, the nucleic acid trans-splicing molecule has a linker domain of more than 25 nucleotides in length. In some embodiments, the nucleic acid trans-splicing molecule has a linker domain comprising, consisting essentially of, or consisting of SEQ ID NO: 27 or a sequence having at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, or at least 99% identity to SEQ ID NO: 27.

[0138] In some embodiments, the trans-splicing molecules described herein include the following operably linked in the 5′ to 3′ direction: a 5′ untranslated region, a coding domain sequence (e.g., a CDS, e.g., a sequence encoding a functional sequence of an ABCA4 exon, e.g., a sequence encoding a functional sequence of an ABCA4 exon that is 5′ relative to a binding site), a splicing domain (e.g., a splicing site), a linker domain, a binding domain, a 3′ downstream region, and a terminator domain.

[0139] In some embodiments, the nucleic acid trans-splicing molecules described herein are configured to correct at least one mutation (e.g., two different mutations, each of which is present on a different allele of the ABCA4 gene in a subject) located in the 5′ region of the ABCA4 gene (e.g., the region 5′ of intron 22) by binding to the target intron 22 and mediating trans-splicing of the CDS having the 5′ ABCA4 exon functional sequence with the endogenous ABCA4 exon 3′ of the target intron. Such trans-splicing thereby repairs the defective ABCA4 gene in the target cell of the individual by replacing the defective exon and removing the defective portion of the target mRNA precursor, producing a functional ABCA4 mRNA capable of transcribing a functional ABCA4 protein in the cell.

[0140] In some embodiments, the trans-splicing molecule can be up to 5,000 nucleotide bases in length, e.g., up to 4,900 nucleotide bases in length, up to 4,800 nucleotide bases in length, or up to 4,700 nucleotide bases in length (e.g., 3,000 to 4,000 nucleotide bases in length, 3,100 to 3,800 nucleotide bases in length, 3,200 to 3,700 nucleotide bases in length, or 3,300 to 3,500 nucleotide bases in length, e.g., 3,000 to 3,100 nucleotide bases in length, 3,100 to 3,200 nucleotide bases in length, 3,200 to 3,300 nucleotide bases in length, 3,300 to 3,400 nucleotide bases in length, 3,400 to 3,500 nucleotide bases in length, 3,500 to 3,600 nucleotide bases in length). bases, 3,600 to 3,700 nucleotide bases in length, 3,700 to 3,800 nucleotide bases in length, 3,800 to 3,900 nucleotide bases in length, 3,900 to 4,000 nucleotide bases in length, 4,000 to 4,100 nucleotide bases in length, 4,100 to 4,200 nucleotide bases in length, 4,200 to 4,300 nucleotide bases in length, 4,300 to 4,400 nucleotide bases in length, 4,400 to 4,500 nucleotide bases in length, 4,500 to 4,600 nucleotide bases in length, 4,600 to 4,700 nucleotide bases in length, 4,700 to 4,800 nucleotide bases in length, 4,800 to 4,900 nucleotide bases in length or 4,900 to 5,000 nucleotide bases in length).

[0141] Due to the large size of the ABCA4 gene and the size limitations of AAV delivery, a single trans-splicing molecule configured for packaging within an AAV vector (e.g., as a trans-splicing molecule encoding sequence) may not span all mutations in the ABCA4 gene that may be associated with a disorder and, therefore, may not correct mutations across the entire length of the ABCA4 gene. Therefore, the trans-splicing molecules described herein can be tailored as part of the methods described below to correct multiple mutations across the entire length of the ABCA4 gene.

[0142] ABCA4

[0143] The ABCA4 gene targeted by the trans-splicing molecules described herein may contain one or more mutations associated with (e.g., causing or associated with) ABCA4-related retinal dystrophy diseases, such as Stargardt's disease or cone-rod dystrophy. An exemplary human ABCA4 sequence is provided by the National Center for Biotechnology Information (NCBI) reference sequence NG_009073. In addition to the published sequences, all subsequently obtained corrections or naturally occurring conservative and non-pathogenic variant sequences that exist in humans or other mammalian populations are also included. Additional conservative nucleotide substitutions or nucleotide substitutions that result in codon optimization are also included. The sequences provided by the database accession number can also be used to search for homologous sequences in the same or another mammalian organism.

[0144] It is expected that the ABCA4 nucleic acid sequence and the resulting expressed protein can tolerate certain minor modifications at the nucleic acid level, including, for example, modifications to silent nucleotide bases (such as preferred codons). In other embodiments, nucleic acid base modifications that change amino acids, for example, to improve expression of the resulting peptide / protein (e.g., codon optimization) are contemplated. In some embodiments, modifications of allelic variations caused by the natural degeneracy of the genetic code are contemplated.

[0145] Modifications of the ABCA4 gene also include analogs, or modified versions of the encoded amino acid sequence. Typically, such analogs differ from the specifically identified protein by only one to four codon changes. Conservative substitutions are substitutions that occur within a family of amino acids that are related in side chains and chemical properties.

[0146] The nucleic acid sequence of the functional ABCA4 gene can be derived from any mammal that naturally expresses functional ABCA4 or its homologues. In other embodiments, certain modifications are made to the ABCA4 gene sequence to enhance expression in target cells. These modifications include codon optimization.

[0147] For example, mutations in particular exons of ABCA4 are listed in International Patent Publication No. WO 2017 / 087900, which is incorporated herein by reference.

[0148] As described above, ABCA4 retinopathy is caused by pathogenic variants in the ABCA4 gene, which are inherited in an autosomal recessive manner. Such pathogenic variants (mutations) include missense variants, nonsense variants, splice variants, structural variants, and deep intronic variants. Missense variants account for the majority of variants associated with ABCA4 retinopathy. In individuals with ABCA4 retinopathy, ABCA4 on each allele of the individual is mutated. A composition comprising a trans-splicing molecule can correct mutations on both alleles, regardless of the location of the mutation within the ABCA4 gene. For example, for an individual having a mutated ABCA4 exon 2 on the first allele and a mutated ABCA4 exon 9 on the second allele, a single 5′ trans-splicing molecule (5′ RNA editing molecule) encoding exons 1-22 can be used to replace the mutated ABCA4 exon 2 and the mutated ABCA4 exon 9. See, e.g. Fig.14A Thus, in some embodiments, where two or more mutations are located in a portion of the ABCA4 gene that can be replaced by the same trans-splicing molecule spanning the two or more mutations, a single trans-splicing molecule having a coding region containing a functional ABCA4 exon can replace one or more exons containing the mutations.

[0149] Alternatively, in some embodiments, the individual has an ABCA4 mutation that involves a mutation in a distant exon within the ABCA4 gene. For example, where the individual has a mutated ABCA4 exon 2 on a first allele and a mutated ABCA4 exon 49 on a second allele, two RNA editing molecules can be used in combination (e.g., in a composition) to replace each mutated exon. Such an approach would involve using a 5′ trans-splicing molecule to replace the mutated ABCA4 exon 2 and using a 3′ trans-splicing molecule to replace the mutated ABCA4 exon 49. In such embodiments, the two trans-splicing molecules can be co-delivered as part of the same AAV vector or delivered in separate AAV vectors (e.g., where both trans-splicing molecules exceed the packaging limit of the AAV).

[0150] Coding domain sequence

[0151] In some embodiments, the CDS of the 5' trans-splicing molecule includes all ABCA4 exons (e.g., functional ABCA4 exons) 5' to the target ABCA4 intron (e.g., ABCA4 intron 22). For example, in embodiments where the 5' trans-splicing molecule targets ABCA4 intron 22, the CDS may include functional ABCA4 exons 1-22. In such embodiments, the length of the CDS may be 2,000 to 4,500 bp. In some cases, both allelic mutations occur in the 5' portion of the target gene, and the 5' trans-splicing molecule is selected to correct both mutations. In one embodiment, the binding domain binds to intron 22, and the CDS includes functional ABCA4 exons 1-22.

[0152] In some embodiments, the CDS (e.g., of a transgene encoding RTM) includes cDNAs of ABCA4 exons (e.g., functional ABCA4 exons) to replace mutated ABCA4 exons. For example, one or more functional ABCA4 exons within the CDS can be a cDNA sequence. In some embodiments, the entire CDS is a cDNA sequence. Additionally or alternatively, all or a portion of the CDS, or one or more functional ABCA4 exons thereof, can be a naturally occurring sequence (e.g., a sequence having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an endogenous ABCA4 exon).

[0153] In some embodiments, all or part of the CDS, or one or more functional ABCA4 exons thereof, is a codon-optimized sequence, wherein the nucleic acid sequence has been modified, for example, to enhance expression or stability, without causing a change in the encoded amino acid. Codon optimization can be performed, for example, as described in U.S. Patent Nos. 7,561,972, 7,561,973, and 7,888,112, each of which is incorporated herein by reference in its entirety. For delivery by recombinant AAV as described herein, in one embodiment, the CDS can be a nucleic acid sequence of up to 4,000 nucleotide bases in length (e.g., 3,000 to 4,000 nucleotide bases in length, 3,100 to 3,800 nucleotide bases in length, 3,200 to 3,700 nucleotide bases in length or 3,300 to 3,500 nucleotide bases in length, such as 3,000 to 3,100 nucleotide bases in length, 3,100 to 3,200 nucleotide bases in length, 3,200 to 3,300 nucleotide bases in length, 3,300 to 3,400 nucleotide bases in length, 3,400 to 3,500 nucleotide bases in length, 3,500 to 3,600 nucleotide bases in length). ,600 nucleotide bases in length, 3,600 to 3,700 nucleotide bases in length, 3,700 to 3,800 nucleotide bases in length, 3,800 to 3,900 nucleotide bases in length or 3,900 to 4,000 nucleotide bases in length, such as about 3,108 nucleotide bases in length, about 3,285 nucleotide bases in length, about 3,375 nucleotide bases in length, about 3,503 nucleotide bases in length, about 3,630 nucleotide bases in length, about 3,540 nucleotide bases in length, about 3,363 nucleotide bases in length, about 3,273 nucleotide bases in length, about 3,145 nucleotide bases in length or about 3,018 nucleotide bases in length).

[0154] In some embodiments, all or part of the CDS, or one or more functional ABCA4 exons thereof, is modified to mutate a cryptic splice site identified therein. The inventors have discovered through extensive experimental and computational analysis that cryptic splice sites are used in the context of some embodiments of the ABCA4 exon editors described herein. Briefly, the inventors conducted a large number of experiments and analyses, including the generation of off-target (OFT) libraries and their bioinformatic analysis, and unexpectedly discovered a large number of positions where cryptic splicing occurs within the ABCA4 coding sequence (CDS) comprising exons 1-22 in the context of the trans-splicing molecules described herein. This discovery reveals a previously unappreciated problem, namely that RNA exon editors (also referred to herein as RNA trans-splicing molecules or nucleic acid trans-splicing molecules) can splice at cryptic splice sites, which may result in unwanted splice variant species with potential downstream effects. In order to improve the trans-splicing efficiency and fidelity of the trans-splicing molecules described herein, thereby providing a solution to the problem of cryptic splicing site utilization, the sequences of multiple cryptic splicing sites are modified by introducing synonymous mutations to damage and / or disable the cryptic splicing sites. In some embodiments, the modified cryptic splicing sites are identified based on the number of times the cryptic splicing sites are utilized as detected by bioinformatics analysis of the OFT library. In some embodiments, the modified cryptic splicing sites account for multiple cryptic splicing site events. This approach takes advantage of the degeneracy of the genetic code, allowing the introduction of desired modifications to reduce the use of cryptic splicing sites without causing changes in the encoded amino acids. See, for example, Table 6 and Fig.26 .

[0155] Using next generation sequencing (NGS) methods, the inventors were able to identify cryptic splice sites and quantify the frequency of cryptic splice usage at each different position within the ABCA4 CDS, including exons 1-22, thereby establishing a data-driven strategy to prioritize the reduction of cryptic splice usage therein. See Table 3 and Fig.26 As shown in Table 3, the identified cryptic splice sites are ranked in order of frequency of use, as determined by the average counts per million mapped / merged reads (CPM) in the sequence excluding synonymous mutations that disrupt the cryptic splice site. Thus, the results and their bioinformatic analysis establish a prioritized list of cryptic splice sites in ABCA4 exons 1-22 that can be modified to generate ABCA4 CDSs with improved properties and functionality in the context of trans-splicing molecules.

[0156] Based on the results presented herein, the inventors have established a frequency threshold, above which the analysis and design of reducing cryptic splice sites by introducing synonymous mutations can be advantageously performed. See Table 6. In some embodiments, the threshold based on the results presented in Table 3 is equal to or greater than 10 CPM.

[0157] NGS methods were also implemented to assess the frequency of cryptic splicing usage after the introduction of synonymous mutations. See Tables 3 and Fig.26 The identification of a reduction in cryptic splice sites by this approach links the structural changes in sequence modification (synonymous mutations) to the function conferred thereby, namely the generation of a cryptic splice site-resistant ABCA4 CDS.

[0158] In some embodiments, the RNA exon editor molecule (e.g., an ABCA4 exon editor) has nucleotide changes that reduce cryptic splice sites at one or more sites associated with off-target splicing within the exon editor molecule. Any or all of the altered nucleotide positions may be located at the positions identified in Table 3. In some embodiments, the ABCA4 exon editor has nucleotide changes at one or more of the following positions (numbered according to, for example, SEQ ID NO: 56), wherein the nucleotide positions indicated below refer to the 5′ and 3′ ends of the cryptic splice site nucleotide sequence that is reduced relative to the G (translation start site) of the ATG codon, or any combination thereof. In the sequences listed below, the nucleotide changes made are underlined. See also Table 3:

[0159] Sequence spanning nucleotide positions 3066-3086:

[0160] ACATGCTGTTCTATGCCCA G (SEQ ID NO: 91)

[0161] ACATGCTGTTCTATGCACA A (SEQ ID NO: 92)

[0162] Sequence spanning nucleotide positions 2911-2931:

[0163] CACCTTGTCCATCCTCAC A G (SEQ D NO: 93)

[0164] CACCTTGTCCATCCTCAC T G (SEQ ID NO: 94)

[0165] Sequence spanning nucleotide positions 2556-2576:

[0166] TCGCTTGGTACCTTGATCA G (SEQ ID NO: 95)

[0167] TCGCTTGGTACCTTGATCA A (SEQ ID NO: 96)

[0168] Sequence spanning nucleotide positions 3009-3029 (splice site corrected):

[0169] GCCTTGGCATGTGTCCACAG (SEQ ID NO: 97)

[0170] CCCTTGGCATGTGTCCACAA (SEQ ID NO: 98)

[0171] Sequence spanning nucleotide positions 107-127:

[0172] CTGGTCTTGATCTGGTTA A G (SEQ ID NO: 99)

[0173] CTGGTCTTGATCTGGTTA C G (SEQ ID NO: 100)

[0174] Sequence spanning nucleotide positions 2328-2348:

[0175] TCCTGTGCTTCGCCTGGCA G (SEQ ID NO: 101)

[0176] TCCTGTGCTTCGCCTGGCAA (SEQ ID NO: 102)

[0177] Sequence spanning nucleotide positions 1815-1835:

[0178] GCGGGTTTGC C TATCTGCA G (SEQ ID NO: 103)

[0179] GCGGGGTTTGC A TATCTGCA A (SEQ ID NO: 104)

[0180] Sequence spanning nucleotide positions 1198-1218:

[0181] CACTCCTGATTCACCTGCAG (SEQ ID NO: 105)

[0182] CACTCCTGATTCACCTGCTG (SEQ ID NO: 106)

[0183] Sequence spanning nucleotide positions 3063-3083 [the nucleotide changes indicated below were caused by changes made in the context of position 3086 (close to position 3083) and did not correct the splice site, polypyrimidine tract and / or branch point at position 3083]:

[0184] AGCACATGCTGTTCTATGGC (SEQ ID NO: 107)

[0185] AGCACATGCTGTTCTATGC A (SEQ ID NO: 108)

[0186] Sequence spanning nucleotide positions 2090-2110:

[0187] TGTACCTGGTTCCTGCAC AG (SEQ ID NO: 109)

[0188] TGTACCTGGTTCCTGGAC TC (SEQ ID NO: 110)

[0189] The last nucleotide listed below corresponds to positions 2608-2628 (branch point corrected):

[0190] TTGGTACTTTCTTCT A CAAG (SEQ ID NO: 111)

[0191] TTGGTACTTTCTTCT G CAAG (SEQ ID NO: 112)

[0192] Sequence spanning nucleotide positions 3083-3103 [the nucleotide changes indicated below were caused by changes made in the context of position 3086 (near position 3103) and did not correct the splice site, polypyrimidine tract and / or branch point at position 3103]:

[0193] CA G CTGAAAGGAAAGTCCCA (SEQ ID NO: 113)

[0194] CAACTGAAAGGAAAGTCCCA (SEQ ID NO: 114)

[0195] Sequence spanning nucleotide positions 3073-3093 [the nucleotide changes indicated below were caused by changes made in the context of position 3086 (near position 3093) and did not correct the splice site, polypyrimidine tract and / or branch point at position 3093]:

[0196] GTTCTATGCCCAGCTGAAAG (SEQ ID NO: 115)

[0197] GTTCTATGCACAACTGAAAG (SEQ ID NO: 116)

[0198] Sequence spanning nucleotide positions 681-701 (splice site corrected):

[0199] CCCTGTGCTCCCTCTCCCAG (SEQ ID NO: 117)

[0200] CCCTGTGCTCCCTCTCCCAA (SEQ ID NO: 118)

[0201] Sequence spanning nucleotide positions 508-528:

[0202] CATCGGCCTGTCTGACTC A G (SEQ ID NO: 119)

[0203] CATCGGCCTGTCTGACTC T G (SEQ ID NO: 120)

[0204] Sequence spanning nucleotide positions 1431-1451 (branch points corrected):

[0205] TCCT A AACTTCCTCTACAAG (SEQ ID NO: 121)

[0206] TCCT G AACTTCCTCTACAAG (SEQ ID NO: 122)

[0207] Sequence spanning nucleotide positions 1995-2015 (splice site corrected):

[0208] CTGTCTCCATGACTGT G AA G (SEQ ID NO: 123)

[0209] CTGTCTCCATGACTGT A AAA (SEQ ID NO: 124)

[0210] Sequence spanning nucleotide positions 3159-3179 (can be corrected with non-synonymous mutations):

[0211] AGCGGAATGAAGAGGCTCAG (SEQ ID NO: 125)

[0212] AGCGGAATGAAGAGGCTCAG (SEQ ID NO: 125)

[0213] Sequence spanning nucleotide positions 2234-2254 (splice site corrected):

[0214] ATGCTGTGCTTTCTGCTC AG (SEQ ID NO: 126)

[0215] ATGCTGTGCTTTCTGCTC TC (SEQ ID NO: 127)

[0216] Sequence spanning nucleotide positions 1104-1124 (splice sites, branch points corrected):

[0217] TTTGTAATGC A TTGAT C CA G (SEQ ID NO: 128)

[0218] TTTGTAATGC C TTGAT A CA A (SEQ ID NO: 129)

[0219] Sequence spanning nucleotide positions 1887-1907 (splice site corrected):

[0220] TTGGAATCTACCICCA G CA G (SEQ ID NO: 130)

[0221] TTGGAATCTACCTCCA A CA A (SEQ ID NO: 131)

[0222] However, the skilled practitioner will recognize that other nucleotide changes can be made to disrupt the identified cryptic splice sites, and will be able to envision and design such changes based on the results presented herein. In some embodiments, the ABCA4 exon editor has one or more nucleotide changes at the above positions. See also Table 3. In some embodiments, the ABCA4 exon editor has a CDS sequence that has at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity or 100% sequence identity to any one of the sequences shown in SEQ ID NOs: 56-59. In some embodiments, the ABCA4 exon editor has a nucleotide change that reduces a cryptic splice site at one or more of the above positions (numbered according to, for example, SEQ ID NO: 56) and has a CDS sequence that has at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity, or has 100% sequence identity to any one of the sequences shown in SEQ ID NOs: 56-58. In some embodiments, the ABCA4 exon editor has a nucleotide change that reduces a cryptic splice site at one or more of the above positions (numbered according to, for example, SEQ ID NO: 56) and has at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% sequence identity, or has 100% sequence identity to the sequence shown in SEQ ID NO: 56. In some embodiments, the ABCA4 exon editor has a nucleotide change that reduces a cryptic splice site at at least one of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, or 45 positions set forth in Table 3.

[0223] In some embodiments, an ABCA4 exon editor has a nucleotide change that reduces a cryptic splice site at at least one of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 positions set forth in Table 3 at a splice site usage frequency of at least 10 counts per million (also known as CPM), except for those positions listed in Table 3 that do not include splice sites (e.g., position 3083, 3103, or 3093). In some embodiments, the ABCA4 exon editor molecule has a nucleotide change that reduces cryptic splice sites at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 or all cryptic splice sites [except those sites listed in Table 3 that do not include splice sites (e.g., position 3083, 3103, or 3093)] with a usage frequency of at least 10 cpm as measured by the assay described in Example 7 below.

[0224] In some embodiments, an ABCA4 exon editor has a nucleotide change that reduces a cryptic splice site at at least one of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 positions set forth in Table 3 with a splice site usage frequency of at least 5 counts per million (also known as CPM), except for those positions listed in Table 3 that do not include splice sites (e.g., position 3083, 3103, or 3093). In some embodiments, the ABCA4 exon editor molecule has a nucleotide change that reduces cryptic splice sites at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 or all cryptic splice sites [except those sites listed in Table 3 that do not include splice sites (e.g., position 3083, 3103, or 3093)] with a usage frequency of at least 5 cpm as measured by the assay described in Example 7 below.

[0225] In some embodiments, the ABCA4 exon editor has a nucleotide change that reduces a cryptic splice site at at least one of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 positions set forth in Table 3 with a splice site usage frequency of at least 3 counts per million (also known as CPM), except for those positions listed in Table 3 that do not include splice sites (e.g., position 3083, 3103, or 3093). In some embodiments, the ABCA4 exon editor molecule has a nucleotide change that reduces cryptic splice sites at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 or all cryptic splice sites [except those sites listed in Table 3 that do not include splice sites (e.g., position 3083, 3103, or 3093)] with a usage frequency of at least 3 cpm as measured by the assay described in Example 7 below.

[0226] In some embodiments, an ABCA4 exon editor has a nucleotide change that reduces a cryptic splice site at at least one of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 positions set forth in Table 3 with a splice site usage frequency of at least 2 counts per million (also known as CPM), except for those positions listed in Table 3 that do not include splice sites (e.g., position 3083, 3103, or 3093). In some embodiments, the ABCA4 exon editor molecule has a nucleotide change that reduces cryptic splice sites at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 or all cryptic splice sites [except those sites listed in Table 3 that do not include splice sites (e.g., position 3083, 3103, or 3093)] with a usage frequency of at least 2 cpm as measured by the assay described in Example 7 below.

[0227] In some embodiments, an ABCA4 exon editor has a nucleotide change that reduces a cryptic splice site at at least one of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 positions set forth in Table 3 with a splice site usage frequency of at least 1 count / million (also known as CPM), except for those positions listed in Table 3 that do not include splice sites (e.g., position 3083, 3103, or 3093). In some embodiments, the ABCA4 exon editor molecule has a nucleotide change that reduces cryptic splice sites at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 or all cryptic splice sites [except those sites listed in Table 3 that do not include splice sites (e.g., position 3083, 3103, or 3093)] with a usage frequency of at least 1 cpm as measured by the assay described in Example 7 below.

[0228] In addition to the ABCA4 exon editor, the embodiments described herein also include exon editors with nucleotide changes that reduce cryptic splice sites that are specific for other gene targets. Nucleotide changes that reduce cryptic splice sites can include changes that eliminate or reduce the ability of cryptic splice sites to be used in splicing reactions. For example, cryptic splice sites identified in the context of RNA exon editors typically include splice sites, polypyrimidine regions, and branch points. In some embodiments, one or more nucleotide changes can be introduced into at least one of the splice sites, polypyrimidine regions, or branch points of the cryptic splice sites identified in the context of RNA exon editors, or any combination thereof. In some embodiments, nucleotide changes are determined to minimize the potential impact on the protein encoded by them. Those skilled in the art will understand that if the nucleotide changes made to reduce the frequency of use of cryptic splice sites also change the amino acids encoded by trans-splicing RNA, conservative amino acid changes will be better than non-conservative amino acid changes. In addition, such technicians can easily analyze protein sequences and structures, focusing on the functional domains and important sequences therein to assess whether such changes can be reasonably expected to change the function of the protein encoded by the trans-splicing protein. Those skilled in the art can also test proteins containing such amino acid changes using assays known in the art to determine whether biological activity has changed. In some embodiments, more than one nucleotide changes within the identified hidden splicing site. In some cases, it is empirically determined how many nucleotides should be changed based on computer predictions and / or experimental results. In some embodiments, one or more (also referred to herein as at least one) synonymous mutations may be introduced into at least one of the splicing sites, polypyrimidine regions, or branch points of the hidden splicing sites identified in the context of the RNA exon editor, or any combination thereof. Synonymous mutations do not change the amino acid sequence of the protein encoded by the trans-splicing RNA. In some embodiments, more than one synonymous mutation may be introduced into at least one of the splicing sites, polypyrimidine regions, or branch points of the hidden splicing sites identified in the context of the RNA exon editor, or any combination thereof.

[0229] In addition to the above, the inventors have carried out the following analysis to the experimental results and sequence information.By searching and replacing certain elements of the splicing donor site, changes are made to remove the hidden splicing sites found in the experiment.For introducing nucleotide changes, the AG site (and the stronger CAG site) at the end of the splicing donor site is preferred.If the AG site is not found or the site cannot be changed without introducing non-synonymous mutations, the sequence of 42-44 base pairs upstream of the splicing site is scanned to find the branch point (sequences matched with YNAH).Then analyze any such branch point sequence identified and consider the use of the hidden splicing site at the hidden splicing site identified in the experiment for introducing nucleotide mutations.In addition, the sequence is also scanned for the presence of a polypyrimidine region (multiple Ys close to the upstream of the terminal AG).Typically, this polypyrimidine region includes at least 5 pyrimidines located within 10 base pairs upstream of the splicing site.Once identified, then analyze this type of polypyrimidine region and consider the use of the hidden splicing site at the hidden splicing site identified in the experiment for introducing nucleotide mutations.

[0230] In some embodiments, the cryptic splice site or off-target splice site that is altered to reduce off-target splicing is a site that has been empirically identified as an off-target splice site. For example, such sites can be identified using the techniques described in Examples 6 and 7 below. In some embodiments, all cryptic splice sites with a usage frequency above a predetermined threshold are altered by nucleotide changes that reduce cryptic splice sites.

[0231] In some embodiments, the cryptic splice site or off-target splice site that is changed to reduce off-target splicing is a site that has been predicted to be an off-target splice site. Such predictions can be made based on sequence analysis to identify typical splice sites, polypyrimidine regions and / or branch points of the cryptic splice sites inferred therein. In the human genome, the number of cryptic splice sites is one order of magnitude more than the true splice sites, and may have the same splice recognition sequence as the true splice site, but is generally inhibited by a molecular mechanism that is not yet understood. Cryptic 5′ splice sites generally have a common NNN / GUNNNN or NNN / GCNNNN, where N is an arbitrary nucleotide, and “ / ” is an exon-intron boundary. Cryptic 3′ splice sites generally have a common NAG / N. Activation of cryptic splice sites is positively influenced by surrounding nucleotides that may make the cryptic splice site look more like the typical consensus sequences of true splice sites, namely MAG / GURAGU and YAG / G, respectively, where M is C or A, R is G or A, and Y is C or U.

[0232] In some embodiments, the nucleotide changes that reduce the hidden splice site cause the nucleotide sequence that matches the typical splice site consensus sequence to no longer match the typical sequence. In some embodiments, the nucleotide changes that reduce the hidden splice site eliminate potential splice site nucleotides. In some embodiments, the nucleotide changes that reduce the hidden splice site eliminate potential polypyrimidine region nucleotides. In some embodiments, the nucleotide changes that reduce the hidden splice site eliminate potential branch point nucleotides. In some embodiments, the nucleotide changes that reduce the hidden splice site are synonymous nucleotide changes. In some embodiments, the nucleotide changes that reduce the hidden splice site cause the amino acid encoded by the exon editor to change. In some embodiments, the amino acid changes are conservative amino acid substitutions.

[0233] As described in, for example, Table 3 and Examples 6 and 7, the inventors experimentally observed the use of cryptic splice sites in the RNA exon editors described herein. Further analysis of the located / identified cryptic splice sites can identify putative splice sites, polypyrimidine tracts, and branch points within the cryptic splice sites identified in the experiment, which in turn provides guidance on which sequences should be modified to reduce cryptic splice site engagement. These results are broadly applicable to RNA exon editors in general.

[0234] In some embodiments, described herein is an RNA molecule comprising in the 5' to 3' direction: (a) a cDNA coding domain sequence; (b) a splicing donor sequence; and (c) a binding domain sequence, wherein the binding domain sequence is configured to bind to an intron of an endogenous RNA molecule; wherein the coding domain sequence comprises a nucleotide mutation relative to the endogenous RNA molecule sequence, wherein the nucleotide mutation destroys a cryptic splicing site within the coding domain sequence. In some embodiments, the nucleotide mutation is a synonymous nucleotide mutation. In some embodiments, the cryptic splicing site is experimentally identified. In some embodiments, the cryptic splicing site is predicted based on computer analysis.

[0235] Also contemplated herein is a method for modifying an RNA molecule in a cell, the method comprising providing an exogenous RNA molecule to the cell, the exogenous RNA molecule comprising in the 5' to 3' direction: (a) a cDNA coding domain sequence, the cDNA coding domain sequence comprising a nucleotide mutation different from an endogenous target RNA molecule in the cell; (b) a splicing donor sequence, the splicing donor sequence being configured to splice to a splicing acceptor sequence of an endogenous target RNA molecule; and (c) a binding domain sequence, the binding domain sequence being configured to bind to an intron of an endogenous target RNA molecule; wherein the nucleotide mutation destroys a cryptic splicing site within the coding domain sequence of the exogenous RNA molecule. In some embodiments, the nucleotide mutation is a synonymous nucleotide mutation. In some embodiments, the cryptic splicing site is experimentally identified. In some embodiments, the cryptic splicing site is predicted based on computer analysis.

[0236] Also contemplated herein is a method for increasing the trans-splicing efficiency of an RNA exon editor, the method comprising introducing a mutation into the coding domain sequence of the RNA exon editor, wherein the mutation destroys a cryptic splicing site in the coding domain sequence of the RNA exon editor. In some embodiments, the nucleotide mutation is a synonymous nucleotide mutation. See, for example, Table 6. In some embodiments, the cryptic splicing site is experimentally identified. In some embodiments, the cryptic splicing site is predicted based on computer analysis.

[0237] Binding domain

[0238] The ABCA4 trans-splicing molecules described herein feature a binding domain (BD) that is configured to bind / anneal to a target ABCA4 intron and / or exon. In some cases, the target ABCA4 intron is ABCA4 intron 22. In one embodiment, the binding domain is a nucleic acid sequence that is at least 80% complementary (e.g., at least 85% complementary, at least 90% complementary, at least 91% complementary, at least 92% complementary, at least 93% complementary, at least 94% complementary, at least 95% complementary, at least 96% complementary, at least 97% complementary, at least 98% complementary, at least 99% complementary, or 100% complementary) to a sequence of a target ABCA4 mRNA precursor intron (e.g., a target ABCA4 intron) that can inhibit endogenous target cis-splicing while enhancing trans-splicing between a trans-splicing molecule and the target ABCA4 mRNA precursor (e.g., by creating a chimeric molecule having a portion of an endogenous ABCA4 mRNA and a coding domain sequence having one or more functional ABCA4 exons that encodes a wild-type ABCA4 amino acid sequence). In one embodiment involving a trans-splicing molecule encoding sequence (e.g., a vector encoding a trans-splicing molecule), the binding domain encoding sequence encodes a nucleic acid sequence that is at least 80% complementary (e.g., at least 85% complementary, at least 86% complementary, at least 87% complementary, at least 88% complementary, at least 89% complementary, at least 90% complementary, at least 91% complementary, at least 92% complementary, at least 93% complementary, at least 94% complementary, at least 95% complementary, at least 96% complementary, at least 97% complementary, at least 98% complementary, at least 99% complementary, or 100% complementary) to a sequence in an intron of a target ABCA4 mRNA precursor.

[0239] In some cases, the present invention provides a trans-splicing molecule (or a vector thereof) that binds ABCA4 at intron 22, for example, wherein the nucleic acid trans-splicing molecule is configured to trans-splice the CDS to endogenous ABCA4 exon 23. Specifically, the trans-splicing molecules described herein include trans-splicing molecules wherein the binding domain binds to a binding site having any one or more (e.g., six or more, eight or more, ten or more, or twelve or more) nucleotides of nucleotides 1 to 510 or 880 to 1,350 of SEQ ID NO: 16.

[0240] In some cases, the binding domain includes any six or more consecutive nucleotides within nucleotides 1 to 510 or 880 to 1,350 of intron 22 of ABCA4 (e.g., any eight or more consecutive nucleotides within nucleotides 1 to 510 or 880 to 1,350 of intron 22 of ABCA4, any ten or more consecutive nucleotides within nucleotides 1 to 510 or 880 to 1,350 of intron 22 of ABCA4, any 12 or more consecutive nucleotides within nucleotides 1 to 510 or 880 to 1,350 of intron 22 of ABCA4, any 20 or more consecutive nucleotides within nucleotides 1 to 510 or 880 to 1,350 of intron 22 of ABCA4, any 30 or more consecutive nucleotides within nucleotides 1 to 510 or 880 to 1,350 of intron 22 of ABCA4 a plurality of consecutive nucleic acids, any 40 or more consecutive nucleic acids within nucleotides 1 to 510 or 880 to 1,350 of intron 22 of ABCA4, any 50 or more consecutive nucleic acids within nucleotides 1 to 510 or 880 to 1,350 of intron 22 of ABCA4, any 100 or more consecutive nucleic acids within nucleotides 1 to 510 or 880 to 1,350 of intron 22 of ABCA4, any 150 or more consecutive nucleic acids within nucleotides 1 to 510 or 880 to 1,350 of intron 22 of ABCA4, any 200 or more consecutive nucleic acids within nucleotides 1 to 510 or 880 to 1,350 of intron 22 of ABCA4, or any 250 or more consecutive nucleic acids within nucleotides 1 to 510 or 880 to 1,350 of intron 22 of ABCA4).

[0241] In some cases, the binding site includes any six or more consecutive nucleotides within nucleotides 880 to 1,350 of intron 22 of ABCA4 (e.g., any eight or more consecutive nucleic acids within nucleotides 880 to 1,350 of intron 22 of ABCA4, any ten or more consecutive nucleic acids within nucleotides 880 to 1,350 of intron 22 of ABCA4, any 12 or more consecutive nucleic acids within nucleotides 880 to 1,350 of intron 22 of ABCA4, any 20 or more consecutive nucleic acids within nucleotides 880 to 1,350 of intron 22 of ABCA4, any 30 or more consecutive nucleic acids within nucleotides 880 to 1,350 of intron 22 of ABCA4, any 40 or more consecutive nucleic acids within nucleotides 880 to 1,350 of intron 22 of BCA4, any 50 or more consecutive nucleic acids within nucleotides 880 to 1,350 of intron 22 of ABCA4, any 100 or more consecutive nucleic acids within nucleotides 880 to 1,350 of intron 22 of ABCA4, any 150 or more consecutive nucleic acids within nucleotides 880 to 1,350 of intron 22 of ABCA4, any 200 or more consecutive nucleic acids within nucleotides 1 to 510 or 880 to 1,350 of intron 22 of ABCA4, or any 250 or more consecutive nucleic acids within nucleotides 1 to 510 or 880 to 1,350 of intron 22 of ABCA4).

[0242] In some cases, the binding domain has at least two non-overlapping sequences that have at least 80% complementarity to the binding site.

[0243] In some cases, the binding domain comprises a polypeptide that is nucleotide-binding to UUGUUGGUAAAGGGUGUACAGCAAUUUCCUGGCUAUAUAGUUGCAAAAAUCAGGAGUUAACUAAAAAAAAAAACCCAAGGGAACUAAUUCAGCAGCAAA UUCCAGCAUAUUGGGACAAUAAUAACCAACAUUUCAUAGCUUCCUACAUAC (SEQ ID NO:17) has at least 80% identity (e.g., at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identity; for example, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity) to the nucleic acid sequence.

[0244] In some embodiments, the binding domain is a polypeptide that is SEQ ID NO: 18TTGTTGGTAAAGGGTGTACAGCAATTTCCTGGCTATATAGTTGCAAAAATCAGGAGTTAACTAAAAAAAAAAACCCAAGGGAACTAATTCAGCAGCAAATTCCAGCATATTGGGACAATAATAACCAACATTTCATAGCTTCCTACATAC (SEQ ID NO: 18TTGTTGGTAAAGGGTGTACAGCAATTTCCTGGCTATATAGTTGCAAAAATCAGGAGTTAACTAAAAAAAAAAACCCAAGGGAACTAATTCAGCAGCAAATTCCAGCATATTGGGACAATAATAACCAACATTTCATAGCTTCCTACATAC (SEQ ID NO:18) has at least 80% identity (e.g., at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identity; for example, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity) to a DNA sequence.

[0245] In some cases, the binding domain comprises a nucleic acid sequence that is at least 80% identical (at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical; e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical) to SEQ ID NO:19.

[0246] In some embodiments, the binding domain is a DNA sequence that is at least 80% identical (e.g., at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical; e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical) to SEQ D NO:20.

[0247] In some cases, the binding domain comprises a nucleic acid sequence that is at least 80% identical (at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical; e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical) to SEQ ID NO:21.

[0248] In some embodiments, the binding domain is a DNA sequence that is at least 80% identical (e.g., at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical; e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical) to SEQ ID NO:22.

[0249] In some cases, the binding domain comprises a nucleic acid sequence that is at least 80% identical (e.g., at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical; e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical) to SEQ ID NO:23.

[0250] In some embodiments, the binding domain is a DNA sequence that is at least 80% identical (e.g., at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical; e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical) to SEQ ID NO:24.

[0251] The binding domain can be operably linked 3' to the splicing domain (eg, directly to the splicing domain or with an intervening sequence linking the 3' end of the splicing domain and the 5' end of the binding domain).

[0252] As described in detail herein, the first stage of the design of the ABCA4 exon editor began with the screening and selection of efficient BD sequences that are complementary to the targeted mRNA precursor intron. In order to achieve high CDS replacement potential and provide an exon editor that can be used to correct mutations in a high percentage of ABCA4-related retinopathy patient populations within the constraints of AAV packaging capacity (approximately 4.7 Kb), intron 22 of the ABCA4 gene was selected for BD screening. The inventors applied an NGS-based BD library method and a bioluminescence-based method to scan along the intron 22 sequence with exon editor variants with different BD sequences. The results of the two methods were compared and the region within the intron suitable for RNA exon editing was successfully identified, thereby selecting BD117 in some embodiments. See. Fig.16 .

[0253] Splicing domain

[0254] The splicing domain may include a splicing site, a branch point, and / or a polypyrimidine tract (PPT) to mediate trans-splicing. In some embodiments, the splicing domain has a single splicing site, indicating that the splicing site is designed to preferentially perform trans-splicing rather than cis-splicing due to the lack of a corresponding splicing site.

[0255] Those skilled in the art can select alternative splicing domains according to known methods and principles. In one embodiment, the 5' splice site consensus sequence is the nucleic acid sequence AG / GURAGU (wherein / represents a splice site). In another embodiment, endogenous splice sites corresponding to exons and introns proximal to the splice site can be used to maintain any splicing regulatory signals.

[0256] In one embodiment, a suitable 5' splice site with a spacer is: 5'-GTAAGA GAG CTC GTTGCG ATA TTA T-3' (SEQ ID NO: 25). In one embodiment, a suitable 5' splice site is AGGT. In some embodiments, the splice site (e.g., 5' splice site) is or comprises GTAAGT or GUAAGT. In some embodiments, the splice site (e.g., 5' splice site) is or comprises GTAAGG, GUAAGG, GTAAGC, GUAAGC, GTAACT, GUAACU, CAAAGT, or CAAAGU.

[0257] The splice domain can be operably linked 5' to the terminator domain (e.g., directly linked to the terminator domain, or with an intervening sequence linking the 3' end of the splice domain and the 5' end of the terminator domain, such as a linker domain and / or 3' downstream sequences).

[0258] 5′ untranslated region

[0259] In some cases, the nucleic acid trans-splicing molecule includes a 5' untranslated region. In some embodiments, the 5' untranslated region comprises, consists essentially of, or consists of a native 5' ABCA4 untranslated region. In some embodiments, the 5' untranslated region comprises a sequence having at least 80% sequence identity (e.g., at least 85% sequence identity, at least 86% sequence identity, at least 87% sequence identity, at least 88% sequence identity, at least 89% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity) with any one of SEQ ID NOs: 12-13.

[0260] In some embodiments, the 5' untranslated region can be operably linked 5' to the CDS (eg, directly linked to the CDS or with an intervening sequence linking the 3' end of the 5' untranslated region and the 5' end of the CDS).

[0261] 5′ regulatory domain

[0262] In some cases, the nucleic acid trans-splicing molecule is operably linked to a 5' regulatory domain that is operably linked to the CDS at 5' (e.g., directly linked to the CDS, or linked through an intermediate domain, such as an untranslated region). The 5' regulatory domain can include a promoter (e.g., a constitutive promoter, such as a CMV promoter or an EF1-α promoter). In some cases, the 5' regulatory domain includes a promoter (e.g., a constitutive promoter, such as a CMV promoter) operably linked to the native 5' ABCA4 untranslated region. In some embodiments, the 5' regulatory domain operably linked to the native 5' ABCA4 untranslated region comprises a sequence having at least 80% sequence identity (e.g., at least 85% sequence identity, at least 86% sequence identity, at least 87% sequence identity, at least 88% sequence identity, at least 89% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity) to any one of SEQ ID Nos: 14-15.

[0263] In some embodiments, the 5' regulatory domain can be operably linked 5' to the CDS (eg, directly linked to the CDS or with an intervening sequence linking the 3' end of the 5' regulatory domain and the 5' end of the CDS).

[0264] Linker domain

[0265] As discussed herein, improving trans-splicing efficiency remains an important goal for using nucleic acid trans-splicing molecules as therapeutic agents. In order to design nucleic acid trans-splicing molecules with trans-splicing efficiencies that meet the requirements for their use in therapeutic interventions, the inventors tested thousands of linker sequences between the splicing domain (SD) and the binding domain (BD) and identified an exemplary linker, referred to as 40-mer, whose performance was statistically significantly improved relative to the precursor linker (LinkD). See, e.g. Fig.17A and 17B .

[0266] In addition to the foregoing, nucleic acid trans-splicing molecules may include a joint domain at one or more positions of the molecule. In some embodiments, the joint domain is operably connected to the splicing domain or splicing site at 3' (e.g., directly connected to the splicing domain or splicing site). The joint domain can be any suitable size. In some embodiments, the joint domain length exceeds 25 nucleotides (e.g., a length between 25 and 50 nucleotides, a length between 35 and 45 nucleotides, or a length of about 40 nucleotides (e.g., a 40-mer joint)). In some cases, the linker domain comprises, consists essentially of, or consists of a nucleic acid sequence that is at least 80% identical (e.g., at least 85% sequence identity, at least 86% sequence identity, at least 87% sequence identity, at least 88% sequence identity, at least 89% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity) to CUGGUGCCCGCGGGCCGCGGAACCGGUUGGGGGCAUGUAC (SEQ ID NO:26) or CTGGTGCCCGCGGGCCGCGGAACCGGTTGGGGGCATGTAC (SEQ ID NO:27).

[0267] As described above, a 40-mer linker comprising SEQ ID NO: 26 (RNA) or SEQ ID NO: 27 (DNA) was selected from a library screen in which thousands of different elements were evaluated for function in the context of trans-splicing molecules. For example, Figure 1 The superiority of the 40-mer linker was evident from a comparison of three different linkers in the context of different element combinations. In each context, the presence of the 40-mer linker (denoted as the linker corresponding to the lightest grayscale tone; the third linker represented from left to right in the context of each ss) was associated with the highest relative trans-splicing efficiency. The linker sequence is typically included in trans-splicing molecules, where it is located between the splice donor and the binding domain, providing flexibility and accessibility to each element. As described herein, in different combinations, the functional contributions of different elements are evaluated for the activity conferred in the context of trans-splicing molecules. In this screen, the 40-mer linker emerged as a leading candidate element that conferred improved trans-splicing activity in the context of trans-splicing molecules, as evidenced by a statistically significant increase in the % on-target (ONT) substitutions of ABCA4 RNA relative to LinkD ( Fig.17A ) and the level of trans-splicing ABCA4 protein (ONT) was significantly increased and the level of non-splicing protein (NSP) was significantly decreased ( Fig. 17B ) is proved.

[0268] In other cases, the linker domain comprises, consists essentially of, or consists of a nucleic acid sequence having at least 80% identity (e.g., at least 85% sequence identity, at least 86% sequence identity, at least 87% sequence identity, at least 88% sequence identity, at least 89% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity) to CCGAAUACGACACGUAC AAGAUCU (SEQ ID NO: 28) or CCGAATACGACACGTACAAGAT CT (SEQ ID NO: 29). In other cases, the linker domain comprises, consists essentially of, or consists of a nucleic acid sequence that is at least 80% identical (e.g., at least 85% sequence identity, at least 86% sequence identity, at least 87% sequence identity, at least 88% sequence identity, at least 89% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity) to GCUGCUGCUCAGUCUCCUGGGCUGG (SEQ ID NO:30) or GCTGCTGCTCAGTCTCCTGGGCTGG (SEQ ID NO:31).

[0269] Enhancers of RNA exon editor activity

[0270] The inventors use a multifaceted experimental approach to design nucleic acid trans-splicing molecules with properties that are beneficial for therapeutic intervention. Therefore, the inventors attempt to identify additional elements that can enhance the activity of RNA exon editors, for example, by increasing on-target (ONT) trans-splicing, increasing ONTABCA4 trans-splicing protein levels, or reducing non-splicing protein (NSP) levels, or any combination thereof. Therefore, a variety of elements are tested to determine whether the presence of the test element enhances the activity of the RNA exon editor relative to the activity observed for the RNA exon editor without the test element. Through a large number of trial-and-error procedures, in which different elements and their different combinations are scored in the context of individual trans-splicing molecules, the inventors identified a sequence element, the U1 binding site (UBS), which increases ONT trans-splicing and reduces NSP levels for RNA exon editors containing UBS as additional elements relative to RNA exon editors lacking UBS. See, e.g. Fig.13 (3×U1) and Fig.19A and 19B (3×UBS). In some embodiments, 3×UBS (also known as 3×U1) comprises SEQ ID NO: 62. In some embodiments, 3×UBS (also known as 3×U1) comprises at least one sequence comprising GGTAAGT or GGTAAGTAGAGTG (SEQ ID NO: 61) or GGTGAGTAGAGTG (SEQ ID NO: 83). In a specific embodiment thereof, 3×UBS is located 3′ of the linker domain. In a specific embodiment thereof, 3×UBS is located 3′ of the linker domain and 5′ of the binding domain. In a specific embodiment thereof, 3×UBS comprises at least one sequence comprising GGTAAGT, wherein each of the at least one sequence comprising GGTAAGT further comprises a flanking sequence. In an embodiment thereof, 3×UBS comprises at least one of GGTAAGTAGAGTG (SEQ ID NO: 61) or GGTGAGTAGAGTG (SEQ ID NO: 83). In some embodiments, 3xUBS comprises at least one of: CGTGGTAAGTAGAGTG (SEQ ID NO: 74; UBS1); ATGGGTAAGT AGAGTG (SEQ ID NO: 75; UBS2); or TGG GGTAAGT AGAGTG (SEQ ID NO: 76; UBS3), or any combination thereof.

[0271] Thus, in some embodiments, the RNA exon editor comprising at least one UBS comprises at least one sequence comprising GGTAAGT or GGTAAGTAGAGTG (SEQ ID NO: 61). In a specific embodiment thereof, the 3×UBS is located 3′ of the linker domain in the RNA exon editor. In a specific embodiment thereof, the 3×UBS is located 3′ of the linker domain and 5′ of the binding domain in the RNA exon editor. In some embodiments, the RNA exon editor comprising at least one UBS comprises at least one of the following: CGT GGTAAGT AGAGTG (UBS1; SEQ ID NO: 74); ATG GGTAAGT AGAGTG (UBS2; SEQ ID NO: 75); or TGG GGTAAGT AGAGTG (UBS3; SEQ ID NO: 76); or any combination thereof. In some embodiments, the RNA exon editor comprising at least one UBS comprises at least one CGT GGTAAGT AGAGTG (UBS1; SEQ ID NO: 74). In some embodiments, the RNA exon editor comprising at least one UBS comprises CGT GGTAAGT AGAGTG (SEQ ID NO: 74; UBS1), ATG GGTAAGT AGAGTG (SEQ IDNO: 75; UBS2) and TGG GGTAAGT AGAGTG (SEQ ID NO: 76; UBS3).

[0272] Based on the results presented herein, at least one UBS present in the context of a trans-splicing molecule is referred to herein as an enhancer. An exemplary enhancer described herein comprises at least one of: CGT GGTAAGT AGAGTG (UBS1; SEQ ID NO: 74), ATG GGTAAGT AGAGTG (UBS2; SEQ ID NO: 75) or TGG GGTAAGT AGAGTG (UBS3; SEQ ID NO: 76), or any combination thereof. In some embodiments, an exemplary enhancer described herein comprises at least one UBS comprising at least one CGT GGTAAGTAGAGTG (UBS1; SEQ ID NO: 74). In some embodiments, an exemplary enhancer described herein comprises a UBS comprising CGT GGTAAGT AGAGTG (UBS1; SEQ ID NO: 74), ATG GGTAAGT AGAGTG (UBS2; SEQ ID NO: 75), and TGG GGTAAGT AGAGTG (UBS3; SEQ ID NO: 76).

[0273] The UBS (included as an additional element in the RNA exon editor and located 3′ to the linker and 5′ to the BD; see Fig.13 ) is surprising, at least because it is reasonable to predict that the presence of at least one additional element that could function as an alternative 5′ splice site might potentiate the activity of an RNA exon editor by potentially interacting with the splicing domain of the RNA exon editor (see e.g. Fig.13 ; SD; existing true 5' splice site) competes and / or interferes with it to reduce ONT trans-splicing, and this competition / interference will reduce ONT trans-splicing. Therefore, the observed increase in ONT trans-splicing conferred by the presence of an enhancer (at least one of the UBSs, such as UBS1, UBS2 or UBS3, or any combination thereof) in an RNA exon editor is unexpected and surprising. The enhancer also statistically significantly decreased NSP, an observation that further emphasizes the surprising functional properties of this element in the context of RNA exon editors.

[0274] The functional properties of the enhancers described herein have also been demonstrated in the context of RNA exon editors comprising different binding domains that bind / target different introns in different target mRNA precursors other than ABCA4 mRNA precursors. Results from exemplary RNA exon editors indicate that enhancers comprising 3×UBS confer surprising beneficial properties in the context of RNA exon editors targeting intron A and intron B in non-ABCA4 mRNA precursors. More specifically, RNA exon editors targeting non-ABCA4 mRNA precursors comprising a combination of 40-mer + 3×UBS (SEQ ID NO: 62) exhibited significantly reduced NSP levels relative to RNA exon editors comprising only 40-mer (SEQ ID NO: 27). See, e.g. Fig.27B and 28BWhile reducing NSP, the combination of 40mer + 3×UBS (SEQ ID NO: 62) maintained similar levels of ONT trans-splicing proteins relative to 40mer alone. By comparison, 3×UBS was shown to reduce NSP per RNA exon editor [intron 22 of the target ABCA4 mRNA precursor ( Fig.19B ); intron A ( Fig.27B ); and intron B ( Fig.28B )] includes the same 40-mer + 3×UBS sequence box, which supports the conclusion that the function conferred by the presence of the 3×UBS sequence (SEQ ID NO: 62) is consistent regardless of the target intron and / or target mRNA precursor of the RNA exon editor.

[0275] The functionality conferred by the presence of the 3xUBS sequence (SEQ ID NO: 62) in nucleic acid trans-splicing molecules was also evident at the level of % RNA trans-splicing. Fig.19A (targeting intron 22 of ABCA4 pre-mRNA), Fig.28A (intron B) and Fig.29 (Intron C) It was demonstrated that the presence of the 3×UBS sequence (SEQ ID NO: 62) can increase RNA trans-splicing %, which is reflected in the trend of increased RNA substitution %. In fact, in the exemplary trans-splicing molecule targeting intron C, the presence of the 3×UBS sequence (SEQ ID NO: 62) increased the substitution % level by 3 times. These results indicate that this additional functional property of the 3×UBS sequence (SEQ ID NO: 62) promoting the trend of increased substitution % is consistent regardless of the target intron and / or target mRNA precursor of the RNA exon editor. Notably, the RNA exon editor comprising a binding domain (BD34) targeting intron C includes an alternative 5′ splice site that is different from the 5′ splice site used in each RNA exon editor comprising binding domains targeting intron 22, intron A, and intron B of the ABCA4 mRNA precursor. These results suggest that the 3×UBS enhancer can confer functionality in the context of RNA exon editors that differ in elements other than the binding domain and pre-mRNA targeting specificity.

[0276] Thus, the inventors have presented evidence that enhancers such as the enhancer described herein (e.g., SEQ ID NO: 62) function in a manner independent of the binding domain and target and, therefore, can be used in the context of general RNA exon editors, with the expectation that the presence of the enhancer will confer favorable properties, including reduced NSP levels and potentially increased trans-splicing activity, as reflected by % RNA replacement.

[0277] Translational enhancers of RNA exon editor activity

[0278] The search for additional elements that can enhance the activity of RNA exon editors by increasing on-target (ONT) trans-splicing, increasing the level of ONTABCA4 trans-splicing protein, or reducing the level of non-splicing protein (NSP), or any combination thereof, also led the inventors to discover that AU-rich elements (AREs) exhibit surprising functional properties in the context of the RNA exon editors described herein. The surprising properties of AREs were discovered through a large number of trial-and-error procedures, in which the scores of different elements and different combinations thereof were evaluated in the context of individual trans-splicing molecules. The inventors demonstrated that the presence of AREs reduces the level of NSPs in RNA exon editors comprising AREs as additional elements (40 polymers + AREs) relative to RNA exon editors lacking AREs (e.g., only 40 polymers). In some experiments, the presence of AREs also increases the ONT trans-splicing ABCA4 protein in RNA exon editors comprising AREs as additional elements (40 polymers + AREs) relative to RNA exon editors lacking AREs (e.g., only 40 polymers). See, e.g. Fig.13 (ARE) and Fig.19B (40mer+ARE). Because AREs reduce NSP levels and increase ONT trans-splicing ABCA4 protein levels, they are referred to herein as "translation enhancers."

[0279] In some embodiments, an exemplary ARE is a granulocyte-macrophage colony stimulating factor (GM-CSF) ARE comprising a sequence comprising ATTTATATATTTATATTTTTTAAAA TATTTATTTATTTATTTATTTA (SEQ ID NO: 63), or a sequence having at least 90% identity to SEQ ID NO: 63. In some embodiments, the translation enhancer has at least 91% identity to SEQ ID NO: 63, at least 92% identity to SEQ ID NO: 63, at least 93% identity to SEQ ID NO: 63, at least 94% identity to SEQ ID NO: 63, at least 95% identity to SEQ ID NO: 63, at least 96% identity to SEQ ID NO: 63, at least 97% identity to SEQ ID NO: 63, at least 98% identity to SEQ ID NO: 63, or at least 99% identity to SEQ ID NO: 63. In some embodiments, SEQ ID NO: 63 or a sequence having at least 90% identity to SEQ ID NO: 63 is operably linked to an enhancer (e.g., SEQ ID NO: 62) at 3′. The core sequence is typically AUUUA (RNA; ATTTA in a DNA vector encoding it), and repeats of the core AUUUA element are typically required for function. ARE elements are typically about equal to or greater than 50 bases. Thus, in some embodiments, the ARE comprises a repeat of the core AUUUA element of about equal to or greater than 50 bases.

[0280] AREs (included as additional elements in RNA exon editors; see Fig.13 )'s ability to enhance RNA exon editor activity was surprising, at least because it increased ONT trans-splicing ABCA4 protein levels while simultaneously decreasing NSP levels. Thus, ARE-mediated effects on encoded protein levels promote the therapeutic potential of RNA exon editors by preferentially increasing therapeutic protein levels (ONT trans-splicing ABCA4 protein levels) and decreasing NSP levels.

[0281] It is also noteworthy that the cassette of the exemplary enhancer combined with the exemplary translation enhancer (40mer + 3×UBS + ARE; SEQ ID NO: 73) caused a more significant reduction in NSP levels relative to the NSP levels of RNA exon editors containing only 40mer, 40mer + 3×UBS, or 40mer + ARE. Therefore, this element combination (40mer + 3×UBS + ARE; SEQ ID NO: 73) exhibits particularly advantageous properties in the context of trans-splicing molecules as described herein.

[0282] The functional properties of the translation enhancers described herein have also been demonstrated in the context of RNA exon editors comprising different binding domains that bind / target different introns in different target mRNA precursors other than ABCA4 mRNA precursors. Results from exemplary RNA exon editors indicate that a translation enhancer comprising ARE (SEQ ID NO: 63) confers surprising beneficial properties in the context of RNA exon editors targeting intron A and intron B in non-ABCA4 mRNA precursors. More specifically, an RNA exon editor targeting a non-ABCA4 mRNA precursor comprising a combination of 40-mer + ARE (SEQ ID NO: 63) exhibited significantly reduced NSP levels relative to an RNA exon editor comprising only 40-mer (SEQ ID NO: 27). See, e.g. Fig.27B and 28B While reducing NSP, the combination of 40mer + ARE (SEQ ID NO: 63) maintained similar levels of ONT trans-splicing proteins relative to the 40mer alone. By comparison, each RNA exon editor [intron 22 of the target ABCA4 mRNA precursor ( Fig.19B ); intron A ( Fig.27B ); and intron B ( Fig.28B )] includes the same 40-mer + ARE sequence (sequence 3444-3529 of SEQ ID NO: 86), which supports the conclusion that the function conferred by the presence of the ARE sequence (SEQ ID NO: 63) is consistent regardless of the target intron and / or target mRNA precursor of the RNA exon editor. The reduction in NSP levels was more pronounced when the 40-mer + 3×UBS + ARE (SEQ ID NO: 73) box was used, indicating that these elements have a combined effect. These results show that ARE translation enhancers can confer functionality in the context of RNA exon editors that differ in binding domains and mRNA precursor target specificity, and can act in combination with other elements to promote the efficacy of RNA exon editors.

[0283] Thus, the inventors have presented evidence that enhancers such as the enhancers described herein (e.g., SEQ ID NO: 63) function in a manner independent of the binding domain and target and, therefore, can be used in the context of general RNA exon editors, with the expectation that the presence of the translation enhancer will confer favorable properties, including reduced NSP levels.

[0284] Additional components or modifications

[0285] In some cases, the trans-splicing molecule includes a 3' transcription terminator domain. In some embodiments, this type of 3' transcription terminator domain forms a triple helical structure that effectively blocks the 3' end of the trans-splicing molecule. In some cases, the 3' transcription terminator domain is from human long non-coding RNA MALAT1 (e.g., wild-type MALAT1). In some embodiments, the 3' transcription terminator domain includes a tRNA-like domain. The 3' transcription terminator domain that can be used as a part of the ABCA4 trans-splicing molecule of the present invention is described in International Patent Publication No. WO2020 / 214973, which is incorporated herein by reference in its entirety. For example, in some embodiments, the RTM region operably connected to the 3' end of the binding domain includes a terminator domain, which includes a wild-type MALAT1+mascRNA domain, such as SEQ ID NO: 32 or SEQ ID NO: 33, consisting essentially of or consisting of it. In some embodiments, the region of the RNA exon editor operably linked to the 3′ end of the binding domain includes a terminator domain comprising, consisting essentially of, or consisting of a mutated MALAT1+mascRNA (anti-Mut1 mascRNA) domain, such as SEQ ID NO: 66 (DNA) or SEQ ID NO: 67 (RNA).

[0286] In some cases, the trans-splicing molecule includes a 3′ downstream (DS) region located downstream of the binding domain (i.e., 3′ operably connected) and / or upstream of the terminator domain (i.e., 5′ operably connected). In some cases, the 3′ DS region is part of the terminator domain. The 3′ DS region can directly connect the binding domain to the terminator region. In some embodiments, the 3′ DS region is 6-10 nucleotides in length (e.g., 8 nucleotides in length). In some embodiments, the 3′ DS region includes any one of the following: 3′ DS-MALAT1 flank 8-mer RNA, AGGGUCAU; 3′ DS-MALAT1 flank 8-mer DNA, AGGGTCAT; 3′ DS- random 8-mer RNA, CGAGCCUC; 3′ DS- random 8-mer DNA, CGAGCCTC; 3′ DS-MALAT1 flank the first 6 8-mer RNA, AGGGU; and 3′ DS-MALAT1 flank the first 6 8-mer DNA, AGGGT. In some embodiments, the 3′ DS region consists of any one of the following: 3′ DS-MALAT1 flanking 8-mer RNA, AGGGUCAU; 3′ DS-MALAT1 flanking 8-mer DNA, AGGGTCAT; 3′ DS-random 8-mer RNA, CGAGCCUC; 3′ DS-random 8-mer DNA, CGAGCCTC; the first 6 8-mer RNAs flanking 3′ DS-MALAT1, AGGGU; and the first 6 8-mer DNAs flanking 3′ DS-MALAT1, AGGGT.

[0287] In some embodiments, the binding of the trans-splicing molecule to the target mRNA precursor is mediated by a percentage of complementarity (i.e., based on the base pairing properties of the nucleic acid), triple helix formation, or protein-nucleic acid interactions (as described in the literature cited herein). In one embodiment, the nucleic acid trans-splicing molecule includes DNA, RNA, or DNA / RNA hybrid molecules, wherein the DNA or RNA is single-stranded or double-stranded. Also included herein is RNA or DNA that can hybridize with one of the aforementioned RNA or DNA, preferably under stringent conditions, such as hybridization at 60° C. in 2.5x SSC buffer, and washing several times in a lower buffer concentration (e.g., 0.5xSSC buffer) at 37° C. These nucleic acids can encode proteins that exhibit lipid phosphate phosphatase activity and / or associate with the plasma membrane. When synthesizing trans-splicing molecules in vitro, such trans-splicing molecules can be modified on the base portion, sugar portion, or phosphate backbone, for example, to improve the stability of the molecule, hybridization with the target mRNA, transport into the cell, stability to enzymatic cleavage in the cell, etc. For example, modifying the trans-splicing molecule to reduce the overall charge can enhance the cellular uptake of the molecule. In addition, modifications may be made to reduce sensitivity to nucleases or chemical degradation. Nucleic acid molecules may be synthesized by conjugation to another molecule, such as a peptide, a hybridization-triggered cross-linking agent, a transporter, a hybridization-triggered cleavage agent, and the like.

[0288] Various other well-known modifications to nucleic acid molecules may be introduced as a means of increasing intracellular stability and half-life (see also above with respect to oligonucleotides). Possible modifications are known in the art. Modifications that may be made to the structure of the synthetic trans-splicing molecules include backbone modifications.

[0289] Exemplary ABCA4 RNA exon editor cassette map and overview

[0290] In general, the ABCA4 RNA exon editor cassette (ABCA4 REEC) contains regulatory components that drive expression of the RNA exon editor, a 5′UTR and CDS that replace the corresponding native sequence and any mutations that may be present within the target native sequence, a splice donor (SD) that interacts with the natural splice acceptor (SA), a linker that provides flexibility and accessibility for this interaction to occur, a regulatory element that enhances trans-splicing (TS), a BD that targets the correct position in the pre-mRNA, and a terminator sequence that promotes TS and stability. Fig.13 These characteristics are indicated and briefly described in Table 1 below, where an exemplary ABCA4REEC is presented:

[0291] Table 1:

[0292]

[0293]

[0294] ABCA4 REEC characteristics

[0295] The following is an overview of Fig.13 Details and background on the features of the exemplary ABCA4 REEC embodiments presented in.

[0296] Inverted terminal repeat (ITR) sequences: 5' and 3' ITR sequences flank the exemplary RNA exon editor sequence and are essential for adeno-associated virus (AAV) transgene packaging. An exemplary ABCA4 REEC contains a "flipped orientation" 130-nucleotide ITR sequence derived from AAV2, which is commonly used in gene therapy.

[0297] CMV / CMV promoter: This regulatory sequence drives expression of an exemplary exon editor transcript. It contains the cytomegalovirus (CMV) immediate early enhancer and the CMV immediate early enhancer, which have been shown to drive high expression in non-human primate (NHP) photoreceptors and are shown herein to drive high expression in NHP retina and human retina. See, e.g., Figures 8, 9, 31, and 32.

[0298] 5′UTR: The 5′ end of the exemplary exon editor RNA molecule begins with the native ABCA4 5′UTR sequence, which retains the native RNA sequence in the final ONT mRNA molecule produced by TS. The UTR sequence has been modified by five point mutations that eliminate suspected or data-driven cryptic splice acceptor sites to reduce the possibility of cis-splicing or TS between exon editor transcripts.

[0299] Coding sequence (CDS): An exemplary ABCA4REEC encodes exons 1 to 22 of the ABCA4 mRNA sequence to replace the corresponding native sequence after the TS (additional details about exon 22 are presented below). Exons 1 to 21 have been modified by more than 40 synonymous mutations that eliminate suspected or data-driven cryptic splice acceptor sites to reduce the possibility of cis-splicing or TS between exon editor transcripts.

[0300] Terminal exon 22: The CDS encoded in the exemplary ABCA4 REEC includes exon 22, which is called the terminal exon because it is immediately preceded by a splice donor (SD) site in the exon editor sequence and is followed by a TS to connect to native exon 23, forming a correct exon 22-23 junction. To facilitate identification and quantification of ONT molecules formed by the TS, exon 22 has been modified by 29 synonymous point mutations. These mutations provide the opportunity to distinguish trans-spliced ​​transcripts from endogenous transcripts by selective primer / probe design that facilitates RT-qPCR analysis (quantification), as well as next-generation sequencing (NGS)-based analysis (identification and quantification) without causing amino acid changes in the protein sequence.

[0301] Splice donor site (splicing domain; SD): The exemplary ABCA4 REEC contains a consensus U1 splice donor site (SD) located directly downstream of the terminal exon 22. During the spliceosome-mediated TS reaction, this SD interacts with the endogenous intron 22 splice acceptor (SA) site, replacing the natural cis-splicing reaction that would otherwise occur between the endogenous intron 22 splice donor site and the SA site. The result of this TS event is a precisely formed exon 22-23 junction, in which the upstream region originates from the exon editor and the downstream region contains the remainder of the native ABCA4 mRNA precursor, which continues its natural cis-splicing event to form a mature mRNA molecule.

[0302] Stop codon: The exemplary ABCA4 REEC includes a double stop codon immediately following the SD site. In fact, the last nucleotide of the GTAAGT SD site serves as the first nucleotide of the TAGTGA double stop codon. One purpose of this intentional stop codon is to eliminate the addition of foreign amino acids at the C-terminus when the pre-splicing exon editor transcript leaves the nucleus, enters the cytoplasm and is translated to produce a truncated non-spliced ​​protein (NSP). Any such foreign amino acids at the C-terminus of the NSP may pose a potential immunogenic risk, which can be avoided by including a stop codon. The stop codon can also promote AU-rich element (ARE)-mediated decay, which the inventors assume will help degrade the pre-splicing exon editor RNA that escapes into the cytoplasm, as discussed below.

[0303] 40-mer linker: The linker sequence located between the SD site and the downstream element can provide flexibility in RNA structure and accessibility to the SD, which is beneficial for efficient TS. After comprehensive screening of thousands of linker candidates, the 40-mer linker stood out as an efficient sequence. See e.g. Figure 1The predicted secondary structure of the exon editor-associated region containing the 40-mer linker suggests that the presence of the 40-mer linker results in an open and accessible SD.

[0304] 3×U1 sites: An exemplary ABCA4REEC contains an enhancer downstream of the 40-mer linker that contains three tandem U1 sites. During spliceosome-mediated splicing, the U1 sites bind to the U1 snRNP. The inclusion of three tandem U1 sites downstream of the major SD site of this exon editor resulted in an increase in RNATS and a decrease in the observed NSP levels. The inventors hypothesize that these results may be due to increased association with the spliceosome and retention in the nucleus of cells where TS occurs.

[0305] AU-Rich Element (ARE): An exemplary ABCA4 REEC contains an AU-rich element (ARE) derived from the mRNA of the granulocyte-macrophage colony stimulating factor (GM-CSF) gene. The presence of this ARE and an upstream stop codon is intended to mimic a 3′UTR-like sequence. The inventors hypothesized that in the case where the exon editor RNA before splicing enters the cytoplasm, the ARE RNA binding protein may recognize the ARE sequence and cause rapid degradation of the molecule, thereby reducing the level of NSP.

[0306] Binding Domain (BD): The BD encoded by the exemplary ABCA4 REEC directly associates the exon editor RNA with the native ABCA4 pre-mRNA. Its 150 nucleotide (nt) sequence is complementary to a region of the same length within intron 22 (chr1:94041452-94041601) of the mRNA precursor. The intronic position of the BD is selected by an iterative process of scanning intron 22 using an array of exon editors that differ in their BD sequence at different intronic positions. This scanning process requires the evaluation of thousands of BDs targeting intron 22 using a massively parallel library NGS-based approach and assessment at the level of individual exon editors using bioluminescence or qPCR as readout. See, e.g. Fig.16 .

[0307] MALAT1 triple helical terminator: The exemplary ABCA4 REEC also includes a terminator sequence derived from the MALAT1 long noncoding RNA (lncRNA). This portion of the MALAT1 lncRNA contains a triple helical structure that can confer RNA stability and nuclear retention to the exon editor. The MALAT1 terminator enables TS efficiencies far exceeding those achieved when alternative terminators (e.g., self-cleaving ribozymes) are applied. See, e.g. Fig. 20AThe triple helix is ​​followed by an RNase P cleavage site and a short sequence containing a MALAT1-associated small cytoplasmic RNA (mascRNA), as discussed below. RNase P cleavage downstream of the triple helix defines the 3′ end of the exon editor transcript.

[0308] MascRNA: The mascRNA sequence in the exemplary ABCA4 REEC is flanked by an upstream RNase P cleavage site and a downstream RNase Z cleavage site, and it is thought that once processed, it will leave the nucleus, while the exon editor transcript will remain and participate in TS. Although the mascRNA is no longer present in the exon editor transcript after RNase P cleavage, the inclusion of the downstream sequence of the MALAT1 triple helix as it naturally occurs may help achieve efficient TS results. In the cytoplasm, mascRNA is suspected to promote global protein translation and cell proliferation by interacting with and upregulating the poly-tRNA synthetase complex component glutaminyl-tRNA synthetase (QARS). To reduce this potential risk, the mascRNA sequence encoded in the exemplary ABCA4 REEC has been mutated to include a point mutation within its anticodon stem-loop, called anti-Mut1, thereby eliminating its interaction with QARS and the subsequent possible increase in the overall protein synthesis rate. The second point mutation helps maintain the natural cloverleaf structure of the mascRNA by base pairing with the anti-Mut1 mutation. Notably, introduction of anti-Mut1 into mascRNA sequences did not impair TS efficiency. See, e.g., 20B.

[0309] As described herein, an exemplary ABCA4 REEC encodes an exemplary ABCA4 5′ exon editor RNA molecule that functions in a 5′ trans-splicing reaction mediated by the endogenous spliceosome. Fig.14A As shown, after the exon editor RNA is transcribed, the RNA sequence (binding domain; BD) within the exon editor that is complementary to intron 22 of the natural ABCA4 mRNA precursor locates the exon editor RNA to the mRNA precursor. Next, a trans-splicing (TS) reaction occurs between the splicing donor site (SD) of the exon editor and the intron 22 splicing acceptor site (SA) of the mRNA precursor. This reaction causes the natural endogenous mRNA precursor sequence from exon 1 to exon 22 to be replaced by the corresponding coding sequence (CDS) provided by the exon editor RNA, thereby correcting any mutations that may exist in this region of the natural endogenous mRNA precursor. The resulting on-target (ONT) molecule is translated to form a biologically active ABCA4 protein. See, for example Fig.14A .

[0310] In addition to the above, without being bound by theory, the RNA exon editor described herein is believed to operate through spliceosome-mediated trans-splicing, which is carried out by a mechanism similar to cis-splicing. After transcription, the exon editing RNA diffuses in the nucleus, and the U1 snRNP is deposited on its unpaired SD. In addition, in the nucleus, the endogenous (natural) mRNA precursor target is transcribed from its locus, and its introns are removed by cis-splicing between the flanking SD and the splicing acceptor (SA) site within seconds after the SA of each intron appears. The trans-splicing process is initiated by base pairing of the exon editor binding domain (BD) with its complementary sequence located within intron 22 of the endogenous ABCA4 mRNA precursor, which must occur before the intron is removed by cis-splicing. At this point, the spliceosome can perform the following: (1) use the endogenous SD and SA sites to form a lariat for cis-splicing, or (2) use the SD of the exon editor to pair with the endogenous SA to form a "Y branch" for trans-splicing. In the latter case, the first nucleotide (guanine) of the SD of the exon editor forms a covalent bond with the branch point of the intron, which is usually located 15-50bp upstream of SA. The formation of this bond causes the downstream part of the exon editor to separate from the CDS part that terminates in exon 22, while exon 22 still interacts with the spliceosome. Next, the spliceosome mediates the connection of exon 22 of the exon editor to exon 23 of the endogenous mRNA precursor, while the intron is separated, thereby forming the correct exon 22-23 junction. Finally, the Y-branch RNA composed of the downstream part of the exon editor RNA and the separated intron sequence will be rapidly degraded, similar to the fate of the lariat RNA formed during cis-splicing. See, for example Fig. 14B .

[0311] The ABCA4 exon editor may include or exclude one or more of the components listed above in Table 1. Individual functional components may be advantageously included in the ABCA4 exon editor, and it is not necessary to include all of the components listed in Table 1. For example, while elements 3, 7, 8, 9, 10, and 12 provide advantages to the ABCA4 exon editor, an effective ABCA4 exon editor may be made without one or more of these elements.

[0312] Cell line assays

[0313] In some cases, the trans-splicing molecules described herein are tested in cultured cell lines. In order to screen, select, and improve the functionality of RNA exon editors, cultured cell lines can be obtained or engineered to express the targeted ABCA4 mRNA precursor at sufficient levels. Since ABCA4 is expressed at very low levels in common, robust, and easily transfected / transduced transformed cell lines, a HEK293T-based cell line, called B6, was designed to express high ABCA4 RNA and protein levels. This was achieved by knocking in (KI) the constitutive CAGGS promoter between the endogenous ABCA4 promoter and exon 1 via CRISPR-mediated homology-directed repair (HDR). PCR of genomic DNA showed that the CAG promoter was inserted into at least one allele in B6 cells. ABCA4 RNA expression in B6 cells was then confirmed using four different qPCR assays. This was in contrast to parental HEK293T cells, which do not express ABCA4. Protein translation in B6 cells was confirmed by western blotting. See Figure 3C .

[0314] To characterize the ability of ABCA4 RNA exon editors to efficiently correct the target native mRNA precursor, the resulting trans-splicing was assessed for its ability to be translated on-target (ONT) RNA and produce full-length ABCA4 protein. To this end, a knockout (KO) cell line, termed 17+06, was engineered based on the B6 cell line. 17+06 cells continued to produce high levels of ABCA4 RNA, but in stark contrast to the B6 cell line, 17+06 cells did not produce ABCA4 protein. Engineering of 17+06 cells was achieved by introducing mutations into the ABCA4 gene coding sequence using CRISPR and guide RNAs (gRNAs) targeting exons 3 and 4. B6 cells were subjected to two rounds of sequential transfection to achieve high mutation efficiency and disruption of the ABCA4 gene sequence, first by applying a gRNA targeting exon 3 and then by applying a mixture of a gRNA targeting exon 3 and a gRNA targeting exon 4. The mutation was confirmed by Sanger sequencing of PCR amplicons generated from 17+06 genomic DNA as well as cDNA, which confirmed that the mutation occurred in an allele that had undergone a successful CAG insertion during the generation of the parental cell line, B6. RT-qPCR confirmed the persistence of ABCA4 RNA expression in the 17+06 cell line, while Western blot analysis showed that ABCA4 protein translation was abrogated. Figure 3C .

[0315] RNA Exon Editor Screening Platform

[0316] like Fig.13As described, the 5′ RNA exon editor contains several functional sequence elements, such as a binding domain (BD) for targeting the mRNA precursor and a linker capable of approaching the splicing donor (SD) site. When engineering an RNA exon editor for a given gene target, multiple sequence options for each of these elements will be tested for the ability to contribute to improved trans-splicing (TS) efficiency. This testing can be done by: (A) cloning and transfecting individual RNA exon editor variants and analyzing efficiency by RT-qPCR / ddPCR and protein blotting; or (B) cloning and pooling RNA exon editors in a high-throughput (HT) library-based approach that relies on next-generation sequencing (NGS) and computational analysis to assess efficiency. ABCA4REEC is an exemplary ABCA4 RNA exon editor construct that was developed by combining these methods. Both methods are described below.

[0317] RNA Exon Editor Screening in Individual Formats:

[0318] This method can be used to test a small number of variable elements in RNA exon editor sequences before initiating library-based multiplex screening, to validate the performance of RNA exon editors identified in multiplex screening, and / or to improve the performance of lead candidates. Assessment of TS efficiency occurs at both the RNA and protein levels.

[0319] At the RNA level, TS activity is assessed by isolating total RNA from cells followed by reverse transcription and real-time quantitative PCR (RT-qPCR) to measure, for example, RNA copy number of the following targets: RNF20 (a housekeeping gene for normalization); native (ABCA4) mRNA; exon editor RNA; on-target exon-edited RNA (ONT), which is the product of positive TS; ONT+exon editor+OFT (off-target)—a single assay that captures all three targets. OFT represents incorrect RNA molecules that may be trans-spliced ​​by RNA exon editors.

[0320] ONT TS efficiency, also called replacement percentage, represents the fraction of the total ABCA4 mRNA population that has been successfully TSed and is calculated by the following equation: ONT TS% = 100 x (ONT copy number / (ONT copy number + native copy number)).

[0321] The RNA exon editor TS efficiency is the fraction of the RNA exon editor transcript population that has been correctly trans-spliced ​​into ABCA4 RNA and is calculated by the following equation: Exon editor TS% = 100 × (ONT copy number / (ONT copy number + exon editor copy number + OFT copy number)).

[0322] At the protein level, TS activity is measured by western blot analysis of proteins extracted from cells or tissue samples, in the case of ABCA4, by a protocol that enriches for membrane proteins. Na+ / K+ ATPase is a membrane protein and is used as a loading control. ONT protein levels are measured using an ABCA4-specific antibody (Ab). For those constructs that include a tag (e.g., a V5 tag at the N-terminus), ONT protein levels can be assessed by probing a western blot using an Ab specific for the tag (e.g., a V5-specific Ab).

[0323] RNA Exon Editor Screening in Library Format:

[0324] In addition to the above, RNA exon editors can be screened in a high-throughput library format that relies on the synthesis of DNA oligonucleotide libraries, which may focus on specific features of the exon editors, such as BDs or linkers.

[0325] Confirmation of the full-length exon-edited ABCA4 mRNA sequence:

[0326] To confirm that the ABCA4 mature mRNA produced by exon editing has the sequence predicted to be produced by an accurate trans-splicing reaction, including the correct exon 22-exon 23 junction, the inventors isolated and sequenced the edited ABCA4 RT-PCR products from ABCA4 KO cells transiently transfected with a plasmid encoding the ABCA4-01 exon editor. Sanger sequencing confirmed the correct sequence of the mature mRNA in multiple randomly selected clones. In addition to confirming the correct exon 22-exon 23 junction, these sequencing results also confirmed that the full-length exon-edited ABCA4 mature mRNA molecule has the expected sequence throughout its entire length, including the exon editor-derived CDS spanning exons 1 to 22 and the endogenous sequence spanning exons 23 to 50. These results provide additional confidence that ABCA4 exon editing mediated by ABCA4-01 treatment will produce the expected correct ABCA4 mature mRNA sequence.

[0327] Evaluation of ATPase functional activity of exon-edited ABCA4 protein:

[0328] The ABCA4 protein is a member of the ATP-binding cassette (ABC) transporter superfamily and is primarily localized to the marginal region of the photoreceptor outer segment disc membrane. ABC transporters use the energy from ATP hydrolysis to transfer a variety of substrates unidirectionally across the cell membrane, from ions to lipids and peptides. Once light entering the eye is converted into an electrical signal (phototransduction), the ABCA4 protein becomes active. Potentially toxic vitamin A derivatives are formed during phototransduction, and the ABCA4 protein helps remove at least two of these substances (all-trans-retinal and 11-cis-retinal) from the photoreceptor outer segments. This photoreceptor clearance mechanism helps protect photoreceptors and retinal pigment epithelial cells from accumulation and secondary damage caused by these molecules. As described above, recessively inherited loss-of-function ABCA4 mutations lead to the accumulation of these vitamin A derivatives, which in turn lead to the accumulation of lipofuscin, including A2E (the diretinoid pyridinium salt N-retinylidene-N-retinylethanolamine fluorophore found in lipofuscin), leading to retinal cell toxicity and ultimately progressive vision loss.

[0329] ATPase activity, including the increase in activity due to substrate binding, is essential for the function of the ABCA4 protein. Therefore, evaluating the ATPase activity of the ABCA4 protein translated from the ABCA4 mRNA produced by exon editing can be used as an overall indicator of the biological activity of ABCA4. Previous reports have shown that incubation of 40 μM all-trans-retinal (ATR) with purified wild-type (WT) ABCA4 protein causes a 1.8- to 2.5-fold increase in ATPase activity. Taking this information into account, experiments were designed to evaluate the biological activity of the exon-edited ABCA4 protein.

[0330] The ATPase activity of rescued ABCA4 protein in ABCA4KO cells transfected with an overexpression plasmid encoding an N-terminal V5 epitope-tagged version of the RNA exon editor ABCA4-01 (SEQ ID NO: 81) was assessed in the presence or absence of 40 μM all-trans retinal (ATR) following immunoprecipitation of ABCA4 protein using established methods. Initial data demonstrated that the basal level of ATPase activity was increased after the addition of 40 μM all-trans retinal. See Fig.24. Minimal background ATPase activity was detected in untransfected samples lacking ABCA4. These results provide evidence that the exon-edited ABCA4 protein produced by treatment with ABCA4-01 (SEQ ID NO: 90) will exhibit functional ATPase activity required for transport of all-trans retinal and excess 11-cis retinal from photoreceptor outer segments. In some embodiments, fragments of SEQ ID NO: 90 (e.g., SEQ ID NO: 69) can be combined with different 5′UTRs to obtain equivalent results. These results depict restoration of ABCA4 biological activity following expression of an exemplary ABCA4 RNA exon editor.

[0331] Summary of in vivo NHP studies supporting the use of ABCA4 exon editors to treat patients with ABCA4-related retinopathy:

[0332] Example 4 presents evidence that AAV8-based V5 epitope-tagged ABCA4 exon editors produce therapeutically relevant exon editing activity in African green monkeys (AGV) 1 month after a single subretinal administration of 1E11 vg / injection. Notably, the early lead vector containing (SEQ ID NO: 42) tested in this study was used as the basis for further optimization and final selection of elements present in ABCA4-01 (SEQ ID NO: 90), which includes an RNA exon editor containing SEQ ID NO: 78. See, e.g. Figure 4-1 2; Tables 1 and 2.

[0333] Example 8 presents evidence that the selected regulatory elements in ABCA4-01 (SEQ ID NO: 90) confer sustained expression and exon editing activity in AGM up to the 3-month time point. The AAV8 construct tested in this study contains an RNA exon editor comprising SEQ ID NO: 77 (wherein the first 104 nucleotides contain the native ABCA4 5′UTR followed by an ATG start codon for initiation of translation), which is very similar to the early leader vector containing (SEQ ID NO: 42), but differs in that it lacks a V5 epitope tag, contains a double stop codon after the splicing domain, and produces higher levels of truncated ABCA4 non-splicing protein (NSP) in vitro compared to ABCA4-01 (SEQ ID NO: 90). Of note, the AAV8 construct tested in this study contained an exon editor (SEQ ID NO: 77) very similar to the early lead vector containing (SEQ ID NO: 42), which was well tolerated at 1 month and 3 months after a single subretinal injection of 4.3E10 vg / eye in all animals, further supporting the clinical approach using the related construct ABCA4-01 (SEQ ID NO: 90). See Figure 22. The ABCA4-01 RNA exon editor containing SEQ ID NO: 90 (which in turn contains SEQ ID NO: 78) differs from the RNA exon editor containing SEQ ID NO: 77 used in this study in that SEQ ID NO: 77 does not include an enhancer (e.g., SEQ ID NO: 62) or a translation enhancer (e.g., SEQ ID NO: 63). However, each of SEQ ID NO: 77 and SEQ ID NO: 78 has the same regulatory elements and double stop codons.

[0334] Example 10 presents evidence that ABCA4-01 (SEQ ID NO: 90) confers sustained expression and exon editing activity in NHPs up to the 6-month time point. More specifically, Figures 30A-30C Results are presented demonstrating robust ABCA4 RNA and protein replacement in vivo in NHPs following six (6) months of treatment with an exemplary AAV8 RNA exon editor construct (ABCA4-01; SEQ ID NO: 90). Briefly, wild-type cynomolgus monkeys were treated with a single subretinal dose of ABCA4-01 (results are presented for an exemplary dose of 3.5E11 vg / eye). For this dose of ABCA4-01, the percentage of RNA replacement ranged from approximately 40%-60%. This resulted in therapeutic levels of the resulting human-NHP chimeric ABCA4 protein, as measured by a qualified IA-MS assay ( Fig. 30C). More specifically, human-NHP chimeric ABCA4 protein generated by ABCA4 RNA editing in these animals was found to account for 20-40% of the total (human-NHP+NHP) ABCA4 protein in the tested samples. RNA replacement was as high as 66% and human / NHP chimeric ABCA4 protein was as high as 45% in wild-type cynomolgus monkeys treated with a higher dose of ABCA4-01 (1E12 vg / eye) delivered by a single subretinal injection. These results suggest that ABCA4-01 achieves therapeutically relevant levels of edited ABCA4 protein expression in NHPs, levels that exceed the levels of rescued ABCA4 protein previously shown to confer therapeutic benefit in the Abca4KO mouse model.

[0335] Example 12 presents evidence that ABCA4-01 (an exemplary AAV8 RNA exon editor construct comprising SEQ ID NO: 90) functions in the context of human photoreceptors. Briefly, donor-derived retinal explants from multiple human donors were treated with ABCA4-01 (3.9E11 vg) to assess the activity of ABCA4-01 in human photoreceptors. ABCA4-01 treatment resulted in approximately 20-30% replacement of endogenous exons 1-22 with RNA encoding the same corresponding exons ( Fig.31 ). Notably, the same batch of ABCA4-01 was also used in the investigative NHP study mentioned in Example 10, further demonstrating the translatability of the ABCA4-01 results from NHP to human subjects.

[0336] III. Vector

[0337] Trans-splicing molecules can be delivered to target cells of an individual using various techniques, such as recombinant adeno-associated virus (AAV) vectors or other vector forms, such as non-viral vectors. Therefore, provided herein are vectors comprising / encoding trans-splicing molecules (e.g., viral or non-viral vectors comprising / encoding trans-splicing molecules, such as DNA vectors comprising / encoding trans-splicing molecules). Any suitable nucleic acid vector can be used in combination with the compositions and methods of the present invention to design and assemble components of trans-splicing molecules and recombinant AAV. In one embodiment, the vector is a recombinant AAV carrying a trans-splicing molecule, which is driven by a promoter to express the trans-splicing molecule in selected cells of an individual. Methods for assembling recombinant vectors are known in the art. See, e.g., Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1989; Kay, MA et al., Nat. Medic, 2001, 7(1):33-40; and Walther W. and Stein U., Drugs 2000, 60(2):249-71.

[0338] In certain embodiments described herein, the trans-splicing molecules are delivered to selected cells in need of treatment, such as photoreceptor cells, by means of an AAV vector. A variety of naturally occurring AAV serotypes can be used. There are a variety of natural variants of the AAV capsid, allowing the identification and use of AAVs with properties particularly suitable for eye or cochlear cells. Artificial AAV vectors can be engineered by conventional molecular biology techniques, so that these particles can be optimized to specifically deliver trans-splicing molecule nucleic acid sequences to cells, minimize immunogenicity, regulate stability and particle life, achieve efficient degradation, and accurately deliver to the nucleus, etc. For example, such artificial capsids can be generated by any suitable technique using selected AAV sequences (e.g., fragments of vp1 capsid proteins) in combination with heterologous sequences that can be obtained from different selected AAVs, non-continuous parts of the same AAV, non-AAV viral sources, or non-viral sources. Artificial AAV can be, but is not limited to, pseudotyped AAVs, chimeric AAV capsids, recombinant AAV capsids, or "humanized" AAV capsids. Pseudotyped vectors in which the capsid of one AAV is replaced with a heterologous capsid protein can be used to deliver the trans-splicing molecules described herein.

[0339] The expression of the trans-splicing molecules described herein can be achieved in selected cells by delivery with recombinant engineered AAV or artificial AAV containing sequences containing / encoding the desired trans-splicing molecules. The use of AAV is a common way of delivering exogenous DNA because it is relatively non-toxic, provides efficient gene transfer, and is easily optimized for specific purposes. Among the well-characterized AAV serotypes isolated from humans or non-human primates, human serotype 2 has been widely used for effective gene transfer experiments in different target tissues and animal models.

[0340] In some embodiments, the AAV is AAV1 or a variant thereof (e.g., SEQ ID NO: 6 or 64 of US20030138772 or SEQ ID NO: 11 or 27 of US20150159173), AAV2 or a variant thereof (e.g., SEQ ID NO: 7 or 70 of US20030138772, SEQ ID NO: 7 or 23 of US20150159173 or SEQ ID NO: 7 of US20150159173), AAV2G9 or a variant thereof, AAV3 or a variant thereof (e.g., SEQ ID NO: 8 or 71 of US20030138772), AAV3a or a variant thereof, AAV3b or a variant thereof (e.g., SEQ ID NO: 1 and 10 of U.S. Pat. No. 6,156,303), AAV3-3 or a variant thereof (e.g., SEQ ID NO: 200 and 217 of WO2005033321), AAV3-4 or a variant thereof (e.g., SEQ ID NO: 219 of WO2005033321), AAV3-5 or a variant thereof (e.g., SEQ ID NO: 301 of WO2005033321), AAV3-6 or a variant thereof (e.g., SEQ ID NO: 310 of WO2005033321), AAV3-7 or a variant thereof (e.g., SEQ ID NO: 321 of WO2005033321), AAV3-8 or a variant thereof (e.g., SEQ ID NO: 330 of WO2005033321), AAV3-9 or a variant thereof (e.g., SEQ ID NO: 150159173 , AAV6.2 or a variant thereof, AAV6.1.2 or a variant thereof, AAV7 or a variant thereof (e.g., SEQ ID NOs: 1-3 of US20030138772 ), AAV7.2 or a variant thereof, AAV8 or a variant thereof (e.g., SEQ ID NOs: 1-3 of US20030138772 ), AAV8 or a variant thereof (e.g., SEQ ID NOs: 1-14 of US20030138772 ), AAV6 or a variant thereof (e.g., SEQ ID NOs: 65 of US20030138772 ), AAV6.1 or a variant thereof (e.g., SEQ ID NOs: 29 of US20150159173 ), AAV6.2 or a variant thereof, AAV6.1.2 or a variant thereof, AAV7 or a variant thereof (e.g., SEQ ID NOs: 1-3 of US20030138772 ), AAV7.2 or a variant thereof, AAV8 or a variant thereof (e.g., SEQ ID NOs: 1-14 of US20030138772 ), NO: 4 and 95 or AAV8 (b) (having an amino acid sequence of Pro-Glu-Arg-Thr-Ala-Met-Ser-Leu-Pro (SEQ ID NO: 132) at amino acid positions 587-595 compared to wild-type AAV8, as described in U.S. Pat. No. 9,567,376 (which is incorporated herein by reference in its entirety)), AAV9 or variants thereof (e.g., SEQ ID NO: 5 and 100 of US20030138772), AAV9.9 or variants thereof, AAV9.11 or variants thereof, AAV9.13 or variants thereof, AAV9.16 or variants thereof, AAV9.24 or variants thereof, AAV9.45 or variants thereof, AAV9.47 or variants thereof, AAV9.61 or variants thereof, AAV9.68 or variants thereof, AAV9.84 or variants thereof (see, e.g., N. Pulicherla et al.Molecular Therapy 19(6): 1070-1078 (2011), incorporated herein by reference in its entirety), AAV10 or variants thereof (e.g., SEQ ID NO: 117 of US20030138772), AAV11 or variants thereof (e.g., SEQ ID NO: 118 of US20030138772), AAV12 or variants thereof (e.g., SEQ ID NO: 119 of US20030138772), AAV16.3 or variants thereof, AAV24.1 or variants thereof, AAV27.3 or variants thereof, AAV42.12 or variants thereof, AAV42-1b or variants thereof, AAV42-2 or variants thereof, AAV42-3a or variants thereof, AAV42-3b or variants thereof, AAV42-4 or variants thereof, AAV42-5a or variants thereof, AAV42-5b or variants thereof, AAV42-6b or variants thereof, AAV4 2-8 or variants thereof, AAV42-10 or variants thereof, AAV42-11 or variants thereof, AAV42-12 or variants thereof, AAV42-13 or variants thereof, AAV42-15 or variants thereof, AAV42-aa or variants thereof, AAV43-1 or variants thereof, AAV43-12 or variants thereof, AAV43-20 or variants thereof, AAV43-21 or variants thereof, AAV43-23 or variants thereof, AAV43-2 ... AAV43-5 or variants thereof, AAV44.1 or variants thereof, AAV44.2 or variants thereof, AAV44.5 or variants thereof, AAV223.1 or variants thereof, AAV223.2 or variants thereof, AAV223.4 or variants thereof, AAV223.5 or variants thereof, AAV223.6 or variants thereof, AAV223.7 or variants thereof, AAV1-7 / rh.48 or variants thereof, AAV1-8 / rh.49 or variants thereof, AAV2-15 / rh.62 or variants thereof Variants, AAV2-3 / rh.61 or variants thereof, AAV2-4 / rh.50 or variants thereof, AAV2-5 / rh.51 or variants thereof, AAV3.1 / hu.6 or variants thereof, AAV3.1 / hu.9 or variants thereof, AAV3-9 / rh.52 or variants thereof, AAV3-11 / rh.53 or variants thereof, AAV4-8 / rh.64 or variants thereof, AAV4-9 / rh.54 or variants thereof (e.g., SEQ ID NO: WO2005033321) ID NO: 116), AAV4-19 / rh.55 or variants thereof (e.g., SEQ ID NO: 117 of WO2005033321), AAV5-3 / rh.57 or variants thereof, AAV5-22 / rh.58 or variants thereof, AAV7.3 / hu.7 or variants thereof, AAV16.8 / hu.10 or variants thereof, AAV16.12 / hu.11 or variants thereof, AAV29.3 / bb.1 or variants thereof, AAV29.5 / bb.2 or variants thereof, AAV106.1 / hu.37 or variants thereof, AAV114.3 / hu.40 or variants thereof, AAV127.2 / hu.41 or variants thereof, AAV127.5 / hu.42 or variants thereof, AAV128.3 / hu.44 or variants thereof, AAV130.4 / hu.48 or variants thereof, AAV145.1 / hu.53 or variants thereof, AAV145.5 / hu.54 or variants thereof, AAV145.6 / hu.55 or variants thereof, AAV161. 10 / hu.60 or variants thereof, AAV161.6 / hu.61 or variants thereof, AAV33.12 / hu.17 or variants thereof, AAV33.4 / hu.15 or variants thereof, AAV33.8 / hu.16 or variants thereof, AAV52 / hu.19 or variants thereof, AAV52.1 / hu.20 or variants thereof, AAV58.2 / hu.25 or variants thereof, AAVA3.3 or variants thereof, AAVA3.4 or variants thereof, AAVA3.5 or variants thereof, AAVA3.7 or variants thereof, AAVC1 or variants thereof, AAVC2 or variants thereof, AAVC5 or variants thereof, AA V-DJ or variants thereof (e.g., SEQ ID NO: 2 or 3 of US20140359799), AA V-DJ8 or variants thereof, AAVF3 or variants thereof, AAVF5 or variants thereof, AAVH2 or variants thereof, AAVH6 or variants thereof, AAVLK03 or variants thereof, AAVH-1 / hu.1 or variants thereof, AAVH-5 / hu.3 or variants thereof, AAVLG-10 / rh.40 or variants thereof, AAVLG-4 / rh.38 or variants thereof, AAVLG-9 / hu.39 or variants thereof, AAVN721-8 / rh.43 or variants thereof, AAVCh.5 or variants thereof (e.g., SEQ ID NO: 3 of US20150159173), O46), AAVCh.5R1 or variants thereof, AAVcy.2 or variants thereof, AAVcy.3 or variants thereof, AAVcy.4 or variants thereof, AAVcy.5 or variants thereof (e.g., SEQ ID NOs: 8 and 24 of US20150159173), AAVCy.SR1 or variants thereof, AAVCy.5R2 or variants thereof, AAVCy.5R3 or variants thereof, AAVCy.5R4 or variants thereof, AAVcy.6 or variants thereof, AAVhu.1 or variants thereof (e.g., SEQ ID NO: 144 of WO2005033321), AAVhu.2 or variants thereof (e.g., SEQ ID NO: 143 of WO2005033321), AAVhu.3 or variants thereof (e.g., SEQ ID NO: 145 of WO2005033321), AAVhu.4 or variants thereof (e.g., SEQ ID NO: 141 of WO2005033321), AAVhu.5 or variants thereof, AAVhu.6 or variants thereof (e.g., SEQ ID NO: 84 of WO2005033321), AAVhu.7 or variants thereof (e.g., SEQ ID NO: 150 of WO2005033321), AAVhu.9 or variants thereof (e.g., SEQ ID NO: 155 of WO2005033321), AAVhu.10 or variants thereof (e.g., SEQ ID NO: 156 of WO2005033321), AAVhu.11 or variants thereof (e.g., SEQ ID NO: 153 of WO2005033321), AAVhu.13 or variants thereof (SEQ ID NOs: 16 and 32 of US20150159173), AAVhu.15 or variants thereof (e.g., SEQ ID NO: 16 and 32 of WO2005033321), 3321 ), AAVhu.20 or a variant thereof (e.g., SEQ ID NO: 134 of WO2005033321 ), AAVhu.21 or a variant thereof (e.g., SEQ ID NO: 135 of WO2005033321 ), AAVhu.22 or a variant thereof (e.g., SEQ ID NO: 136 of WO2005033321 ), AAVhu.23 or a variant thereof (e.g., SEQ ID NO: 137 of WO2005033321 ), AAVhu.24 or a variant thereof (e.g., SEQ ID NO: 138 of WO2005033321 ), AAVhu.25 or a variant thereof (e.g., SEQ ID NO: 139 of WO2005033321 ), AAVhu.26 or a variant thereof (e.g., SEQ ID NO: 140 of WO2005033321 ), AAVhu.27 or a variant thereof (e.g., SEQ ID NO: 141 of WO2005033321 ID NO: 138), AAVhu.23.2 or variants thereof (e.g., SEQ ID NO: 137 of WO2005033321), AAVhu.24 or variants thereof (e.g., SEQ ID NO: 136 of WO2005033321), AAVhu.25 or variants thereof (e.g., SEQ ID NO: 146 of WO2005033321), AAVhu.26 or variants thereof (e.g., SEQ ID NO: 17 and 33 of US20150159173), AAVhu.27 or variants thereof (e.g., SEQ ID NO: 140 of WO2005033321), AAVhu.28 or variants thereof (e.g., SEQ ID NO: 42 of US20150159173), AAVhu.29 or variants thereof (e.g., SEQ ID NO: 132 of WO2005033321), AAVhu.29R or variants thereof, AAVhu.31 or a variant thereof (e.g., SEQ ID NO: 121 of WO2005033321), AAVhu.32 or a variant thereof (e.g., SEQ ID NO: 122 of WO2005033321), AAVhu.34 or a variant thereof (e.g., SEQ ID NO: 125 of WO2005033321), AAVhu.35 or a variant thereof (e.g., SEQ ID NO: 164 of WO2005033321), AAVhu.37 or a variant thereof (e.g., SEQ ID NO: 18 and 34 of US20150159173), AAVhu.39 or a variant thereof (e.g., SEQ ID NO: 102 of WO2005033321), AAVhu.40 or a variant thereof (e.g., SEQ ID NO: 87 of WO2005033321), AAVhu.41 or a variant thereof (e.g., SEQ ID NO: 87 of WO2005033321), NO: 91), AAVhu.42 or a variant thereof (e.g., SEQ ID NO: 85 of WO2005033321), AAVhu.43 or a variant thereof (e.g., SEQ ID NO: 160 of WO2005033321), AAVhu.44 or a variant thereof (e.g., SEQ ID NO: 45 of US20150159173), AAVhu.44R1 or a variant thereof, AAVhu.44R2 or a variant thereof, AAVhu.44R3 or a variant thereof, AAVhu.45 or a variant thereof (e.g., SEQ ID NO: 127 of WO2005033321), AAVhu.46 or a variant thereof (e.g., SEQ ID NO: 159 of WO2005033321), AAVhu.47 or a variant thereof (e.g., SEQ ID NO: 160 of WO2005033321), NO: 128), AAVhu.48 or a variant thereof (e.g., SEQ ID NO: 38 of US20150159173), AAVhu.48R1 or a variant thereof, AAVhu.48R2 or a variant thereof, AAVhu.48R3 or a variant thereof, AAVhu.49 or a variant thereof (e.g., SEQ ID NO: 189 of WO2005033321), AAVhu.51 or a variant thereof (e.g., SEQ ID NO: 190 of WO2005033321), AAVhu.52 or a variant thereof (e.g., SEQ ID NO: 191 of WO2005033321), AAVhu.53 or a variant thereof (e.g., SEQ ID NO: 19 and 35 of US20150159173), AAVhu.54 or a variant thereof (e.g., SEQ ID NO: 188 of WO2005033321), AAVhu.3321 : 194), AAVhu.58 or a variant thereof (e.g., SEQ ID NO: 195 of WO2005033321), AAVhu.60 or a variant thereof (e.g., SEQ ID NO: 184 of WO2005033321), AAVhu.61 or a variant thereof (e.g., SEQ ID NO: 185 of WO2005033321), AAVhu.63 or a variant thereof (e.g., SEQ ID NO: 195 of WO2005033321), AAVhu.64 or a variant thereof (e.g., SEQ ID NO: 196 of WO2005033321), NO: 196), AAVhu.66 or variants thereof (e.g., SEQ ID NO: 197 of WO2005033321), AAVhu.67 or variants thereof (e.g., SEQ ID NO: 198 of WO2005033321), AAVhu.14 / 9 or variants thereof, AAVhu.t 19 or variants thereof, AAVrh.2 or variants thereof (e.g., SEQ ID NO: 39 of US20150159173), AAVrh.2R or variants thereof, AAVrh.8 or variants thereof (e.g., SEQ ID NO: 41 of US20150159173), AAVrh.8R or variants thereof, AAVrh.10 or variants thereof (e.g., SEQ ID NO: 9 and 25 of US20150159173), AAVrh.12 or variants thereof, AAVrh.13 or variants thereof (e.g., SEQ ID NO: 42 of US20150159173), NO: 10 and 26), AAVrh.13R or a variant thereof, AAVrh.14 or a variant thereof, AAVrh.17 or a variant thereof, AAVrh.18 or a variant thereof, AAVrh.19 or a variant thereof, AAVrh.20 or a variant thereof (e.g., SEQ ID NO: 1 of US20150159173), AAVrh.21 or a variant thereof, AAVrh.22 or a variant thereof, AAVrh.23 or a variant thereof, AAVrh.24 or a variant thereof, AAVrh.25 or a variant thereof, AAVrh.31 or a variant thereof, AAVrh.32 or a variant thereof, AAVrh.33 or a variant thereof, AAVrh.34 or a variant thereof, AAVrh.35 or a variant thereof, AAVrh.36 or a variant thereof, AAVrh.37 or a variant thereof (e.g., SEQ ID NO: 1 of US20150159173), NO: 40), AAVrh.37R2 or its variants, AAVrh.38 or variants thereof (e.g., SEQ ID NO: 86 of WO2005033321), AAVrh.39 or variants thereof (e.g., SEQ ID NO: 3, 20 or 36 of US20150159173), AAVrh.40 or variants thereof (e.g., SEQ ID NO: 92 of WO2005033321), AAVrh.43 or variants thereof (e.g., SEQ ID NO: 21 and 37 of US20150159173), AAVrh.46 or variants thereof (e.g., SEQ ID NO: 4 and 22 of US20150159173), AAVrh.48 or variants thereof (e.g., SEQ ID NO: 44 of US20150159173), AAVrh.48.1 or variants thereof (e.g., SEQ ID NO: 45 of US20150159173), NO: 44), AAVrh.48.1.2 or a variant thereof, AAVrh.48.2 or a variant thereof, AAVrh.49 or a variant thereof (e.g., SEQ ID NO: 103 of WO2005033321), AAVrh.50 or a variant thereof (e.g., SEQ ID NO: 108 of WO2005033321), AAVrh.51 or a variant thereof (e.g., SEQ ID NO: 104 of WO2005033321), AAVrh.52 or a variant thereof (e.g., SEQ ID NO: 96 of WO2005033321), AAVrh.53 or a variant thereof (e.g., SEQ ID NO: 97 of WO2005033321), AAVrh.54 or a variant thereof (e.g., SEQ ID NO: 49 of US20150159173), AAVrh.56 or a variant thereof (e.g., SEQ ID NO: 105 of WO2005033321), ID NO: 152), AAVrh.57 or a variant thereof (e.g., SEQ ID NO: 105 of WO2005033321), AAVrh.58 or a variant thereof (e.g., SEQ ID NO: 48 of US20150159173), AAVrh.61 or a variant thereof (e.g., SEQ ID NO: . NO: 107), AAVrh.62 or a variant thereof (e.g., SEQ ID NO: 114 of WO2005033321), AAVrh.64 or a variant thereof (e.g., SEQ ID NO: 43 of US20150159173), AAVrh.64R1 or a variant thereof, AAVrh.64R2 or a variant thereof, AAVrh.67 or a variant thereof (e.g., SEQ ID NO: 47 of US20150159173), AAVrh.73 or a variant thereof (e.g., SEQ ID NO: 5 of US20150159173) or AAVrh.74 or a variant thereof (e.g., SEQ ID NO: 6 of US2015015917). Non-limiting examples of variants include SEQ ID NOs: 9, 27-45, 47-62, 66-69, 73-81, 84-94, 96, 97, 99 and 101-113 of US20030138772 (the contents of which are herein incorporated by reference in their entirety) and SEQ ID NOs: 1, 2, 4-82, 89, 90, 93-95, 98, 100, 101, 109-113, 118-120, 124, 126, 131, 139, 142, 151, 154, 158, 161, 162, 165-183, 202, 204-212, 215, 219 and 224-236 of WO2005033321 (the contents of which are herein incorporated by reference in their entirety). In one embodiment, the AAV serotype is any of those AAV serotypes described in US2021 / 0189430 (the contents of which are incorporated herein by reference in their entirety). The amino acid sequence of AAV may include one or more amino acid substitutions at one or more positions in the AAV capsid protein that interact with heparin sulfate proteoglycans or at one or more positions corresponding to amino acids 484, 487, 527, 532, 585, or 588, numbered based on the VP1 numbering of AAV2.

[0341] Unless otherwise indicated, the AAV ITRs and other selected AAV components described herein can be easily selected from any AAV serotype, including but not limited to AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9 or other known and unknown AAV serotypes. In one embodiment, ITRs are from AAV2. These ITRs or other AAV components can be easily separated from AAV serotypes using techniques available to those skilled in the art. Such AAVs can be isolated or obtained from academic, commercial or public sources (e.g., American Type Culture Collection (Manassas, Va.)). Alternatively, AAV sequences can be obtained by synthesis or other suitable means with reference to published sequences (e.g., sequences available in the literature or databases (e.g., GenBank, PubMed, etc.)).

[0342] AAV fragments suitable for assembly into vectors include cap proteins (including vp1, vp2, vp3 and hypervariable regions), rep proteins (including rep 78, rep 68, rep 52 and rep 40) and sequences encoding these proteins. These fragments can be easily used in various vector systems and host cells. These fragments can be used alone or in combination with other AAV serotype sequences or fragments, or in combination with elements from other AAV or non-AAV viral sequences. As used herein, artificial AAV serotypes include, but are not limited to, AAVs with non-naturally occurring capsid proteins. Such artificial capsids can be generated by any suitable technique using selected AAV sequences (e.g., fragments of vp1 capsid proteins) in combination with heterologous sequences that can be obtained from different selected AAV serotypes, non-continuous parts of the same AAV serotype, non-AAV viral sources or non-viral sources. Artificial AAV serotypes can be, but are not limited to, pseudotyped AAVs, chimeric AAV capsids, recombinant AAV capsids or "humanized" AAV capsids. Pseudotype vectors in which the capsid of one AAV is used with the ITR of an AAV having a different capsid protein are useful as described herein. In one embodiment, the AAV is AAV2 / 5 (i.e., an AAV having an AAV2 ITR and an AAV5 capsid). In another embodiment, the AAV is AAV2 / 8 (i.e., an AAV having an AAV2 ITR and an AAV8 capsid). In one embodiment, the AAV comprises an AAV8 capsid. Such AAV8 capsids include the amino acid sequence found under the NCBI reference sequence: YP_077180.1. In another embodiment, the AAV8 capsid includes a capsid encoded by nt 2121 to 4337 of GenBank accession number: AF513852.1.

[0343] In one embodiment, the vectors useful in the compositions and methods described herein contain at least a sequence encoding a selected AAV serotype capsid (e.g., an AAV2 capsid) or a fragment thereof. In another embodiment, the vectors useful contain at least a sequence encoding a selected AAV serotype rep protein (e.g., an AAV2 rep protein) or a fragment thereof. Optionally, such vectors may contain both AAV cap and rep proteins. In vectors providing AAV rep and cap, the AAV rep and AAV cap sequences may both be from one serotype, such as an AAV2 source.

[0344] Alternatively, a vector in which the rep sequence is from an AAV serotype different from the AAV serotype providing the cap sequence can be used. In one embodiment, the rep and cap sequences are expressed from different sources (e.g., different vectors, or host cells and vectors). In another embodiment, these rep sequences are fused in frame with the cap sequences of different AAV serotypes to form chimeric AAV vectors, such as those described in U.S. Pat. No. 7,282,199 (incorporated herein by reference).

[0345] A suitable recombinant AAV (rAAV) is produced by culturing a host cell containing a nucleic acid sequence encoding an AAV serotype capsid protein or a fragment thereof as defined herein; a functional rep gene; a minigene consisting of, for example, an AAV ITR and a trans-splicing molecule nucleic acid sequence; and sufficient auxiliary functions to allow the minigene to be packaged into the AAV capsid protein. The components required for culturing in a host cell to package the AAV minigene into the AAV capsid can be provided to the host cell in trans. Alternatively, any one or more required components (e.g., minigenes, rep sequences, cap sequences, and / or auxiliary functions) can be provided by a stable host cell that has been engineered to contain one or more required components using methods known to those skilled in the art.

[0346] In one embodiment, AAV includes a promoter (or a functional fragment of a promoter). The promoter used in rAAV can be selected from a large number of constitutive or inducible promoters that can express the selected transgene in the desired target cells. See, for example, the promoter list identified in International Patent Publication No. WO2014 / 012482 (incorporated herein by reference). In one embodiment, the promoter is cell-specific. The term "cell-specific" means that a specific promoter selected for a recombinant vector can guide the expression of the selected transgene in a specific cell type. In one embodiment, the promoter specifically expresses the transgene in photoreceptor cells. In another embodiment, the promoter specifically expresses the transgene in rod cells and / or cone cells. In another embodiment, the promoter specifically expresses the transgene in retinal pigment epithelium (RPE) cells. In another embodiment, the promoter specifically expresses the transgene in ganglion cells. In another embodiment, the promoter specifically expresses the transgene in Mueller cells (Mueller cell). In another embodiment, the promoter specifically expresses the transgene in bipolar cells. In another embodiment, the promoter specifically expresses the transgene in horizontal cells. In another embodiment, the promoter expresses the transgene specifically in amacrine cells. In another embodiment, the transgene is expressed in any of the above cells.

[0347] In another embodiment, the promoter is the natural promoter of the target gene to be expressed. Useful promoters include, but are not limited to, rod opsin promoter, red-green opsin promoter, blue opsin promoter, cGMP-phosphodiesterase promoter, mouse opsin promoter, rhodopsin promoter, α subunit of cone transduction, β phosphodiesterase (PDE) promoter, retinitis pigmentosa promoter, NXNL2 / NXNL 1 promoter, RPE65 promoter, retinal slow degeneration / peripheral protein 2 (Rds / perph2) promoter, and VMD2 promoter.

[0348] Other conventional regulatory sequences contained in minigenes or rAAVs are also disclosed in documents such as WO2014 / 124282 and other documents cited and incorporated by reference herein. Those skilled in the art can make choices among these and other expression control sequences without departing from the scope described herein.

[0349] The selected genetic elements can be delivered by any suitable method, including the methods described herein. Methods for constructing any of the embodiments described herein are known to those skilled in the art of nucleic acid manipulation, and include genetic engineering, recombinant engineering, and synthetic techniques. See, for example, Sambrook et al., Molecular Cloning. A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY. Similarly, methods for generating rAAV virions are well known, and the selection of suitable methods does not limit the methods and constructs described herein. See, for example, K. Fisher et al., J. V Virol., 1993 70: 520-532 and U.S. Pat. No. 5,478,745, each of which is incorporated herein by reference.

[0350] In another embodiment, the trans-splicing molecule is included in a proviral plasmid, such as those disclosed in International Patent Publication No. WO2012 / 158757 (incorporated herein by reference). Such a proviral plasmid contains a modular recombinant AAV genome comprising the following in operative association: a wild-type 5′ AAV2 ITR sequence flanked by unique restriction sites that allow easy removal or replacement of the ITR; a promoter comprising a 49 nucleic acid cytomegalovirus sequence located upstream of a cytomegalovirus (CMV)-chicken beta actin sequence; or a photoreceptor-specific promoter / enhancer, the promoter flanked by unique restriction sites that allow easy removal or replacement of the entire promoter sequence, and the upstream sequence flanked by unique restriction sites that allow easy removal or replacement of only the upstream CMV or enhancer sequence from the promoter sequence. The trans-splicing molecules described herein can be inserted into the site of a polyclonal polylinker, wherein the trans-splicing molecule is operably linked to the promoter and is under regulatory control of the promoter. A bovine growth hormone polyadenylation sequence flanked by unique restriction sites, allowing easy removal or replacement of the polyadenylation sequence; and a wild-type 3' AAV2 ITR sequence flanked by unique restriction sites, allowing easy removal or replacement of the 3' ITR; are also part of this plasmid. The plasmid backbone contains the elements necessary for replication in bacterial cells, such as the kanamycin resistance gene, and is itself flanked by transcription terminator / insulator sequences.

[0351] In one embodiment, the proviral plasmid comprises: (a) a modular recombinant AAV genome comprising the following in operative association: (i) a wild-type 5′ AAV2 ITR sequence flanked by unique restriction sites that allow easy removal or replacement of the ITR; (ii) a promoter comprising a 49 nucleic acid CMV sequence upstream of (A) a CMV-chicken beta actin sequence; (B) a photoreceptor-specific promoter / enhancer; or (C) a neuronal cell-specific promoter / enhancer. The promoter is flanked by unique restriction sites that allow easy removal or replacement of the entire promoter sequence, and the upstream sequence is flanked by unique restriction sites that allow easy removal or replacement of only the upstream CMV or enhancer sequence from the promoter sequence. A portion of the proviral plasmid also includes a polyclonal polylinker sequence that allows insertion of a trans-splicing molecule sequence including any sequence described herein, wherein the trans-splicing molecule is operably linked to a promoter and is regulated by the promoter; a bovine growth hormone polyadenylation sequence, flanked by unique restriction sites that allow easy removal or replacement of the polyadenylation sequence; and a wild-type 3′AAV2 ITR sequence flanked by unique restriction sites that allow easy removal or replacement of the 3′ITR. The proviral plasmid also contains a plasmid backbone that contains the elements necessary for replication in bacterial cells and a kanamycin resistance gene, and the plasmid backbone is flanked by transcription terminator / insulator sequences. The proviral plasmid described herein may also contain a non-coding lambda phage 5.1kb stuffer sequence in the plasmid backbone to increase backbone length and prevent reverse packaging of non-functional AAV genomes.

[0352] In yet another aspect, the promoter of the proviral plasmid is modified to reduce the size of the promoter, thereby allowing a larger trans-splicing molecule sequence to be inserted into rAAV. In one embodiment, the CMV / CBA hybrid promoter (which typically includes a total of about 1,000 base pairs of non-coding exons and introns) is replaced by a 130 base pair chimeric intron, as described in International Patent Publication No. WO 2017 / 087900 (incorporated herein by reference in its entirety).

[0353] These proviral plasmids are then used in current conventional packaging methods to generate recombinant viruses expressing trans-splicing molecule transgenes carried by the proviral plasmids. It is easy for those skilled in the art to select suitable production cell lines. For example, suitable host cells can be selected from any organism, including prokaryotic (e.g., bacterial) cells, and eukaryotic cells, including insect cells, yeast cells, and mammalian cells. Simply put, the proviral plasmid is transfected into the selected packaging cell, where it may exist temporarily. Alternatively, the small gene or gene expression cassette and its flanking ITR are stably integrated into the genome of the host cell in chromosomal form or episomal form. Suitable transfection techniques are known and can be easily used to deliver the recombinant AAV genome to the host cell. Typically, the proviral plasmid is cultured in a host cell expressing cap and / or rep proteins. In the host cell, the small gene consisting of the trans-splicing molecule and the flanking AAVITR is rescued and packaged into the capsid protein or envelope protein to form infectious viral particles. Thus, recombinant AAV infectious particles are produced by culturing packaging cells carrying the proviral plasmid in the presence of sufficient viral sequences to allow packaging of the gene expression cassette viral genome into the infectious AAV envelope or capsid.

[0354] Alternatively, a non-AAV vector (e.g., a non-viral vector) can be used to deliver the trans-splicing molecules. Any suitable non-viral vector technology known in the art or described herein can be used. Such non-viral vectors suitable for delivering trans-splicing molecules include liposomes (e.g., cationic liposomes, unilamellar liposomes, or multilamellar liposomes), nanoparticles (e.g., polymer nanoparticles, lipid nanoparticles (LNPs), pegylated nanoparticles (e.g., pegylated LNPs), peptide nanoparticles, metal nanoparticles, etc.), dendrimers (e.g., cationic dendrimers, such as polypropyleneimine dendrimers), exosomes (e.g., immunologically inert and / or targeted exosomes, such as those made using the techniques described in Alvarez-Erviti, et al., 2011, Nat. Biotechnol. 29: 341) and microvesicles. In some cases, cell penetrating peptides (CPPs) can be used to deliver the trans-splicing molecules described herein, which can transfer the plasma membrane of target cells and promote the delivery of trans-splicing molecules to the interior of target cells.

[0355] IV. Pharmaceutical Compositions and Kits

[0356] Provided herein are pharmaceutical compositions comprising nucleic acid trans-splicing molecules, proviral plasmids, or rAAVs comprising any ABCA4 nucleic acid trans-splicing molecules described herein. In some embodiments, the pharmaceutical composition comprises any 5' trans-splicing molecule described herein. In some embodiments, the pharmaceutical composition comprises a 5' trans-splicing molecule and a 3' trans-splicing molecule, for example; wherein the 5' trans-splicing molecule and the 3' trans-splicing molecule together contain a functional sequence of an ABCA4 exon and bind to the same target ABCA4 intron (e.g., intron 22).

[0357] Such pharmaceutical compositions can be prepared so that they are pure and uncontaminated and suitable for in vivo administration. The contamination of the pharmaceutical compositions described herein can be assessed by conventional methods and then formulated into pharmaceutical compositions intended for suitable routes of administration. Other compositions containing trans-splicing molecules (e.g., naked DNA) can also be formulated in a similar manner using suitable carriers. Such preparations involve the use of pharmaceutically and / or physiologically acceptable vehicles or carriers, particularly designated for administration to target cells (e.g., eye cells). In one embodiment, carriers suitable for administration to target cells include buffered saline, isotonic sodium chloride solutions or other buffers (e.g., HEPES) to maintain pH at appropriate physiological levels, as well as optional other pharmaceutical preparations, agents, stabilizers, buffers, carriers, adjuvants, diluents, etc.

[0358] In some embodiments, the carrier is an injection. Exemplary physiologically acceptable carriers include sterile, pyrogen-free water and sterile, pyrogen-free phosphate buffered saline. U.S. Patent No. 7,629,322 (incorporated herein by reference) provides a variety of such known carriers. In one embodiment, the carrier is an isotonic sodium chloride solution. In another embodiment, the carrier is a balanced salt solution. In one embodiment, the carrier includes tween. If the virus is to be stored for a long time, it can be frozen in the presence of glycerol or TWEEN 20.

[0359] In other embodiments, the compositions containing the trans-splicing molecules described herein include a surfactant. Useful surfactants may include, for example, Pluronic F68 (Poloxamer 188, also known as F68) because they can prevent AAV from adhering to inert surfaces, thereby ensuring the delivery of the desired dose. For example, an exemplary composition designed to treat an eye disease described herein comprises a recombinant adeno-associated vector carrying a nucleic acid sequence encoding a 5′ trans-splicing molecule or a 3′ trans-splicing molecule described herein and a pharmaceutically acceptable carrier, wherein the nucleic acid sequence is controlled by a regulatory sequence for expressing the trans-splicing molecule in an ocular cell of a mammalian individual. The carrier is an isotonic sodium chloride solution and includes a surfactant, Pluronic F68. In one embodiment, the trans-splicing molecule is any trans-splicing molecule described herein.

[0360] In yet another exemplary embodiment, the composition comprises a rAAV virus comprising any of the ABCA4 trans-splicing molecules described herein for ABCA4 gene correction, the nucleic acid sequence being controlled by a promoter directing expression of the trans-splicing molecule in photoreceptor cells, wherein the composition is formulated with a carrier and additional components suitable for subretinal injection. In another embodiment, the composition or components for producing or assembling the composition (including carriers, rAAV particles, surfactants, and / or components for generating rAAV) and suitable laboratory hardware for preparing the composition can be included in a kit. Such kits may also include instructions for administering the composition to an individual, e.g., for treating an eye disease, such as Stargardt's disease or Usher Syndrome.

[0361] Additionally provided herein are kits containing a pharmaceutical composition comprising a 5' trans-splicing molecule (eg, wherein the trans-splicing molecule is packaged in any AAV vector described herein). In some embodiments, the kit includes instructions for mixing the pharmaceutical composition prior to administration.

[0362] V Methods and Uses

[0363] Patients with ABCA4-related retinopathy present with similar but not identical clinical features. The vast majority have lipofuscin accumulation and bilateral visual loss. ABCA4-related Stargardt disease typically shows characteristic macular atrophy, often with a bronze appearance on funduscopy. Fundus xanthophyma is similar but may show less macular atrophy and the presence of larger yellow-white spots in the macula extending into the mid-peripheral area. Subjects with ABCA4-related cone-rod dystrophy present with visual symptoms such as visual loss, impaired color vision, and central scotoma.

[0364] The clinical manifestations of ABCA4-related Stargardt disease can be divided into childhood-onset, adult-early onset, and adult-late onset. Each of these groups may have its own phenotypic variations that are associated with specific ABCA4 variants.

[0365] Childhood onset: Children with biallelic severe ABCA4 variants present with more aggressive central vision loss due to macular dysfunction alone or in combination with cone-rod dystrophy, typically occurring between the ages of five and eleven years.

[0366] Maturity-onset: These patients typically present with central vision loss due to foveal atrophy in their second or third decade of life. At presentation, funduscopy typically shows marked macular atrophy with numerous paramacular and peripheral flecks. These patients typically carry ABCA4 variants with a moderate effect on ABCA4 function (e.g., c.6079C>T and c.[2588G>C;5603A>T]), either with an effect on both alleles or in compound heterozygous combinations with null / severe ABCA4 variants.

[0367] Adult late hair The definition of "late" onset disease varies from age ≥35 years to age ≥50 years. Thus, patients may present with symptoms from age 40 years onwards. Patients are often discovered incidentally during retinal screening because of relatively well preserved best corrected visual acuity (BCVA), which is thought to be explained by the fact that atrophy spares the fovea.

[0368] Most patients with ABCA4-related retinopathy are diagnosed / present symptoms in their mid-twenties, which can have a significant impact on their development, independence, education, and overall quality of life. Additionally, some of the more severe forms, such as cone-rod dystrophy, begin in early childhood, as young as 5 years of age. A study of 95 patients with Stargardt's disease found that once visual acuity (VA) dropped below 20 / 40, there was a rapid loss of vision to 20 / 200. Additionally, the probability of maintaining 20 / 40 or better vision in at least one eye was 52% at age 19, but this dropped to 22% by age 39. In general, the earlier onset and more severe forms of cone-rod dystrophy and childhood-onset Stargardt's disease are often associated with biallelic null variants of ABCA4. These childhood / early-onset forms present with symptomatic central scotoma and rapidly progressive atrophy, with most pediatric patients showing damage to rod photoreceptors at the time of diagnosis, an indicator of a poor prognosis. Another consideration is that young patients with ABCA4 retinopathy may present with amblyopia. Amblyopia is caused by early visual development defects, which can lead to impaired vision, reduced stereopsis and impaired fusion. It is understood that if it is not corrected during the critical period of 7-9 years old, it will cause permanent effects. Some studies have shown that adolescents may still retain a certain potential for neuroplasticity. This makes the inventors expect that treating pediatric subjects with retinopathy with the ABCA4 exon editor described herein before the end of the critical period will have greater efficacy.

[0369] The above-mentioned nucleic acid trans-splicing molecules (e.g., nucleic acid trans-splicing molecules and nucleic acid trans-splicing molecule encoding vectors) and compositions can be used to express functional ABCA4 and / or regulate the expression of ABCA4 in target cells (e.g., eye cells, retinal cells, photoreceptors and / or RPE cells) of an individual, for example, for treating diseases or disorders associated with ABCA4 gene mutations, such as ABCA4-related retinal dystrophy, such as Stargardt's disease and cone-rod dystrophy, including methods for delaying or ameliorating symptoms associated with the diseases described herein. The above-mentioned nucleic acid trans-splicing molecules (e.g., nucleic acid trans-splicing molecules and nucleic acid trans-splicing molecule encoding vectors) and compositions can also be used to express functional ABCA4 and / or regulate the expression of ABCA4 in target cells (e.g., eye cells, retinal cells, photoreceptors and / or RPE cells) of an individual, for example, for its use in treating diseases or conditions associated with ABCA4 gene mutations, such as ABCA4-related retinal dystrophy, such as Stargardt's disease and cone-rod dystrophy, including delaying or improving symptoms associated with the diseases described herein, or for its use in the preparation of a medicament for treating diseases or conditions associated with ABCA4 gene mutations, such as ABCA4-related retinal dystrophy, such as Stargardt's disease and cone-rod dystrophy, including delaying or improving symptoms associated with the diseases described herein. Such methods and uses involve contacting a target ABCA4 gene (e.g., ABCA4 mRNA precursor) with a trans-splicing molecule as described herein [e.g., a 5' trans-splicing molecule, or a mixture of 3' and 5' trans-splicing molecules as described herein, a composition (e.g., a pharmaceutical composition) comprising the same, or a medicament comprising the same] under conditions where the CDS of the trans-splicing molecule is spliced ​​to the target ABCA4 mRNA precursor, to replace a portion of the targeted mRNA precursor carrying one or more defects or mutations with a functional (i.e., healthy), normal or wild-type or corrected mRNA of the targeted gene, thereby correcting the expression of ABCA4 in the target cell. Thus, the methods and compositions can be used to treat ocular diseases / lesions associated with specific mutations and / or gene expression.

[0370] In some cases, provided herein are methods for expressing functional ABCA4 in target cells by contacting (e.g., transducing) the target cells with any nucleic acid trans-splicing molecule, vector (e.g., AAV vector), or composition described herein. In one embodiment, contacting involves administering a composition (e.g., a pharmaceutical composition) directly to a diseased individual. In another embodiment, contacting can be performed in vitro, with cultured cells and treated ocular cells reimplanted into the individual. In another embodiment, the method involves administering an rAAV carrying any 5'ABCA4 trans-splicing molecule described herein. In yet another embodiment, the method involves administering a mixture of an rAAV carrying a 3' trans-splicing molecule and an rAAV carrying a 5' trans-splicing molecule. These methods include administering an effective concentration of any composition described herein to an individual in need thereof.

[0371] In some embodiments, the method comprises selecting one or more trans-splicing molecules to treat an individual with a condition associated with an ABCA4 mutation. In some embodiments, the use of one or more trans-splicing molecules to treat an individual with a condition associated with an ABCA4 mutation, or the use thereof for the preparation of a medicament for treating an individual with a condition associated with an ABCA4 mutation, is contemplated herein. Such methods and uses comprise selecting one or more trans-splicing molecules to treat an individual with a condition associated with an ABCA4 mutation, or using one or more trans-splicing molecules so selected to treat an individual with a condition associated with an ABCA4 mutation, or using one or more trans-splicing molecules so selected to prepare a medicament for treating an individual with a condition associated with an ABCA4 mutation. Such selection may be based on the genotype of the individual. In some embodiments, the condition associated with ABCA4 may be an autosomal recessive condition. In some cases, the individual is homozygous or compound heterozygous for an ABCA4 mutation. Methods for screening and identifying specific mutations in ABCA4 are known in the art.

[0372] The methods of the invention include selecting a single trans-splicing molecule based on the location of a single mutation in ABCA4 (e.g., a mutation in one allele of an individual). In some cases in the context of an autosomal recessive mutation, correcting only one of the two mutations is sufficient to restore functional protein activity, e.g., where the second allele has a mutation on the opposite portion of the ABCA4 gene, beyond the scope of a single AAV-delivered trans-splicing molecule configured to correct the first mutation. Thus, in some embodiments, the methods of the invention include administering a single trans-splicing molecule to correct a single mutation on the 5′ portion of the target gene, e.g., without regard to the location of the mutation in the other allele.

[0373] In addition, the present invention provides methods involving the selection of a single trans-splicing molecule to correct two or more mutations on the 5′ portion of the ABCA4 gene, such that a single trans-splicing molecule that can be packaged in an AAV vector can span two or all mutations, thereby correcting two or all mutations.

[0374] In other embodiments, provided herein are methods for correcting multiple mutations within an ABCA4 gene using two trans-splicing molecules (a 5' trans-splicing molecule and a 3' trans-splicing molecule). In some embodiments, the entire ABCA4 gene is replaced after binding and trans-splicing of the two trans-splicing molecules, for example, wherein the 5' trans-splicing molecule and the 3' trans-splicing molecule bind to the same target ABCA4 intron and replace exons upstream and downstream of the target intron, respectively.

[0375] In some embodiments, as a method of treating a disease or condition, a composition provided herein is administered to an individual. In some embodiments, the individual suffers from a genetic disease, such as an ABCA4-related retinopathy described herein. In some embodiments, the individual is at risk of developing a disease, such as an ABCA4-related retinopathy described herein. In some embodiments, the individual is at increased risk of developing a disease or condition caused by insufficient amounts of a protein (e.g., an ABCA protein) or insufficient activity of a protein (e.g., an ABCA protein). If the individual suffers from an "increased risk" of a disease or condition caused by insufficient amounts of a protein or insufficient activity of a protein, the method involves prophylactic or preventive treatment. For example, due to a family history of a disease, an individual may be at increased risk of developing such a disease or condition. Typically, individuals at increased risk of developing such diseases or conditions benefit from preventive treatment (e.g., by preventing or delaying the onset or progression of the disease or condition).

[0376] The effective concentration range of the recombinant adeno-associated virus carrying the trans-splicing molecule described herein is about 10 8 Up to 10 13 rAAV infectious units are measured as described in McLaughlin et al., J. Virol. 1988, 62:1963. In another embodiment, the concentration range is 10 9 Up to 10 13 In another embodiment, the effective concentration is about 1.5×10 11 In another embodiment, the effective concentration is about 5×10 11 In one embodiment, the effective concentration is about 1.5×10 10 In another embodiment, the effective concentration is about 2.8×10 11In yet another embodiment, the effective concentration is about 1.5×10 12 In another embodiment, the effective concentration is about 1.5×10 13 vg / mL.

[0377] In some embodiments, the concentration range is 4.0×10 10 With 1×10 12 vg / eye. In some embodiments, the effective concentration is about 1.0×10 11 vg / eye. In some embodiments, the effective concentration is about 4.3×10 10 vg / eye.

[0378] It is desirable to use the lowest effective dose (total number of genome copies delivered) of the virus to reduce the risk of adverse effects, such as toxicity, and other problems associated with ocular administration, such as retinal dysplasia and detachment. The effective dose range of the recombinant adeno-associated virus carrying the trans-splicing molecule as described herein is about 10 per dose (i.e., per injection). 8 with 10 13 In one embodiment, the dosage range is between 10 9 with 10 13 In another embodiment, the effective dose is about 1.5×10 11 In another embodiment, the effective dose is about 5×10 11 In one embodiment, the effective dose is about 1.5×10 10 In another embodiment, the effective dose is about 2.8×10 11 In yet another embodiment, the effective dose is about 1.5×10 12 In another embodiment, the effective concentration is about 1.5×10 13 vg. The attending physician may also select other dosages within these ranges or other units taking into account the physical condition of the individual being treated, including the individual's age, the composition being administered and the particular disorder, the cells being targeted and the extent of the disorder (if progressive).

[0379] The composition can be delivered in a volume of about 50 μL to about 1 mL, including all numbers within this range, depending on the size of the area to be treated, the viral titer used, the route of administration, and the desired effect of the method. In one embodiment, the volume is about 50 μL. In another embodiment, the volume is about 70 μL. In another embodiment, the volume is about 100 μL. In another embodiment, the volume is about 125 μL. In another embodiment, the volume is about 150 μL. In another embodiment, the volume is about 175 μL. In another embodiment, the volume is about 200 μL. In another embodiment, the volume is about 250 μL. In another embodiment, the volume is about 300 μL. In another embodiment, the volume is about 350 μL. In another embodiment, the volume is about 400 μL. In another embodiment, the volume is about 450 μL. In another embodiment, the volume is about 500 μL. In another embodiment, the volume is about 600 μL. In another embodiment, the volume is about 750 μL. In another embodiment, the volume is about 850 μL. In another embodiment, the volume is about 1,000 μL.

[0380] In some embodiments, a composition comprising an RNA exon editor described herein (e.g., an RNA exon editor comprising SEQ ID NO: 90, SEQ ID NO: 78, or SEQ ID NO: 69) can be provided as a suspension suitable for injection. In some embodiments, an RNA exon editor described herein (e.g., an RNA exon editor comprising SEQ ID NO: 90, SEQ ID NO: 78, or SEQ ID NO: 69) can be administered by subretinal injection in a fixed volume of 300 μL via a small gauge cannula after vitrectomy.

[0381] In one embodiment, the volume and concentration of the rAAV composition are selected so that only certain anatomical regions with target cells are affected. In another embodiment, the volume and / or concentration of the rAAV composition is greater so as to reach a greater portion of the eye. Similarly, the dosage administered to other organs will also be adjusted.

[0382] In some embodiments, the treatments and uses described herein replace 10% or more of the target ABCA4 mRNA in the target cells (e.g., 11% or more of the target ABCA4 mRNA in the target cells, 12% or more of the target ABCA4 mRNA in the target cells, 13% or more of the target ABCA4 mRNA in the target cells, 14% or more of the target ABCA4 mRNA in the target cells, 15% or more of the target ABCA4 mRNA in the target cells, 16% or more of the target ABCA4 mRNA in the target cells, 17% or more of the target ABCA4 mRNA in the target cells, 18% or more of the target ABCA4 mRNA in the target cells, or 19% or more of the target ABCA4 mRNA in the target cells). In some embodiments, the treatments and uses described herein replace 20% or more of the target ABCA4 mRNA in the target cells [e.g., 21% or more of the target ABCA4 mRNA in the target cells, 22% or more of the target ABCA4 mRNA in the target cells, 23% or more of the target ABCA4 mRNA in the target cells, 24% or more of the target ABCA4 mRNA in the target cells, 25% or more of the target ABCA4 mRNA in the target cells, 26% or more of the target ABCA4 mRNA in the target cells, 27% or more of the target ABCA4 mRNA in the target cells, 28% or more of the target ABCA4 mRNA in the target cells, 29% or more of the target ABCA4 mRNA in the target cells, 30% or more of the target ABCA4 mRNA in the target cells, 31% or more of the target ABCA4 mRNA in the target cells, 32% or more of the target ABCA4 mRNA in the target cells, 33% or more of the target ABCA4 mRNA in the target cells, 34% or more of the target ABCA4 mRNA in the target cells, 35% or more of the target ABCA4 mRNA in the target cells] mRNA, 36% or more of the target ABCA4 mRNA in the target cells, 37% or more of the target ABCA4 mRNA in the target cells, 38% or more of the target ABCA4 mRNA in the target cells, 39% or more of the target ABCA4 mRNA in the target cells, 40% or more of the target ABCA4 mRNA in the target cells, 41% or more of the target ABCA4 mRNA in the target cells, 42% or more of the target ABCA4 mRNA in the target cells, 43% or more of the target ABCA4 mRNA in the target cells, 44% or more of the target ABCA4 mRNA in the target cells, 45% or more of the target ABCA4 mRNA in the target cells, 46% or more of the target ABCA4 mRNA in the target cells, 47% or more of the target ABCA4 mRNA in the target cells, 48% or more of the target ABCA4 mRNA in the target cells, 49% or more of the target ABCA4mRNA, 50% or more of the target ABCA4 mRNA in the target cells, 51% or more of the target ABCA4 mRNA in the target cells, 52% or more of the target ABCA4 mRNA in the target cells, 53% or more of the target ABCA4 mRNA in the target cells, 54% or more of the target ABCA4 mRNA in the target cells, 55% or more of the target ABCA4 mRNA in the target cells, 56% or more of the target ABCA4 mRNA in the target cells, 57% or more of the target ABCA4 mRNA in the target cells, 58% or more of the target ABCA4 mRNA in the target cells, 59% or more of the target ABCA4 mRNA in the target cells, 60% or more of the target ABCA4 mRNA in the target cells, 61% or more of the target ABCA4 mRNA in the target cells, 62% or more of the target ABCA4 mRNA in the target cells, 63% or more of the target ABCA4 mRNA in the target cells, 64% or more of the target ABCA4 mRNA in the target cells, 65% or more of the target ABCA4 mRNA in the target cells, 66% or more of the target ABCA4 mRNA, 67% or more of the target ABCA4 mRNA in the target cells, 68% or more of the target ABCA4 mRNA in the target cells, 69% or more of the target ABCA4 mRNA in the target cells, 70% or more of the target ABCA4 mRNA in the target cells; 75% or more of the target ABCA4 mRNA in the target cells; 80% or more of the target ABCA4 mRNA in the target cells; 85% or more of the target ABCA4 mRNA in the target cells; 90% or more of the target ABCA4 mRNA in the target cells; 95% or more of the target ABCA4 mRNA in the target cells].

[0383] In some embodiments, the treatments and uses described herein replace 5% or 10% or more of the target ABCA4 protein in the target cells [e.g., 11% or more of the target ABCA4 protein in the target cells, 12% or more of the target ABCA4 protein in the target cells, 13% or more of the target ABCA4 protein in the target cells, 14% or more of the target ABCA4 protein in the target cells, 15% or more of the target ABCA4 protein in the target cells, 16% or more of the target ABCA4 protein in the target cells, 17% or more of the target ABCA4 protein in the target cells, 18% or more of the target ABCA4 protein in the target cells, or 19% or more of the target ABCA4 protein in the target cells]. In some embodiments, the treatments and uses described herein replace 20% or more of the target ABCA4 protein in the target cells [e.g., 21% or more of the target ABCA4 protein in the target cells, 22% or more of the target ABCA4 protein in the target cells, 23% or more of the target ABCA4 protein in the target cells, 24% or more of the target ABCA4 protein in the target cells, 25% or more of the target ABCA4 protein in the target cells, 26% or more of the target ABCA4 protein in the target cells, 27% or more of the target ABCA4 protein in the target cells, 28% or more of the target ABCA4 protein in the target cells, 29% or more of the target ABCA4 protein in the target cells, 30% or more of the target ABCA4 protein in the target cells, 31% or more of the target ABCA4 protein in the target cells, 32% or more of the target ABCA4 protein in the target cells, 33% or more of the target ABCA4 protein in the target cells, 34% or more of the target ABCA4 protein in the target cells, 35% or more of the target ABCA4 protein in the target cells, 36% or more of the target ABCA4 protein in the target cells, 37% or more of the target ABCA4 protein in the target cells] protein, 38% or more of the target ABCA4 protein in the target cells, 39% or more of the target ABCA4 protein in the target cells, 40% or more of the target ABCA4 protein in the target cells, 41% or more of the target ABCA4 protein in the target cells, 42% or more of the target ABCA4 protein in the target cells, 43% or more of the target ABCA4 protein in the target cells, 44% or more of the target ABCA4 protein in the target cells, 45% or more of the target ABCA4 protein in the target cells, 46% or more of the target ABCA4 protein in the target cells, 47% or more of the target ABCA4 protein in the target cells more of the target ABCA4 protein, 48% or more of the target ABCA4 protein in the target cells, 49% or more of the target ABCA4 protein in the target cells, 50% or more of the target ABCA4 protein in the target cells, 51% or more of the target ABCA4 protein in the target cells, 52% or more of the target ABCA4 protein in the target cells, 53% or more of the target ABCA4 protein in the target cells, 54% or more of the target ABCA4 protein in the target cells, 55% or more of the target ABCA4 protein in the target cells, 56% or more of the target ABCA4 protein in the target cells,57% or more of the target ABCA4 protein in the target cells, 58% or more of the target ABCA4 protein in the target cells, 59% or more of the target ABCA4 protein in the target cells, 60% or more of the target ABCA4 protein in the target cells, 61% or more of the target ABCA4 protein in the target cells, 62% or more of the target ABCA4 protein in the target cells, 63% or more of the target ABCA4 protein in the target cells, 64% or more of the target ABCA4 protein in the target cells, 65% or more of the target ABCA4 protein in the target cells, 66% or more of the target ABCA4 protein in the target cells , 67% or more of the target ABCA4 protein in the target cells, 68% or more of the target ABCA4 protein in the target cells, 69% or more of the target ABCA4 protein in the target cells, 70% or more of the target ABCA4 protein in the target cells; 75% or more of the target ABCA4 protein in the target cells; 80% or more of the target ABCA4 protein in the target cells; 85% or more of the target ABCA4 protein in the target cells; 90% or more of the target ABCA4 protein in the target cells; 95% or more of the target ABCA4 protein in the target cells].

[0384] When referring to increasing the level of functional ABCA4 protein, the increase may be clinically significant. The increase may be relative to the level of functional ABCA4 protein in an untreated subject, or relative to the amount of functional ABCA4 protein in a similar subject population. The increase in functional ABCA4 protein may be at least a 10% increase relative to the subject or similar subject population before treatment. The increase in functional ABCA4 protein may be at least a 20% increase relative to the subject or similar subject population before treatment. The increase in functional ABCA4 protein may be at least a 40% increase relative to the subject or similar subject population before treatment. The increase in functional ABCA4 protein may be at least a 50% increase relative to the subject or similar subject population before treatment. The increase in functional ABCA4 protein may be at least an 80% increase relative to the subject or similar subject population before treatment. The increase in functional ABCA4 protein may be at least a 100% increase relative to the subject or similar subject population before treatment. The increase in functional ABCA4 protein may be at least a 200% increase relative to the subject or similar subject population before treatment. The increase in functional ABCA4 protein may be at least 500% relative to the subject or a similar population of subjects prior to treatment.

[0385] In some cases, the methods and uses described herein reduce ABCA4-associated lipofuscin in a subject (e.g., a subject with ABCA4-associated retinal dystrophy). In other cases, the methods and uses described herein reduce A2E accumulation in a subject (e.g., a subject with ABCA4-associated retinal dystrophy).

[0386] For each of the methods and uses described, the treatment or use can be used to prevent further damage from occurring, or to rescue tissue with mild, moderate or advanced disease. As used herein, the term "rescue" refers to preventing disease progression, preventing the spread of damage to uninjured cells, and / or ameliorating damage to injured cells.

[0387] Thus, in one embodiment, the composition is administered before the onset of the disease. In another embodiment, the composition is administered before the onset of symptoms. In another embodiment, the composition is administered after the onset of symptoms. In yet another embodiment, the composition is administered when, for example, less than 90% of the target cells are functional or remaining compared to a reference tissue. In yet another embodiment, the composition is administered when, for example, more than 10% of the target cells are functional or remaining compared to a reference tissue. In yet another embodiment, the composition is administered when more than 20% of the target cells are functional or remaining. In yet another embodiment, the composition is administered when more than 30% of the target cells are functional or remaining. In yet another embodiment, the composition is administered when more than 40% of the target cells are functional or remaining. In yet another embodiment, the composition is administered when more than 50% of the target cells are functional or remaining. In yet another embodiment, the composition is administered when more than 60% of the target cells are functional or remaining. In yet another embodiment, the composition is administered when more than 70% of the target cells are functional or remaining. In yet another embodiment, the composition is administered when more than 80% of the target cells are functional or remaining. In yet another embodiment, the composition is administered when greater than 90% of the target cells are functional or remaining. In yet another embodiment, the composition is administered when greater than 95% of the target cells are functional or remaining.

[0388] In yet another embodiment, any of the methods or uses described above are combined with another therapy or secondary therapy. The therapy may be any currently known or not yet known therapy that helps prevent, prevent or ameliorate these mutations or defects or any effects associated therewith. The secondary therapy may be administered before, simultaneously with or after the administration of the pharmaceutical composition described above. In one embodiment, the secondary treatment involves non-specific methods of maintaining retinal cell health, such as administering neurotrophic factors, antioxidants and / or anti-apoptotic agents. Non-specific methods are achieved by injection of proteins, recombinant DNA, recombinant viral vectors, stem cells, fetal tissue or genetically modified cells. The latter may include encapsulated genetically modified cells.

[0389] In another embodiment, the method includes performing functional and imaging studies to determine the therapeutic effect. These studies include ERG and in vivo retinal imaging, as described in U.S. Patent No. 8,147,823 and International Patent Publication No. WO 2014 / 011210 or WO 2014 / 124282, which are incorporated herein by reference. In addition, visual field studies, visual field examinations (e.g., dynamic visual field examinations or full-field static visual field examinations) and microperimetry, slit lamp examinations, intraocular pressure measurements, mydriatic funduscopy examinations, activity tests, vision and / or color vision tests can also be performed. Efficacy can be measured at a time point after administering a nucleic acid trans-splicing molecule as described herein and an RNA exon editor encoded thereby or a composition (e.g., a pharmaceutical composition) comprising them, to determine, for example, whether the symptoms of ABCA4-related retinopathy in the treated subject are alleviated compared to untreated subjects. In some embodiments, efficacy can be measured, for example, by an improvement in vision and / or color vision or a reduction in lipofuscin (including A2E accumulation).

[0390] In certain embodiments, non-invasive retinal imaging and functional studies are required to identify the areas of preserved photoreceptors targeted by the therapy. In these embodiments, clinical diagnostic tests are used to determine the precise location of one or more subretinal injections. These tests may include ERG, visual field examination, topographic mapping of retinal layers and measurement of the thickness of their layers by confocal scanning laser ophthalmoscope (cSLO) and optical coherence tomography (OCT), topographic mapping of cone density by adaptive optics (AO), functional ophthalmological examination, etc. In view of imaging and functional studies, in some embodiments, one or more injections are performed in the same eye to target different areas of preserved photoreceptors.

[0391] For use in these methods, the volume and viral titer of each injection is determined individually and may be the same or different from other injections performed in the same eye or in the contralateral eye. In another embodiment, a single larger volume injection is performed to treat the entire eye. Dosages, administration, and regimens may be determined by the attending physician based on the teachings of the present disclosure.

[0392] The following examples do not limit the scope of the embodiments described herein. Those skilled in the art will appreciate that modifications may be made to the following examples without departing from the spirit or scope of the present invention.

[0393] Example

[0394] The following examples provide non-limiting methods of making the above-described compositions and using the above-described compositions.

[0395] Example 1. Trans-splicing efficiency in cultured human cells

[0396] ABCA4 trans-splicing molecules were tested in cultured human cells using a high-throughput NGS-based assay in which various permutations of each trans-splicing molecule were tested. The results are shown in Figure 1 Each ABCA4 trans-splicing molecule in this example includes a 5′ regulatory domain (including a CMV promoter and a native 5′UTR) and a functional ABCA4 CDS. The domains that vary across trans-splicing molecules are the linker domain, the binding domain (BD), the 3′ DS, and the terminator. In this example, the trans-splicing molecules were transfected into cells as plasmids and detected by unique molecular identifiers (UMIs) according to known RNA-seq methods. The trans-splicing efficiency readouts indicate that certain domains exhibit improved trans-splicing in many or all permutations. For example, here, the 40-mer linker of SEQ ID NO: 27 unexpectedly exhibited the highest trans-splicing efficiency relative to the shorter linkers of SEQ ID NOs: 29 and 31. In addition, the binding domain with SEQ ID NO: 18 exhibited the highest trans-splicing efficiency among all the binding domains tested. It is also noteworthy that certain combinations of linker domains, BDs, and splice sites (SS) confer surprising relative trans-splicing efficiency levels.

[0397] Example 2. Splice site assessment

[0398] Next generation sequencing was used to test the splice sites in the ABCA4 nucleic acid trans-splicing molecule library with a total of 550 adapter sequences. The five splice sites tested were CAAAGT, GTAACT, GTAAGC, GTAAGG and GTAAGT. The RNA sequences encoded thereby are referred to herein as GUAAGU, GUAAGG, GUAAGC and GUAACU, respectively. Figure 2 Trans-splicing activity (exon editing activity) is shown in arbitrary units. These results show that among the five splicing sites tested, the splicing site containing GTAAGT confers the highest trans-splicing activity. Therefore, the exemplary splicing domain described herein contains GUAAGT, which is encoded by GTAAGT.

[0399] Example 3. ABCA4 trans-splicing in cultured human cells

[0400] Cultured human cells (HEK-293T) were transduced with AAV encoding various ABCA4 trans-splicing molecules (RNA exon editors) at MOI = 100,000 and incubated for three days before harvesting the cells. AAV-56 is an AAV vector encoding an ABCA4 trans-splicing molecule having SEQ ID NO: 40. AAV-274 is an AAV vector encoding an ABCA4 trans-splicing molecule having SEQ ID NO: 41. AAV-443 is an AAV vector encoding an ABCA4 trans-splicing molecule having SEQ ID NO: 42. AAV-497 is an AAV vector encoding an ABCA4 trans-splicing molecule having SEQ ID NO: 43. AAV-505 is an AAV vector encoding an ABCA4 trans-splicing molecule having SEQ ID NO: 44.

[0401] Membrane proteins were extracted using conventional methods. Briefly, permeabilization buffer and protease / phosphatase inhibitors were added to the cells, vortexed, and incubated at 4°C for 10 minutes. The permeabilized cells were centrifuged and the pellet was resuspended in lysis buffer containing protease / phosphatase inhibitors. The samples were incubated at 4°C for 30 minutes and then centrifuged. The supernatant containing membrane proteins was transferred and stored at -80°C.

[0402] RNA was extracted by conventional methods and quantified by RT-qPCR. The percentage of target ABCA4 trans-splicing was normalized to the copy number of the trans-spliced ​​molecule. Figure 3A RNA results are shown, showing the percentage of ABCA4 mRNA replaced by each trans-splicing molecule (exon editing). Figure 3B Shown is a Western blot using anti-ABCA4 C-terminal antibody and anti-NaK / ATPase antibody as a loading control.

[0403] AAV-274, AAV-443, AAV-497, and AAV-505 each exhibited improved trans-splicing efficiency relative to AAV-56 (37.3%, 38.7%, 28.5%, and 28.5%, respectively, relative to 23.8%). AAV-274 and AAV-443 each exhibited significantly higher on-target copy numbers compared to AAV-56.

[0404] Similar assays were performed to compare the trans-splicing efficiency between AAV-443-2 (SEQ ID NO: 45) and AAV-652 (SEQ ID NO: 46) using ABCA4 knock-in cells as a positive control and untreated HEK293T cells as a negative control. Figure 3C Western blots showing protein expression in duplicate samples of each of AAV-443-2 and AAV-652 are shown. Figure 3D Notably, complete restoration of ABCA4 protein levels was observed in ABCA4 knockout cells ( Figure 3D ).

[0405] Example 4. Evaluation of ABCA4 trans-splicing molecules in non-human primates

[0406] Recessive inherited mutations in ABCA4 are responsible for progressive blindness, including Stargardt's disease 1 and cone-rod dystrophy 3. The 6882bp coding sequence of ABCA4 is too large to be delivered intact by a single AAV vector. In addition, since hundreds of pathogenic mutations have been found throughout the gene, a single base editing approach cannot address the problem for a large number of patients. Large-scale exon editing solutions aim to deliver therapeutic RNA constructs that can be trans-spliced ​​into endogenous ABCA4 mRNA precursors, thereby introducing functional exons and correcting a large number of mutations located in functional exons delivered by trans-splicing. In fact, RNA trans-splicing using a single AAV-based construct can address approximately 60% of all patient mutations. This example reports the editing efficiency and tolerability of the AAV-ABCA4 exon editor in vivo after subretinal injection in healthy African green monkey (AGM) nonhuman primates (NHPs).

[0407] Exon editors 443 (SEQ ID NO: 47), 274 (SEQ ID NO: 48), 497 (SEQ ID NO: 49) and 505 (SEQ ID NO: 50) were packaged in AAV8 vectors. AAV8 vector preparations were characterized using qPCR titration of common regulatory elements, Stunner measurement of complete and empty capsids, and measurement of endotoxin levels. The results are shown in Table 2 below.

[0408] Table 2. AAV characterization

[0409]

[0410] The VP1, VP2, and VP3 proteins of each preparation were detected and visualized on SDS gels at 5 × 10 vg / well ( Figure 4 ).

[0411] A GFP-encoding AAV vector containing the 5′ regulatory domain of SEQ ID NO: 15 (i.e., containing the CMV promoter and the native 5′ ABCA4 untranslated region) was administered subretinaly in African green monkey (AGM) nonhuman primates (NHPs). GFP protein expression is shown in Figures 5A-5C middle. Figure 5A is a real-time image showing the GFP protein. Figure 5Bare photomicrographs showing anti-GFP immunohistochemistry (IHC) staining of retinal sections in day 28 negative control (photoreceptors and choroid are labeled). Figure 5C is a micrograph showing anti-GFP IHC staining of retinal sections (photoreceptors and choroid are labeled) from animals treated with GFP exon editor at day 28. These results demonstrate that the 5′ regulatory domain confers robust protein expression in photoreceptors in vivo.

[0412] ABCA4 exon editor was formulated into AAV8 and administered subretinally in two blisters per eye in AGM NHPs. Each injection contained 1 × 10 11 vg. Figure 6 cSLO and OCT images at baseline, after subretinal injection, day 14, and day 28 are shown. Superior and inferior blebs were observed after injection. By day 28, a slight 'shadow' was observed in the bleb area. Clinical scoring of vehicle, exon editor 443, and trans-splicing molecule 274 was performed using color fundus imaging at day 28 ( Figure 7 ). The total clinical scores for vehicle, exon editor 443, and trans-splicing molecule 274 were 17, 0, and 1, respectively.

[0413] Exon editing of the ABCA4 exon editor in the AGM NHP retina was assessed using quantitative RT-PCR to quantify RNA and western blotting to quantify ABCA4 protein. To measure trans-spliced ​​ABCA4 mRNA, chimeric mRNA junctions between human and AGM sequences were detected using quantitative RT-PCR, as described in Fig. 8A For each ABCA4 exon editor, trans-spliced ​​mRNA was quantified as the number of edited copies per 10 ng RNA ( Figure 8B and Table 4).

[0414] Table 4. Editing copy number / 10ngRNA

[0415] Exon Editor average value Standard Deviation (vehicle) 0 0 443 464880.29 464880.29 274 45380.29 45380.29 497 328749.88 328749.88 505 30594.16 30594.16

[0416] For each ABCA4 exon editor, tagged full-length trans-spliced ​​ABCA4 protein was quantified in membrane extracts of the retina by western blotting of the tag. Fig. 9 An exemplary Western blot showing full-length ABCA4 expression of exon editors 443, 274, 497, and 505 is shown.

[0417] To confirm that the expressed protein was chimeric human / AGM (and therefore a trans-splicing product), mass spectrometry experiments were performed. Unique peptides that distinguished full AGM NHP ABCA4 from chimeric edited ABCA4 were identified by immunoaffinity enrichment combined with MRM-MS. The identity of the peptides was confirmed by spiking standards. In vehicle-treated retinas ( Fig. 10A ), only NHP peptides were observed. In exon editor-treated retinas ( Fig. 10B ), human and NHP peptides were detected. This result confirms that the full-length exon-edited mRNA is translated.

[0418] Eye health was monitored throughout the study. Overall, retinal thickness ( Fig.11A ), intraocular pressure ( Fig. 11B ), total clinical score ( Fig. 11C ), vitreous cell score ( Fig.11D ), aqueous humor cell score ( Fig.11E ) and inflammatory corneal granules ( Fig.11F ) measured, ocular health was maintained following treatment with exon editors delivered subretinally with AAV8. Retinal thickness remained normal ( Fig.11A Tonometry showed that intraocular pressure decreased in vehicle-treated eyes on day 7 and remained stable at subsequent time points ( Fig. 11B Intraocular pressure in eyes treated with exon editors remained within a healthy range. Ocular inflammation was assessed by slit-lamp biomicroscopy and funduscopy ( Figures 11C-11F ). Individual eyes treated with exon editors showed some signs of mild to moderate inflammation, but this was not consistent for a particular editor or AAV preparation, suggesting that these observations were due to the procedure in the individual eye.

[0419] All animals in the study were kept in good health. Fig. 12A ) and heart rate ( Fig. 12B ) measurements did not reveal any clinical signs indicating adverse systemic effects from exon editor administration. Cage-side observations were performed daily and food consumption was monitored, with no changes noted.

[0420] The studies described herein constitute the first report of trans-splicing with clinically relevant efficiency in the NHP retina. Exon editing and replacement demonstrated efficacy and tolerability in vivo following subretinal injection in African green monkey nonhuman primates. All subretinally delivered AAV-mediated exon-editing molecules were well tolerated. These studies highlight the potential of RNA exon editing to treat ABCA4-related retinopathy.

[0421] Example 5. In vitro evaluation of exemplary ABCA4 trans-splicing molecules

[0422] Example ABCA4 RNA exon editor activity after transfection into ABCA4 protein KO cell line

[0423] As described above, a HEK293T-based cell line (referred to as B6) was engineered to express high ABCA4 RNA and protein levels. This was achieved by knocking in (KI) a constitutive CAGGS promoter between the endogenous ABCA4 promoter and exon 1 via CRISPR-mediated homology-directed repair (HDR).

[0424] To create a model system to characterize the ability of ABCA4 RNA exon editors to correct targeted native pre-mRNA, generate trans-spliced ​​on-target (ONT) RNA, and encode full-length ABCA4 protein, a protein knockout (KO) cell line (termed 17+06) was engineered based on the B6 cell line. 17+06 cells continue to produce high levels of ABCA4 RNA, but in stark contrast to the B6 cell line, 17+06 cells do not produce ABCA4 protein. Engineering of 17+06 cells was achieved by introducing mutations into the ABCA4 gene coding sequence using CRISPR and guide RNAs (gRNAs) targeting exons 3 and 4. RT-qPCR confirmed the persistence of ABCA4 RNA expression in the 17+06 cell line, while western blot analysis demonstrated that ABCA4 protein was eliminated. See Figure 3C .

[0425] ABCA4 KO (17+06) cells were transfected with several ABCA4 RNA exon editor constructs to assess trans-splicing efficiency and the resulting expression of ONT trans-spliced ​​ABCA4 protein. The constructs were identical except for the elements indicated as distinguishing, each reflected in Fig.19A and 19B The markers for the four lanes are shown in Figure 1. Fig.13 The exemplary ABCA4 RNA exon editor construct depicted in (5′UTR to the end of MALAT1-MascRNA (anti-mut1; SEQ ID NO: 78)) stood out as a leading candidate in this analysis because it drove high levels of trans-splicing (ABCA4 RNA replacement by approximately 20%) and high levels of ONT trans-spliced ​​ABCA4 protein while reducing NSP levels relative to the other constructs tested. Fig.19A and 19B Lane 4 of Figure 4 shows the activity of an exemplary ABCA4 RNA exon editor. Fig.19A and 19BAs shown, an exemplary ABCA4 RNA exon editor comprises a 40-mer linker + 3×UBS + ARE element as described in detail herein.

[0426] In addition to the above, Fig.19A and 19B Shown are the activities of each of the indicated RNA exon editor (RTM) elements, alone and in combination, in the context of an exemplary ABCA4 5′ construct. Fig.19A A histogram is shown depicting the percent replacement of ABCA4 RNA for each construct shown. The percent replacement for each construct ranged from approximately 20-30%. Interestingly, the combination of 40mer + 3x repeat U1 binding site (3xUUBS) (SEQ ID NO: 72) showed a trend toward increased percent replacement of ABCA4 RNA relative to the 40mer alone (SEQ ID NO: 27). Fig.19B Western blots are presented showing that the indicated constructs comprising 40mer (SEQ ID NO: 27), 40mer + 3×UBS (SEQ ID NO: 72), 40mer + AU-rich element (sequence 3444-3529 of SEQ ID NO: 86), and 40mer + 3×UBS + ARE (SEQ ID NO: 73) express trans-spliced ​​ABCA4 protein (ONT), and that the combination of these RTM elements together shows a trend toward increased ONT levels relative to the 40mer alone. The Western blots also show that each combination of 40mer + 3×UBS, 40mer + ARE, and 40mer + 3×UBS + ARE exhibits a combined effect on the reduction of non-spliced ​​proteins (NSPs) relative to the 40mer alone. The combined effect of 40mer + 3×UBS + ARE (SEQ ID NO: 73) on the reduction of NSPs is particularly pronounced relative to the 40mer alone (SEQ ID NO: 27). In a minimal NSP background (containing a stop codon immediately following the cut donor sequence in an exon editor), the combination of two independent strategies to reduce NSP levels—including 3×UBS and AU-rich elements—showed a synergistic effect in reducing NSP levels. This combination reduced NSP levels by approximately 70% compared to 40-mer alone, to levels seen in exon editors without a stop.

[0427] Notably, the cassette of 40mer + 3×UBS + ARE (SEQ ID NO: 73) resulted in a more significant reduction in NSP levels relative to RNA exon editors comprising only 40mer, 40mer + 3×UBS, or 40mer + ARE. Thus, this element combination (40mer + 3×UBS + ARE; SEQ ID NO: 73) exhibits particularly advantageous properties in the context of a trans-splicing molecule as described herein.

[0428] The results presented in the context of the ABCA4 RNA exon editor were reproduced in the context of other RNA exon editors targeting different introns in the target mRNA precursor of genes other than ABCA4. See, e.g., Figures 27 and 28, which are described in more detail below, which depict the ability of 40mer + 3×UBS (SEQ ID NO: 72), 40mer + ARE (sequence 3444-3529 of SEQ ID NO: 86), and 40mer + 3×UBS + ARE (SEQ ID NO: 73) to reduce NSP levels compared to 40mer alone (SEQ D NO: 27). The arrangement and positioning of 40mer + 3×UBS (SEQ ID NO: 72), 40mer + ARE (sequence 3444-3529 of SEQ ID NO: 86), and 40mer + 3×UBS + ARE (SEQ ID NO: 73) in the context of different RNA exon editors are as described herein and described in more detail below. Fig.13 The arrangement and positioning of the ABCA4 exon editor depicted in Figure 5 are consistent.

[0429] like Fig.27B As shown, NSP was reduced in a combinatorial manner by including 3×UBS and ARE in an RNA exon editor targeting intron A, and the results are depicted in the figure. The RNA exon editor targeting intron A targets an intron in the mRNA precursor different from ABCA4. Briefly, HEK293 cells were transfected with an RNA exon editor targeting intron A, which was varied in its linker region to include the indicated RNA exon editor elements (40mer, 40mer+3×UBS, 40mer+ARE, and 40mer+3×UBS+ARE). Cells were harvested 48 hours after transfection and the trans-splicing efficiency was determined by RT-qPCR ( Fig.27A ) or Western blot analysis ( Fig.28B In exon editors targeting intron A, the inventors showed that 40mer+3×UBS reduced NSP levels by about 75% relative to 40mer alone, 40mer+ARE reduced NSP levels by about 40% relative to 40mer alone, and 40mer+3×UBS+ARE reduced NSP levels by 88% relative to 40mer alone ( Fig.27B ).

[0430] like Fig.28BAs shown, NSP was reduced in a combinatorial manner by including 3×UBS and ARE in an RNA exon editor targeting intron B, and the results are depicted in the figure. The RNA exon editor targeting intron B targets an intron in the mRNA precursor that is different from ABCA4 and different from the mRNA precursor targeted by the RNA exon editor targeting intron A. Briefly, HEK293 cells were transfected with an RNA exon editor targeting intron B, which was varied in its linker region to include the indicated RNA exon editor elements (40mer, 40mer+3×UBS, 40mer+ARE, and 40mer+3×UBS+ARE). Cells were harvested 48 hours after transfection and the trans-splicing efficiency was determined by RT-qPCR ( Fig.28A ) or Western blot analysis ( Fig.28B ). In exon editors targeting intron B, the inventors showed that 40mer+3×UBS reduced NSP levels by about 38% relative to 40mer alone, 40mer+ARE reduced NSP levels by about 33% relative to 40mer alone, and 40mer+3×UBS+ARE reduced NSP levels by 66% relative to 40mer alone ( Fig.28B ).

[0431] Dose-response evaluation of an exemplary ABCA4 RNA exon editor following transduction of an ABCA4 KO cell line

[0432] To demonstrate confidence in the pharmacology and mechanism of action of the ABCA4 RNA exon editor construct, the inventors included Fig.13 The exemplary ABCA4 RNA exon editor construct (ABCA4-01) (SEQ ID NO: 90, which comprises SEQ ID NO: 78) of the exemplary ABCA4 RNA exon editor depicted in Figure 1 was packaged into alternative AAV2 capsids and the dose response was evaluated in the ABCA4 KO cell line. ABCA4 KO cells were treated with 1×10 3 Up to 1×10 6 (1e3-1e6) Transduce with increasing MOI of AAV2-ABCA4 RNA exon editor construct containing Fig.13 The exemplary ABCA4 RNA exon editor depicted in (SEQ ID NO: 90, which includes SEQ ID NO: 78) was then isolated from the membrane protein and western blotted with an ABCA4-specific Ab. Fig.13Increasing MOI of the AAV2-ABCA4 RNA exon editor construct (SEQ ID NO: 90) of the exemplary ABCA4 RNA exon editor depicted in resulted in increased levels of exon editing, as reflected in target (ONT) ABCA4 protein expression and % RNA replacement. Fig.21A and 21B .

[0433] Example 6. Off-target (OFT) discovery next generation sequencing (NGS) method (OFT-seq)

[0434] OFT RNA sequencing (OFT-seq) is a global off-target discovery method developed by the inventors. The method utilizes RNA extracted from cells, NHP neural retinal samples, or human retinal explants, which are either transfected with plasmids or transduced with AAV encoding ABCA4 exon editors or relevant controls. The exon editor-specific codon-optimized CDS 3′ upstream of exon 22 is used as the targeting primer (gene-specific primer: GSP) region. Since this method only targets the upstream sequence of the exon editor, it can be used to capture unbiased global off-target non-ABCA4 RNA sequences. Therefore, this method allows the capture of unspliced ​​exon editors, self-splicing exon editors, and expected ONT-edited ABCA4 RNA and OFT ( Fig.25 ). These sequences were then sequenced using the Illumina short-read NGS platform. The output NGS reads were processed by proprietary computational bioinformatics analysis tools developed in-house. This analysis provides quantitative information on overall sequencing quality and target junction sequence as well as each variant sequence.

[0435] Briefly, RNA samples are first treated with DNase to eliminate residual genomic DNA, plasmid DNA / AAV DNA, and possible contaminating DNA. RNA is then enriched by ribosomal RNA (rRNA) depletion or PolyA enrichment. The enriched RNA sample is then broken into fragments. After Illumina adapter ligation and cDNA preparation, PCR is performed using primers targeting the ABCA4 codon-optimized sequence targeting GSP and the adapter. This step amplifies target sequences with ABCA4 codon-optimized sequences - including exon editors, ONTs, OFTs, and self-splicing exon editors.

[0436] Example 7. Generation of ABCA4 CDS against cryptic splice sites

[0437] The inventors discovered through a large number of experiments and computational analysis results in vitro and in vivo (NHP) that cryptic splice sites are used in the context of the ABCA4 exon editor described herein. The inventors conducted a large number of experiments and analyses, including the generation of off-target (OFT) libraries and their bioinformatic analysis, and unexpectedly discovered a large number of positions where cryptic splicing occurs within the ABCA4 coding sequence (CDS) comprising exons 1-22 in the context of the trans-splicing molecules described herein. In order to improve the trans-splicing efficiency and fidelity of the trans-splicing molecules described herein, the sequences of multiple cryptic splice sites are modified by introducing synonymous mutations therein to impair and / or disable the cryptic splice sites. This approach exploits the degeneracy of the genetic code, allowing the introduction of the desired modifications to reduce the use of cryptic splice sites without causing changes in the encoded amino acids.

[0438] In addition to the above, using the next generation sequencing (NGS) approach...

Claims

1. A nucleic acid trans-splicing molecule, comprising: (a) a coding domain sequence (CDS), wherein the coding domain sequence comprises an ABCA4 exon; (b) a linker domain comprising SEQ ID NO: 27 or a sequence at least 85% identical to SEQ ID NO: 27; and (c) a binding domain that anneals to a binding site within the endogenous ABCA4 mRNA precursor, wherein the CDS, the linker domain and the binding domain are operably linked in a 5' to 3' direction.

2. A nucleic acid trans-splicing molecule, comprising: (a) a CDS comprising, consisting essentially of, or consisting of a variant of any one of SEQ ID NOs: 53-55, wherein the variant of any one of SEQ ID NOs: 53-55 comprises at least one nucleotide variation in at least one cryptic splice site listed in Table 3, wherein the at least one nucleotide variation reduces cryptic splice site usage at each of the at least one cryptic splice site comprising the at least one nucleotide variation; and (b) a linker domain; and (c) a binding domain that anneals to a binding site within the endogenous ABCA4 mRNA precursor, wherein the CDS, the linker domain and the binding domain are operably linked in a 5' to 3' direction.

3. The nucleic acid trans-splicing molecule of claim 2, wherein the variant of SEQ ID NO: 55 comprises any one of SEQ ID NOs: 56-59. 4 . The nucleic acid trans-splicing molecule of claim 3 , wherein the variant of SEQ ID NO: 55 comprises SEQ ID NO:

56.

5. A nucleic acid trans-splicing molecule as described in any of the preceding claims, wherein the linker domain comprises a sequence that is at least 85% identical, at least 86% identical, at least 87% identical, at least 88% identical, or at least 89% identical, 90% identical, 91% identical, at least 92% identical, at least 93% identical, at least 94% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:

27.

6. The nucleic acid trans-splicing molecule of any preceding claim, wherein the linker domain comprises, consists essentially of, or consists of SEQ ID NO:

27.

7. The nucleic acid trans-splicing molecule of any one of the preceding claims, wherein the binding domain anneals to an intron in the endogenous ABCA4 mRNA precursor.

8. The nucleic acid trans-splicing molecule of claim 7, wherein the intron in the endogenous ABCA4 mRNA precursor is intron 22.

9. The nucleic acid trans-splicing molecule of any one of the preceding claims, wherein the binding domain comprises SEQ ID NO: 18 or SEQ ID NO:

20.

10. The nucleic acid trans-splicing molecule of any preceding claim, wherein the binding domain consists essentially of or consists of SEQ ID NO: 18 or SEQ ID NO:

20.

11. The nucleic acid trans-splicing molecule of any preceding claim, wherein the binding domain consists essentially of or consists of SEQ ID NO:

20.

12. The nucleic acid trans-splicing molecule of any one of claims 1 or 5-11, wherein the CDS comprises ABCA4 exons 1-22 or a variant thereof.

13. The nucleic acid trans-splicing molecule of claim 12, wherein the CDS comprises, consists essentially of, or consists of any one of SEQ ID NOs: 53-59.

14. A nucleic acid trans-splicing molecule, comprising: (a) a linker domain comprising, consisting essentially of, or consisting of SEQ ID NO:27, or a sequence at least 91% identical, at least 92% identical, at least 93% identical, at least 94% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:27; (b) a binding domain comprising, consisting essentially of, or consisting of SEQ ID NO: 18 or SEQ ID NO: 20; and (c) a CDS comprising an ABCA4 exon; wherein the CDS, the linker domain and the binding domain are operably linked in a 5' to 3' direction.

15. The nucleic acid trans-splicing molecule of claim 14, wherein the CDS comprises, consists essentially of, or consists of any one of SEQ ID NOs: 53-59.

16. A nucleic acid trans-splicing molecule, comprising: (a) a CDS comprising, consisting essentially of, or consisting of any one of SEQ ID NOs: 53-59; (b) a linker domain comprising, consisting essentially of, or consisting of SEQ ID NO:27, or a sequence at least 91% identical, at least 92% identical, at least 93% identical, at least 94% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:27; and (c) a binding domain comprising, consisting essentially of, or consisting of SEQ ID NO: 20, wherein the CDS, the linker domain and the binding domain are operably linked in a 5' to 3' direction.

17. The nucleic acid trans-splicing molecule of any one of the preceding claims, further comprising an enhancer comprising at least one sequence comprising GGTAAGT or SEQ ID NO:

61.

18. The nucleic acid trans-splicing molecule of claim 17, wherein the enhancer is operably linked to the linker domain at the 3' position.

19. The nucleic acid trans-splicing molecule of any one of claims 17 or 18, wherein the enhancer comprises three sequences arranged in tandem and operably linked, wherein each of the three sequences comprises GGTAAGT or SEQ ID NO:

61.

20. The nucleic acid trans-splicing molecule of any one of claims 17 to 19, wherein the enhancer comprises three sequences arranged in tandem, wherein the three sequences comprise SEQ ID NO:

62.

21. A nucleic acid trans-splicing molecule as described in any of the preceding claims, further comprising a translation enhancer, wherein the translation enhancer comprises SEQ ID NO: 63 or a sequence having at least 90% identity to SEQ ID NO: 63, wherein SEQ ID NO: 63 or the sequence having at least 90% identity to SEQ ID NO: 63 is operably linked to the enhancer at 3′.

22. The nucleic acid trans-splicing molecule of claim 21, wherein the translation enhancer is at least 91% identical to SEQ ID NO: 63, at least 92% identical to SEQ ID NO: 63, at least 93% identical to SEQ ID NO: 63, at least 94% identical to SEQ ID NO: 63, at least 95% identical to SEQ ID NO: 63, at least 96% identical to SEQ ID NO: 63, at least 97% identical to SEQ ID NO: 63, at least 98% identical to SEQ ID NO: 63, or at least 99% identical to SEQ ID NO:

63.

23. The nucleic acid trans-splicing molecule of any one of claims 21 or 22, wherein the translation enhancer comprises, consists essentially of, or consists of SEQ ID NO:

63.

24. The nucleic acid trans-splicing molecule of any one of the preceding claims, further comprising a splicing domain comprising any one of GTAAGT, GTAAGG, GTAAGC or GTAACT.

25. The nucleic acid trans-splicing molecule of any of the preceding claims, further comprising a splicing domain comprising, consisting essentially of, or consisting of GTAAGT.

26. The nucleic acid trans-splicing molecule of any preceding claim, further comprising a 5' untranslated region.

27. The nucleic acid trans-splicing molecule of claim 26, wherein the 5' untranslated region comprises, consists essentially of, or consists of SEQ ID NO: 13 or SEQ ID NO:

64.

28. The nucleic acid trans-splicing molecule of any preceding claim, further comprising a 3' transcription terminator domain.

29. The nucleic acid trans-splicing molecule of claim 28, wherein the 3' transcription terminator domain encodes a ribonucleic acid that forms a triple helical structure, and the triple helical structure protects the 3' end of the trans-splicing molecule.

30. The nucleic acid trans-splicing molecule of claim 28 or claim 29, wherein the 3' transcription terminator domain comprises a wild-type MALAT1 sequence (SEQ ID NO:33) or a nucleic acid sequence that is at least 80% identical to SEQ ID NO:

33.

31. A nucleic acid trans-splicing molecule as described in claim 30, wherein the 3' transcription terminator domain comprises a nucleic acid sequence that is at least 80% identical to SEQ ID NO:33; at least 85% identical to SEQ ID NO:33; at least 90% identical to SEQ ID NO:33; at least 91% identical to SEQ ID NO:33; at least 92% identical to SEQ ID NO:33; at least 93% identical to SEQ ID NO:33; at least 94% identical to SEQ ID NO:33; at least 95% identical to SEQ ID NO:33; at least 96% identical to SEQ ID NO:33; at least 97% identical to SEQ ID NO:33; at least 98% identical to SEQ ID NO:33; at least 99% identical to SEQ ID NO:33; or 100% identical to SEQ ID NO:

33.

32. The nucleic acid trans-splicing molecule of claim 28 or claim 29, wherein the 3' transcription terminator domain comprises, consists essentially of, or consists of SEQ ID NO: 33 or SEQ ID NO:

66.

33. The nucleic acid trans-splicing molecule of any of the preceding claims, further comprising at least one stop codon operably linked 3' to the splicing domain.

34. The nucleic acid trans-splicing molecule of claim 33, comprising the following operably linked in the 5' to 3' direction: (a) 5′ untranslated region; (b) a CDS consisting essentially of or consisting of any one of SEQ ID NOs: 53-59; (c) splicing domain; (d) at least one stop codon; (e) a linker domain consisting essentially of or consisting of SEQ ID NO: 27; (f) at least one enhancer; (g) translation enhancers; (h) a binding domain consisting essentially of or consisting of SEQ ID NO: 18 or SEQ ID NO: 20; and (i) 3' transcription terminator domain.

35. The nucleic acid trans-splicing molecule of claim 34, wherein (a) the 5' untranslated region comprises, consists essentially of, or consists of SEQ ID NO: 13 or SEQ ID NO: 64; (b) the splicing domain comprises, consists essentially of, or consists of GTAAGT; (c) the at least one stop codon comprises, consists essentially of, or consists of two stop codons, wherein The sequence of the first of the two stop codons partially overlaps with the sequence of the splicing domain; (d) the at least one enhancer comprises, consists essentially of, or consists of three tandemly arranged sequences, wherein each of the three sequences comprises GGTAAGT or SEQ ID NO: 61; (e) the translation enhancer comprises, consists essentially of, or consists of SEQ ID NO: 63; and (f) the 3' transcription terminator domain comprises, consists essentially of, or consists of SEQ ID NO:

66.

36. A nucleic acid trans-splicing molecule, comprising: (a) 5′ untranslated region; (b) a CDS comprising, consisting essentially of, or consisting of any one of SEQ ID NOs: 53-59; (c) splicing domain; (d) optionally, at least one stop codon; (e) a linker domain comprising, consisting essentially of, or consisting of SEQ ID NO: 27; (f) at least one enhancer; (g) translation enhancers; (h) a binding domain comprising, consisting essentially of, or consisting of SEQ ID NO: 18 or SEQ ID NO: 20; and (i) 3′ transcription terminator domain, wherein the 5′ untranslated region; the CDS; the splicing domain; the at least one stop codon when present; the linker domain; the at least one enhancer; the translation enhancer; the binding domain; and the 3′ transcription terminator domain are operably linked in the 5′ to 3′ direction.

37. The nucleic acid trans-splicing molecule of claim 36, wherein (a) the 5' untranslated region comprises, consists essentially of, or consists of SEQ ID NO: 13 or SEQ ID NO: 64; (b) the splicing domain comprises, consists essentially of, or consists of GTAAGT; (c) the at least one stop codon is present and comprises, consists essentially of, or consists of two stop codons, wherein The sequence of the first of the two stop codons partially overlaps with the sequence of the splicing domain; (d) the at least one enhancer comprises, consists essentially of, or consists of three tandemly arranged sequences, wherein each of the three sequences comprises GGTAAGT or SEQ ID NO: 61; (e) the translation enhancer comprises, consists essentially of, or consists of SEQ ID NO: 63; and (f) the 3' transcription terminator domain comprises, consists essentially of, or consists of SEQ ID NO:

66.

38. A nucleic acid trans-splicing molecule comprising, in the 5' to 3' direction, operably linked: (a) a 5' untranslated region comprising, consisting essentially of, or consisting of SEQ ID NO: 13 or SEQ ID NO: 64; (b) a CDS comprising, consisting essentially of, or consisting of any one of SEQ ID NOs: 53-59; (c) a splicing domain comprising, consisting essentially of, or consisting of GTAAGT; (d) two stop codons, wherein the sequence of a first of the two stop codons partially overlaps with the sequence of the splicing domain and wherein the sequence of the splicing domain in combination with the two stop codons comprises, consists essentially of, or consists of SEQ ID NO: 68; (e) a linker domain comprising, consisting essentially of, or consisting of SEQ ID NO: 27; (f) an enhancer comprising, consisting essentially of, or consisting of SEQ ID NO: 62; (g) a translation enhancer comprising, consisting essentially of, or consisting of SEQ ID NO: 63; (h) a binding domain comprising, consisting essentially of, or consisting of SEQ ID NO: 18 or SEQ ID NO: 20; and (i) a 3' transcriptional terminator domain comprising, consisting essentially of, or consisting of SEQ ID NO:

66.

39. A nucleic acid trans-splicing molecule according to claim 37 or claim 38, wherein the nucleic acid trans-splicing molecule comprises, consists essentially of or consists of SEQ ID NO: 69, SEQ ID NO: 78 or SEQ ID NO:

90.

40. The nucleic acid trans-splicing molecule of any one of claims 1-20, wherein the nucleic acid trans-splicing molecule comprises, consists essentially of, or consists of SEQ ID NO: 70 or SEQ ID NO:

71.

41. The nucleic acid trans-splicing molecule of any one of claims 1-12, wherein the nucleic acid trans-splicing molecule comprises a nucleic acid sequence that is at least 80% identical to any one of SEQ ID NOs: 40-44, 46, or 48-50.

42. A ribonucleic acid trans-splicing molecule transcribed from a nucleic acid trans-splicing molecule as described in any one of claims 1-41.

43. The nucleic acid trans-splicing molecule of any one of claims 1-41, wherein the endogenous ABCA4 mRNA precursor comprises at least one mutation associated with ABCA4-related retinal dystrophy.

44. The nucleic acid trans-splicing molecule of claim 43, wherein the ABCA4-related retinal dystrophy is recessively inherited.

45. The nucleic acid trans-splicing molecule of claim 43 or 44, wherein the ABCA4-related retinal dystrophy is associated with an allelic pathogenic variant spanning exons 1-22 of the ABCA4 gene and a phenotype consistent with cone-rod dystrophy (e.g., cone-rod dystrophy-3), Stargardt's macular dystrophy (e.g., Stargardt's disease-1), fundus xanthophy, retinitis pigmentosa-19, or age-related macular degeneration-2.

46. ​​The nucleic acid trans-splicing molecule of any one of claims 1 to 45, wherein the endogenous ABCA4 mRNA precursor comprising the at least one mutation is expressed in photoreceptor cells or retinal pigment epithelial cells.

47. A vector comprising the nucleic acid trans-splicing molecule according to any one of claims 1 to 46.

48. The vector of claim 47, wherein the vector comprises a 5' regulatory domain operably linked 5' to the CDS.

49. The vector of claim 48, wherein the 5' regulatory domain is operably linked to a 5' untranslated region.

50. The vector of any one of claims 48-49, wherein the 5' regulatory domain comprises a constitutive promoter or a tissue-specific promoter.

51. A vector as described in claim 50, wherein the constitutive promoter is a CMV promoter.

52. A proviral plasmid comprising the nucleic acid trans-splicing molecule of any one of claims 1-46.

53. An adeno-associated virus (AAV) comprising a nucleic acid trans-splicing molecule as described in any one of claims 1-46, wherein the AAV optionally comprises a 5' regulatory domain, which is operably linked to the nucleic acid trans-splicing molecule at the 5' position.

54. The AAV of claim 53, wherein the AAV comprises a 5' regulatory domain operably linked 5' to the CDS.

55. The AAV of any one of claims 53 or 54, wherein the 5' regulatory domain is operably linked to a 5' untranslated region.

56. The AAV of any one of claims 53-55, wherein the 5' regulatory domain comprises a constitutive promoter.

57. The AAV of claim 56, wherein the constitutive promoter is a CMV promoter.

58. The AAV of any one of claims 53-57, wherein the AAV preferentially targets photoreceptor cells and / or retinal pigment epithelial cells.

59. The AAV of any one of claims 53-58, wherein the AAV is AAV8, AAV5, or AAV2.

60. A composition comprising a nucleic acid trans-splicing molecule as described in any one of claims 1-46, a vector as described in any one of claims 47-51, a proviral plasmid as described in claim 52, or an AAV as described in any one of claims 53-59.

61. The composition of claim 60, comprising a pharmaceutically acceptable excipient.

62. A method for expressing biologically active ABCA4 in a target cell to restore the functional level of ABCA4 protein in the target cell, the method comprising transducing the target cell with a nucleic acid trans-splicing molecule as described in any one of claims 1-46, a vector as described in any one of claims 47-51, a proviral plasmid as described in claim 52, an AAV as described in any one of claims 53-59, or a composition as described in claim 60 or 61.

63. The method of claim 62, wherein at least 5%, at least 10%, or at least 15% of the target ABCA4 mRNA in the target cell is replaced.

64. The method of claim 63, wherein at least 20% of the target ABCA4 mRNA in the target cell is replaced.

65. The method of claim 64, wherein at least 35% of the target ABCA4 mRNA in the target cell is replaced.

66. The method of any one of claims 62-65, wherein the functional level of ABCA4 in the target cell is restored by expressing a biologically functional full-length ABCA4 protein.

67. A method of reducing accumulation of ABCA4-associated lipofuscin and / or A2E in a subject, the method comprising transfecting or transducing target retinal cells in the subject with a nucleic acid trans-splicing molecule as described in any one of claims 1-46, a vector as described in any one of claims 47-51, a proviral plasmid as described in claim 52, an AAV as described in any one of claims 53-59, or a composition as described in claim 60 or 61.

68. A method of correcting at least one mutation in an ABCA4 exon sequence in a target cell of a subject, the method comprising administering to the subject a nucleic acid trans-splicing molecule as described in any one of claims 1-46, a vector as described in any one of claims 47-51, a proviral plasmid as described in claim 52, an AAV as described in any one of claims 53-59, or a composition as described in claim 60 or 61.

69. A method of treating ABCA4-related retinal dystrophy in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a nucleic acid trans-splicing molecule as described in any one of claims 1-46, a vector as described in any one of claims 47-51, a proviral plasmid as described in claim 52, an AAV as described in any one of claims 53-59, or a composition as described in claim 60 or 61.

70. The method of any one of claims 67-69, comprising subretinal administration to the subject of a nucleic acid trans-splicing molecule as described in any one of claims 1-46, a vector as described in any one of claims 47-51, a proviral plasmid as described in claim 52, an AAV as described in any one of claims 53-59, or a composition as described in claim 60 or 61.

71. The method of any one of claims 67-70, wherein the subject is a non-human primate or a human.

72. The method of any one of claims 67-71, wherein the subject has been diagnosed with ABCA4-related retinal dystrophy.

73. The nucleic acid trans-splicing molecule of any one of claims 1-46, the vector of any one of claims 47-51, the proviral plasmid of claim 52, the AAV of any one of claims 53-59, or the composition of claim 60 or 61, for use in treating ABCA4-related retinal dystrophy in a subject in need thereof.

74. A nucleic acid trans-splicing molecule as described in any one of claims 1-46, a vector as described in any one of claims 47-51, a proviral plasmid as described in claim 52, an AAV as described in any one of claims 53-59, or a composition as described in claim 60 or 61, for use in the preparation of a medicament for treating ABCA4-related retinal dystrophy in a subject in need thereof.

75. The method of any one of claims 67-72 or the use of any one of claims 73 or 74, wherein the ABCA4-related retinal dystrophy is associated with an allelic pathogenic mutation spanning exons 1-22 of the ABCA4 gene and a phenotype consistent with cone-rod dystrophy, Stargardt's macular dystrophy, or fundus xanthophy.

76. A nucleic acid trans-splicing molecule, comprising: (a) a linker domain comprising, consisting essentially of, or consisting of SEQ ID NO: 27, or a sequence at least 90% identical to SEQ ID NO: 27; and (b) optionally, an enhancer comprising, consisting essentially of, or consisting of SEQ ID NO: 62; and (c) optionally, a translation enhancer comprising, consisting essentially of, or consisting of SEQ ID NO: 63, wherein the linker domain; the enhancer, when present; and the translation enhancer, when present, are operably linked in the 5' to 3' direction.

77. The nucleic acid trans-splicing molecule of claim 76, further comprising a binding domain, wherein the binding domain anneals to a binding site within an endogenous ABCA4 mRNA precursor, wherein the linker domain; the enhancer, when present; the translation enhancer, when present; and the binding domain are operably linked in a 5' to 3' direction.

78. The nucleic acid trans-splicing molecule of claim 76 or claim 77, further comprising a CDS comprising an ABCA4 exon, wherein the CDS; the linker domain; the enhancer, when present; the translation enhancer, when present; and the binding domain, when present, are operably linked in a 5' to 3' direction.

79. A 5' nucleic acid trans-splicing molecule, comprising: (a) an enhancer comprising, consisting essentially of, or consisting of at least one of GGTAAGT or SEQ ID NO:61, or a sequence at least 90% identical, at least 91% identical, at least 92% identical, at least 93% identical, at least 94% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to GGTAAGT or SEQ ID NO:61; and (b) optionally, a linker domain comprising, consisting essentially of, or consisting of SEQ ID NO: 27, or a sequence at least 90% identical to SEQ ID NO: 27; (c) optionally, a translation enhancer comprising, consisting essentially of, or consisting of SEQ ID NO: 63, wherein the linker domain, when present; the enhancer; and the translation enhancer, when present, are operably linked in a 5' to 3' direction.

80. A 5' nucleic acid trans-splicing molecule, comprising: (a) an enhancer comprising, consisting essentially of, or consisting of SEQ ID NO: 62, or a sequence having at least 90% identity to SEQ ID NO: 62; and (b) optionally, a linker domain comprising, consisting essentially of, or consisting of SEQ ID NO: 27, or a sequence having at least 90% identity to SEQ ID NO: 27; (c) optionally, a translation enhancer comprising, consisting essentially of, or consisting of SEQ ID NO: 63, wherein the linker domain, when present; the enhancer; and the translation enhancer, when present, are operably linked in a 5' to 3' direction.

81. The nucleic acid trans-splicing molecule of claim 79 or claim 80, further comprising a binding domain that anneals to a binding site within an endogenous ABCA4 mRNA precursor, wherein the linker domain, when present; the enhancer; the translation enhancer, when present; and the binding domain, are operably linked in a 5' to 3' direction.

82. The nucleic acid trans-splicing molecule of any one of claims 79 to 81, further comprising a CDS comprising an ABCA4 exon, wherein the CDS; the linker domain, when present; the enhancer; the translation enhancer, when present; and the binding domain, when present, are operably linked in a 5' to 3' direction.

83. A nucleic acid trans-splicing molecule, comprising: (a) a translation enhancer comprising, consisting essentially of, or consisting of SEQ ID NO: 63, or a sequence having at least 90% identity to SEQ ID NO: 63; (b) optionally, an enhancer comprising, consisting essentially of, or consisting of SEQ ID NO: 62; and (c) optionally, a linker domain comprising, consisting essentially of, or consisting of SEQ ID NO: 27, or a sequence at least 90% identical to SEQ ID NO: 27, wherein The linker domain, when present; the enhancer, when present; and the translation enhancer, are operably linked in the 5' to 3' direction.

84. The nucleic acid trans-splicing molecule of claim 83, further comprising a binding domain, wherein the binding domain anneals to a binding site within an endogenous ABCA4 mRNA precursor, wherein the linker domain, when present; the enhancer, when present; the translation enhancer; and the binding domain, are operably linked in a 5' to 3' direction.

85. The nucleic acid trans-splicing molecule of claim 83 or claim 84, further comprising a CDS comprising an ABCA4 exon, wherein the CDS; the linker domain, when present; the enhancer, when present; the translation enhancer; and the binding domain, when present, are operably linked in a 5' to 3' direction.

86. A nucleic acid trans-splicing molecule, comprising: A cassette comprising a linker domain and an enhancer, wherein the cassette comprises, consists essentially of, or consists of SEQ ID NO:

72.

87. The nucleic acid trans-splicing molecule of claim 86, further comprising a binding domain, wherein the binding domain anneals to a binding site within an endogenous ABCA4 mRNA precursor, wherein the cassette and the binding domain are operably linked in a 5' to 3' direction.

88. The nucleic acid trans-splicing molecule of claim 86 or claim 87, further comprising a CDS comprising an ABCA4 exon, wherein said CDS; said cassette; and said binding domain, when present, are operably linked in a 5' to 3' direction.

89. A nucleic acid trans-splicing molecule, comprising: A cassette comprising a linker domain, an enhancer, and a translation enhancer, wherein the cassette comprises, consists essentially of, or consists of SEQ ID NO:

73.

90. The nucleic acid trans-splicing molecule of claim 89, further comprising a binding domain, wherein the binding domain anneals to a binding site within an endogenous ABCA4 mRNA precursor, wherein the cassette and the binding domain are operably linked in a 5' to 3' direction.

91. The nucleic acid trans-splicing molecule of claim 89 or claim 90, further comprising a CDS comprising an ABCA4 exon, wherein said CDS; said cassette; and said binding domain, when present, are operably linked in a 5' to 3' direction.

92. A nucleic acid trans-splicing molecule, comprising: (a) a 3' transcriptional terminator domain comprising, consisting essentially of, or consisting of SEQ ID NO: 66, or a sequence at least 95% identical to SEQ ID NO:

66.

93. A nucleic acid trans-splicing molecule as described in claim 92, wherein the 3′ transcription terminator domain comprises the following nucleic acid sequence, which is at least 96% identical to SEQ ID NO: 66; at least 97% identical to SEQ ID NO: 66; at least 98% identical to SEQ ID NO: 66; at least 99% identical to SEQ ID NO: 66; or 100% identical to SEQ ID NO:

66.

94. The nucleic acid trans-splicing molecule of claim 92 or claim 93, wherein the 3' transcription terminator domain comprises, consists essentially of, or consists of SEQ ID NO: 66.

Images