Genome, expression module, recombinant strain and application thereof in preparing rhodioloside
By constructing recombinant strains and optimizing metabolism, and using sugarcane molasses as a carbon source, the problem of low production efficiency of rhodioloside was solved, achieving efficient and low-cost production of rhodioloside and promoting its application in the pharmaceutical field.
Patent Information
- Application Number
- CN202411014408.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-07-25
- Publication Date
- 2026-04-07
- Estimated Expiration
- 2044-07-25
AI Technical Summary
The content of rhodioloside in Rhodiola rosea is low, and traditional extraction and chemical synthesis methods suffer from problems such as low efficiency and high pollution, making it difficult to achieve large-scale application. In addition, sugarcane molasses resources have not been effectively utilized.
Recombinant strains were constructed, sugarcane molasses was used as the sole carbon source, metabolic flux was optimized through metabolic engineering, and enzyme discovery and screening were combined to improve the production efficiency and conversion rate of rhodioloside. Microbial fermentation technology was then used for large-scale production.
This has enabled the efficient, low-cost, and green production of rhodioloside, reducing material costs, minimizing byproduct generation, and promoting its widespread application in the pharmaceutical field.
Smart Images

Figure BDA0004965989570000041 
Figure BDA0004965989570000051 
Figure BDA0004965989570000061
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of bioengineering, and particularly relates to a genome, an expression module, a recombinant strain and application thereof in preparing salidroside. BACKGROUND
[0002] Rhodiola rosea L is a perennial herb of the Crassulaceae family, which has high medicinal value. With the analysis and research on the phytochemical components of Rhodiola rosea L, various main pharmacologically active components have been isolated therefrom. Salidroside is a phenolic compound present in the rhizomes of Rhodiola rosea L, and has been found to have many important biological activities in recent years, such as anti-fatigue, antioxidant, immune regulation, free radical scavenging and other pharmacological activities, and has a positive effect on the protection of nerves, myocardium, liver, kidney and the like.
[0003] However, the content of salidroside in Rhodiola rosea L is only 0.5% to 0.8%, and Rhodiola rosea L is a high-cold perennial herb, which has not yet been artificially cultivated on a large scale. Therefore, direct extraction cannot meet the wide application of salidroside in the medical field. Chemical synthesis can obtain salidroside by direct glycosylation of tyrosol or glycosylation of tyrosine with phenolic hydroxyl protection, which seems to achieve large-scale production. However, low yield, many by-products and large pollution are major problems faced by chemical synthesis. With the rapid development of synthetic biology, through metabolic engineering of microbial chassis cells, artificial transformation pathways and microbial cell factories have realized the synthesis of a variety of high-value target natural products. Compared with traditional plant extraction or chemical synthesis methods, biosynthesis as a green and environmentally friendly production method is conducive to the construction of an environmentally friendly society and the realization of sustainable economic development. Based on enzyme catalysis theory, the use of biological enzymes with tyrosol and uridine diphosphate glucose as substrates to catalyze the synthesis of salidroside provides a reliable theoretical basis for industrial production. The technology of developing and utilizing the biosynthesis pathway in microorganisms for salidroside production has attracted more and more attention due to its environmental protection, low cost, effective production method and simple operation. Among them, the production of salidroside by Saccharomyces cerevisiae from glucose is considered to be an environmentally sustainable and safe method. It has been reported that engineered Saccharomyces cerevisiae produces salidroside at a concentration of 26.55 g / L through glucose batch fermentation. Similarly, Escherichia coli, with its rapid growth rate, simple culture conditions, abundant and easily accessible genetic tools and comprehensive synthetic biological framework, has become a friendly heterologous host. An engineered Escherichia coli producing salidroside at a concentration of 9.48 g / L has been reported.
[0004] Biomass resource-based bioactive compound production is an important measure to overcome global energy depletion and environmental pollution challenges, contributing to sustainable economic and social development. Producing salidroside from agricultural waste can provide a reliable way to improve economic feasibility and expand industrial applications by reducing production costs and creating additional income for the agricultural industry. In addition, this approach can minimize environmental costs and promote the sustainable use of natural resources. Molasses is a byproduct of the sugar cane industry, containing a large amount of fermentable sugar (i.e., sucrose, glucose, fructose) and most of the microbial growth factors, including minerals and organic nutrients, which can be directly fermented without any pretreatment. Molasses is also a cheap substrate that does not compete with food stocks. Although it can be used as animal feed, grinding aid, or carbon source, etc., a large portion is abandoned, resulting in a huge waste of agricultural resources and serious environmental problems. Therefore, it is desirable to develop an environmentally friendly and economically efficient method to convert sugar cane molasses into high-value bioactive compounds. Therefore, it is essential and meaningful to establish an efficient, low-cost, green, and simple method to produce salidroside from sugar cane molasses for its wide application in the medical field. SUMMARY
[0005] Therefore, the present application provides a genome, an expression module, a recombinant strain and its application in preparing salidroside. The present application constructs a strain capable of utilizing sugar cane molasses as the sole carbon source to produce salidroside, reducing material costs. Then, through metabolic engineering, the metabolic network of the microorganism is restructured, the metabolic flow is optimized, and the metabolic flux between different metabolic modules is reasonably distributed to promote the efficient synthesis of the target product. Finally, enzyme mining and screening are crucial. Based on the combination of training large language models and machine learning models with substrate structural information, enzymes with higher activity and specificity for specific substrates are mined and screened, significantly improving the titer and conversion rate of salidroside production. At the same time, the generation of by-products and the accumulation of precursor substances are reduced, which will promote the large-scale production and application of salidroside.
[0006] In order to achieve the above-mentioned application purposes, the present application provides the following technical solutions:
[0007] The present application provides a genome, comprising: one or more of an expression gene, a knockout gene, an overexpression gene, and an inhibition gene;
[0008] The expression gene comprises: one or more of a cscA gene, a cscK gene, a cscB gene, a CBS2104 gene, a UGT gene, a gene encoding aroG fbr a mutant, a ppsA gene, and a tktA gene. fbr a mutant, a ppsA gene, and a tktA gene.
[0009] The knockout genes include one or more of the following: pheA gene, trpE gene, feaB gene, pgi gene, and ppc gene.
[0010] The overexpression genes include the following: zwf gene and / or pck gene.
[0011] The suppression genes include the pykF gene.
[0012] In some embodiments of the present application, in the above-mentioned genome, the source of the UGT gene includes one or more of the following: Arabidopsis thaliana, Triticum aestivum, Papaver somniferum, Miscanthus lutarioriparius, Senna tora, Gossypium trilobum, Gossypium tomentosum, Ziziphus jujuba, and Hordeum vulgare.
[0013] In some embodiments of the present application, in the above-mentioned genome, the source of the UGT gene includes Arabidopsis thaliana and / or Gossypium trilobum.
[0014] In some embodiments of the present application, in the above-mentioned genome, the source of the aroG fbr The mutant has:
[0015] (1) an amino acid sequence as shown in SEQ ID NO: 1; or
[0016] (2) an amino acid sequence obtained by substituting, deleting, or adding one or more amino acids in the amino acid sequence as shown in (1), and an amino acid sequence functionally identical or similar to the amino acid sequence as shown in (1); or
[0017] (3) an amino acid sequence having at least 80% identity to the amino acid sequence as shown in (1) or (2); and / or
[0018] The tyrA fbr The mutant has:
[0019] (4) an amino acid sequence as shown in SEQ ID NO: 2; or
[0020] (5) an amino acid sequence obtained by substituting, deleting, or adding one or more amino acids in the amino acid sequence as shown in (4), and an amino acid sequence functionally identical or similar to the amino acid sequence as shown in (4); or
[0021] (6) an amino acid sequence that is at least 80% identical to the amino acid sequence shown in (4) or (5).
[0022] The present application also provides an expression module, comprising: the above-mentioned genome.
[0023] In some embodiments of the present application, the above-mentioned expression module, the expression module comprises: one or more of the first expression module, the second expression module, the third expression module, the fourth expression module and the fifth expression module;
[0024] The first expression module comprises: the cscA gene, the cscK gene and the cscB gene;
[0025] The second expression module comprises: the CBS2104 gene and the UGT gene;
[0026] The third expression module comprises: the pheA gene, the trpE gene and the feaB gene;
[0027] The fourth expression module comprises: the mutant gene encoding aroG fbr The mutant gene and the mutant gene encoding tyrA fbr ;
[0028] The fifth expression module comprises: the pgi gene, the ppc gene, the zwf gene, the pck gene, the pykF gene, the ppsA gene and the tktA gene.
[0029] In some embodiments of the present application, the above-mentioned expression module further comprises: a promoter; the promoter comprises: any one of the J23119 promoter, the J23109 promoter, the J23114 promoter and the J23115 promoter.
[0030] In some embodiments of the present application, the above-mentioned expression module further comprises: a promoter; the promoter is: the J23119 promoter.
[0031] The present application also provides a recombinant vector, comprising: the above-mentioned expression module.
[0032] The present application also provides a recombinant strain, which is transformed and / or transfected with the above-mentioned recombinant vector.
[0033] The present application also provides the use of the above-mentioned genome, the above-mentioned expression module, the above-mentioned recombinant vector and / or the above-mentioned recombinant strain in the preparation of rhodioloside.
[0034] The present application also provides a method for preparing rhodioloside, using cane sugar as a carbon source, culturing the above-mentioned recombinant strain, and fermenting to obtain the rhodioloside.
[0035] This invention constructs a microbial cell factory to synthesize rhodioloside through microbial fermentation, overcoming the drawbacks of traditional direct extraction and chemical synthesis methods. Utilizing sugarcane molasses as the sole carbon source for bio-fermentation aligns with sustainable economic and social development and reduces material costs. By combining metabolic engineering to reconstruct the microbial metabolic network, optimizing metabolic flow, and rationally allocating metabolic flux among different metabolic modules, the synthesis of the target product becomes more efficient, maximizing resource utilization. Finally, artificial intelligence is used for enzyme discovery and screening, yielding enzymes with higher activity and specificity, significantly improving the titer and conversion rate of rhodioloside while reducing byproduct generation. Attached Figure Description
[0036] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the description of the embodiments or the prior art will be briefly introduced below.
[0037] Figure 1 Show the chemical structure of rhodioloside;
[0038] Figure 2 This indicates the synthetic pathway of rhodioloside;
[0039] Figure 3 The growth trend of E. coli MG1655 cells expressing a heterologous non-PTS-sucrose utilization module is shown on M9 medium containing 2% different carbon sources; where: A shows wild-type MG1655; B shows MG1655 expressing heterologous cscABK.
[0040] Figure 4 Map of recombinant plasmids expressing heterophenylpyruvate decarboxylase and uridine-5'-bisphosphate glycosyltransferase;
[0041] Figure 5 The effect of aromatic amino acid synthesis pathway knockout on tyrosol and rhodioloside titers;
[0042] Figure 6 The effect of relieving negative regulation on the titers of tyrosol and rhodioloside was shown.
[0043] Figure 7 The effects of increased PEP and E4P supply on tyrosol and rhodioloside titers were shown; where: A showed sequential knockout of pgi and overexpression of zwf and knockout of ppc and overexpression of pck based on Sr07; B showed knockout or knockdown of pyruvate kinase based on Sr11; C showed overexpression of PEP synthase and transketolase based on Sr13.
[0044] Figure 8 The effect of UGTs from different sources on tyrosol and rhodioloside titers was shown.
[0045] Figure 9 Cell growth, tyrosol, and rhodioloside of strain Sr22 after continuous fed-batch fermentation in a 5L fermenter for 110 h were shown. Detailed Implementation
[0046] This invention discloses the genome, expression module, recombinant strain, and their application in the preparation of rhodioloside.
[0047] It should be understood that the expression “one or more of…” individually includes each of the objects described after the expression, as well as various different combinations of two or more of the described objects, unless otherwise understood from the context and usage. The expression “and / or” combined with three or more described objects should be understood to have the same meaning, unless otherwise understood from the context.
[0048] The terms “including,” “having,” or “containing,” including the use of their grammatical synonyms, should generally be understood as open-ended and non-restrictive, for example, not excluding other unstated elements or steps, unless otherwise specifically stated or understood from the context.
[0049] It should be understood that the order of the steps or the order in which certain actions are performed is not important as long as the invention remains operational. Furthermore, two or more steps or actions can be performed simultaneously.
[0050] The use of any and all instances or exemplary language such as “e.g.” or “including” in this document is merely intended to better illustrate the invention and is not intended to limit the scope of the invention unless the claims are made. No language in this specification should be construed as indicating that any unclaimed element is essential to the practice of the invention.
[0051] Furthermore, the numerical ranges and parameters used to define the present invention are approximate values, and the relevant values in the specific embodiments have been presented as precisely as possible. However, any value inevitably contains standard deviations due to individual test methods. Therefore, unless explicitly stated otherwise, it should be understood that all ranges, quantities, values, and percentages used in this disclosure are modified with the word "approximately." Here, "approximately" generally means an actual value within plus or minus 10%, 5%, 1%, or 0.5% of a particular value or range.
[0052] The plasmids and strains involved in this invention are:
[0053]
[0054]
[0055] The gene / amino acid sequence involved in this invention is:
[0056] J23119 promoter sequence: TTGACAGCTAGCTCAGTCCTAGGTATAATGCTAGC (as shown in SEQ ID NO:16).
[0057] J23109 promoter sequence: TTTACAGCTAGCTCAGTCCTAGGGACTGTGCTAGC (as shown in SEQ ID NO:17).
[0058] J23114 promoter sequence: TTTATTGGCTAGCTCAGTCCTAGGTACAATGCTAGC (as shown in SEQ ID NO:18).
[0059] J23115 promoter sequence: TTTATAGCTAGCTCAGCCCTTGGTACAATGCTAGC (as shown in SEQ ID NO:19).
[0060] The amino acid sequence encoded by the cscA gene:
[0061] (as shown in SEQ ID NO:3).
[0062] The amino acid sequence encoded by the cscB gene:
[0063] (as shown in SEQ ID NO:4).
[0064] The amino acid sequence encoded by the cscK gene:
[0065] (as shown in SEQ ID NO:5).
[0066] aroG fbr The amino acid sequence encoded by the (D146N&S180F) gene:
[0067] (as shown in SEQ ID NO:1).
[0068] tyrAfbr The amino acid sequence encoded by the (M53I&A354V) gene:
[0069] (as shown in SEQ ID NO:2).
[0070] Uniprot ID:A0A0A8L7L2,Kluyveromyces dobzhanskii amino acid sequence:
[0071] (as shown in SEQ ID NO:6).
[0072] Uniprot ID:Q9SK82, Arabidopsis thaliana amino acid sequence (UGT1):
[0073] (As shown in SEQ ID NO:7).
[0074] Uniprot ID: A0A3B6APW3, Triticum aestivum amino acid sequence (UGT2):
[0075]
[0076] (as shown in SEQ ID NO:8).
[0077] Uniprot ID: A0A4Y7K589, Papaver somniferum amino acid sequence (UGT3):
[0078] (as shown in SEQ ID NO:9).
[0079] Uniprot ID:A0A811Q054, Miscanthus lutarioriparius amino acid sequence (UGT4):
[0080] (as shown in SEQ ID NO:10).
[0081] Uniprot ID: A0A834T9V3, Sennatora amino acid sequence (UGT5):
[0082] (as shown in SEQ ID NO:11).
[0083] Uniprot ID:A0A7J9DKC8, Gossypium trilobum amino acid sequence (UGT6):
[0084] (as shown in SEQ ID NO: 12).
[0085] Uniprot ID: A0A5D2N787, Gossypium tomentosum amino acid sequence (UGT7):
[0086] (as shown in SEQ ID NO:13).
[0087] Uniprot ID: A0A6P3ZNK7, Ziziphus jujuba amino acid sequence (UGT8):
[0088] (as shown in SEQ ID NO:14).
[0089] Uniprot ID:M0Y2X1, Hordeum vulgare amino acid sequence (UGT9):
[0090]
[0091] (as shown in SEQ ID NO:15).
[0092] Uniprot ID:A0A0A8L7L2 nucleotide sequence:
[0093]
[0094] (as shown in SEQ ID NO:20).
[0095] Uniprot ID:Q9SK82 nucleotide sequence:
[0096] (as shown in SEQ ID NO:21).
[0097] The gene editing method involved in this invention is referenced in: Li Q, Sun B, Chen J, Zhang Y, Jiang Y, Yang S. A modified pCas / pTargetF system for CRISPR-Cas9-assisted genome editing in Escherichia coli. Acta Biochim Biophys Sin (Shanghai). 2021 Apr 15;53(5):620-627. doi:10.1093 / abbs / gmab036.PMID:33764372.
[0098] The UGT in Example 2 and the UGT screened in Example 4 have homologous functions and their amino acid sequences are homologous, belonging to homologous enzymes.
[0099] In Examples 1 to 5 of this invention, all raw materials and reagents used can be purchased from the market.
[0100] The present invention will be further illustrated below with reference to the embodiments:
[0101] Example 1: Construction of the sucrose utilization pathway in Escherichia coli
[0102] Sucrose can be utilized by microorganisms through two different pathways: the non-PTS pathway and the PEP-PTS pathway. In *E. coli*, sugar transport requires the consumption of a large amount of PEP (50% PEP). *E. coli* W grows at the same rate on sucrose as it does on glucose, and its sucrose utilization is controlled by a non-PTS system, which is chromosomally encoded sucrose catabolism (csc) regulation. We amplified the cscA, cscK, and cscB genes from *E. coli* W and integrated them into the *Escherichiacolistr.K-12substr.MG1655* chromosome, obtaining a recombinant strain expressing heterologous cscABK. We then examined the growth of the strain using glucose, fructose, sucrose, and molasses as the sole carbon source. Figure 3 As shown in Table 1, the growth of wild-type MG1655 with sucrose and molasses as the sole carbon source was significantly slower than that with glucose and fructose. However, the growth trends of strains expressing heterologous cscABK on M9 medium with different carbon sources did not differ significantly. Among them, there was a clear secondary growth process when molasses was the sole carbon source. This is because molasses is a mixed carbon source with a total sugar content of >460 g / L, including 381 g / L sucrose, 34 g / L glucose, and 31 g / L fructose. When the first carbon source, glucose and fructose, was depleted, the strain began to utilize the second carbon source, sucrose, after a period of adaptation, thus exhibiting secondary growth.
[0103] Table 1
[0104]
[0105]
[0106] Example 2: Construction of the rhodioloside biosynthetic pathway in Escherichia coli
[0107] Phenylacetate decarboxylase converts 4-hydroxyphenylpyruvate (4-HPP) to 4-hydroxyphenylacetaldehyde (4-HPAA), which is then reduced to tyrosol by endogenous alcohol dehydrogenases (ADHs). Figure 2 Rhodioloside is produced via glycosylation of the 8-OH group, catalyzed by a specific uridine-5'-bisphosphate glycosyltransferase (UGT). We cloned (synthesized) phenylpyruvate decarboxylase (Uniprot ID: A0A0A8L7L2) from Kluyveromycesdobzhanskii CBS2104 and UGT (Uniprot ID: Q9SK82) from Arabianopsisthaliana in the pRSFDuet-1 vector after codon optimization.Figure 4 As shown, it was transformed into the above recombinant strain to obtain Sr01. After shake-flask fermentation, tyrosol and rhodioloside were detected at only 0.141 g / L and 0.0452 g / L, respectively, after 68 h.
[0108] Example 3: Optimization of metabolic flux in the rhodioloside biosynthesis pathway in Escherichia coli
[0109] Based on the above results, we optimized the metabolic flux of the rhodioloside biosynthetic pathway in *Escherichia coli*. Rhodioloside, an L-tyrosine derivative, is synthesized starting with the condensation of phosphoenolpyruvate (PEP) and D-erythrose 4-phosphate (E4P). Three isoenzymes catalyze the condensation of E4P and PEP to generate 3-deoxy-D-arabino-heptulosonate-7-phosphate (DAHP), encoded by the genes aroG (Gene ID: 945605), aroF (Gene ID: 947084), and aroH (Gene ID: 946229), respectively. Its synthesis is inhibited at the transcriptional level by feedback from L-tyrosine, L-phenylalanine, and L-tryptophan. DAHP is then converted to chorismate (CHA) via shikimate (SA). CHA is the branch point for the synthesis of L-tryptophan or L-tyrosine and L-phenylalanine. The enzymes encoded by pheA (Gene ID: 947081) or tyrA (Gene ID: 947115) have dual functions as branching acid mutases and prephenate dehydratases, which can convert CHA to prephenate (PRE) to enter the synthesis of L-tyrosine and L-phenylalanine. Meanwhile, the anthranilate synthase encoded by trpE (Gene ID: 945846) converts CHA into L-tryptophan synthesis. To ensure sufficient L-tyrosine for rhodioloside synthesis, the biosynthetic pathways of L-tryptophan and L-phenylalanine are disrupted, specifically by knocking out the pheA and trpE genes. The intermediate compound 4-HPAA in the L-tyrosine biosynthesis pathway can be oxidized to 4-hydroxyphenylacetate (4HPA) by endogenous phenylacetaldehyde dehydrogenase (encoded by feaB, Gene ID: 945933). Knocking out feaB should increase L-tyrosine biosynthesis. Figure 5As shown in Table 2, disruption of the biosynthetic pathways of L-tryptophan and L-phenylalanine had no significant effect on the titers of tyrosol and rhodioloside. However, when feaB was knocked out, the titers of tyrosol and rhodioloside were significantly increased, which was attributed to the increased supply of the intermediate compound 4-HPAA due to the disruption of the biosynthetic pathways of L-tryptophan and L-phenylalanine.
[0110] L-tyrosine biosynthesis is negatively regulated, including transcriptional repression and allosteric regulation. Of the three isoenzymes catalyzing DAHP production, AroG accounts for approximately 80% of the total activity, while AroF and AroH contribute approximately 15% and 5%, respectively. All three are subject to feedback inhibition by L-tyrosine, L-phenylalanine, and L-tryptophan, respectively. TyrA is subject to feedback inhibition by the final product, L-tyrosine. Furthermore, in *E. coli*, tyrR encodes an aromatic amino acid pathway inhibitor that, in the presence of ATP and L-tyrosine, can inhibit the transcription of multiple genes, including tyrB, aroP, aroL-aroM, aroF-tyrA, and tyrP. This inhibition can be further amplified by disrupting TyrR and expressing the anti-feedback mutant aroG. fbr (D146N / S180F) and tyrA fbr (M53I / A354V) is used to remove negative regulation. For example... Figure 6 As shown in Table 3, the removal of negative regulation had a limited effect on the gain of rhodioloside, but the titer of tyrosol was significantly increased.
[0111] The availability of the precursors PEP and E4P largely determines the biosynthetic flux of L-tyrosine. Under glycolytic conditions, the final products of PEP and pyruvate can enter the tricarboxylic acid cycle via acetyl-CoA and C3-carboxylation to form oxaloacetate. Under gluconeogenic conditions, the tricarboxylic acid cycle intermediates oxaloacetate or malate are converted to pyruvate and PEP via decarboxylation (C4-decarboxylation). Therefore, it is reasonable to adjust the carbon flux at the PEP-pyruvate-oxaloacetate node to meet energy and anabolism requirements. Furthermore, due to the inherent carbon distribution imbalance between glycolysis and the pentose phosphate pathway, the availability of E4P is even lower than that of PEP. Based on this, we adjusted the distribution of carbon flux among catabolism, anabolism, and cellular energy supply to assess its impact on rhodioloside production. Knockout of phosphoglucose isomerase (encoded by pgi, Gene ID: 948535) allows glucose to be used exclusively for the synthesis of UDP-Glc and E4P. Overexpression of glucose-6-phosphate dehydrogenase (encoded by zwf, Gene ID: 946370) increases the carbon flux into the pentose phosphate pathway. Disruption of phosphoenolpyruvate carboxylase (encoded by ppc, Gene ID: 948457) combined with overexpression of phosphoenolpyruvate carboxylkinase (encoded by pck, Gene ID: 945667) increases gluconeogenesis of PEP. Knockout or knockdown of pyruvate kinase (encoded by pykF, Gene ID: 946179) reduces PEP consumption in the TCA cycle. PEP synthase (encoded by ppsA, Gene ID: 946209) and transketolase (encoded by tktA, Gene ID: 947420) are directly involved in the formation of PEP and E4P in *E. coli* and require overexpression to maintain a sufficient supply of PEP and E4P. Figure 7 As shown in A and Table 4, knocking out pgi and overexpressing zwf, and knocking out ppc and overexpressing pck, all increased the titers of tyrosol and rhodioloside. The titers of tyrosol and rhodioloside in Sr11 were 4.324 g / L and 0.534 g / L, respectively. PEP mainly enters the tricarboxylic acid cycle via the conversion of acetyl-CoA from pyruvate. Pyruvate kinases encoded by pykF and pykA catalyze this reaction, with pyruvate kinase I (encoded by pykF) playing a major role. Figure 7 As shown in B and Table 5, complete inactivation of pyruvate kinase I significantly affected cell growth, tyrosol, and rhodioloside titers. Reducing pyruvate kinase I activity was achieved through weak promoter replacement, with the J23109 promoter playing a particularly good role. This resulted in a decrease in biomass, reduced excessive carbon source use for growth, and increased tyrosol and rhodioloside synthesis. Overexpression of PEP synthase and transketolase was the most direct and effective method. Figure 7 As shown in C and Table 6, strain Sr17 had rhodioloside levels exceeding 1 g / L, and tyrosol levels reaching 8 g / L.
[0112] Table 2
[0113]
[0114]
[0115] Table 3
[0116]
[0117] Table 4
[0118]
[0119]
[0120] Table 5
[0121]
[0122] Table 6
[0123]
[0124] Example 4: UGTs Screening
[0125] The results above show that tyrosol accumulation is significantly higher than that of rhodioloside, indicating that the synthesis of rhodioloside from tyrosol is the rate-limiting step. UGTs are the rate-limiting enzymes in the synthesis of rhodioloside. Therefore, screening for highly active UGTs is the key to improving the fermentation yield of rhodioloside.
[0126] Therefore, based on the above metabolic modifications, plasmids (Example 1) were used to ensure the copy number of key enzymes while expressing UGTs from eight different sources. For example... Figure 8 As shown in Table 7, there were significant differences in cell growth, tyrosol, and rhodioloside titers obtained from UGTs of different sources. Among them, UGT6 (Uniprot ID: A0A7J9DKC8) from Gossypium trilobum, namely strain Sr22, achieved the highest specificity for tyrosol conversion, yielding 4.029 g / L of rhodioloside, with 3.208 g / L of tyrosol remaining. In contrast, the Sr19 fermentation broth contained only 0.888 g / L of tyrosol and only 2.792 g / L of rhodioloside, possibly due to the poor specificity of Papaver somniferum UGT3 (Uniprot ID: A0A4Y7K589), which converted a large amount of tyrosol into other substances. In addition, heterologous UGTs from strains Sr21 and Sr23 affected tyrosol and cell growth, thus limiting the synthesis of rhodioloside. Therefore, screening UGTs requires not only high activity, but also that they do not impede cell growth and tyrosol synthesis.
[0127] Table 7
[0128]
[0129] Example 5: Fermentation process for producing rhodioloside from sugarcane molasses using Escherichia coli
[0130] Fermentation seeds were prepared using LB medium (10 g / L tryptone, 10 g / L NaCl, 5 g / L yeast extract). A loopful of the culture was taken from the inoculum tube and inoculated into 50 mL of fresh LB medium. The culture was then incubated overnight at 37°C.
[0131] Shake-flask fermentation was carried out in a medium (17.1 g / L Na₂HPO₄·12H₂O, 3.0 g / L KH₂PO₄, 0.5 g / L NaCl, 0.5 g / L NH₄Cl, 0.05 g / L yeast extract, 35.0 g / L sugarcane molasses). The fermentation seed was inoculated into the fermentation medium at a rate of 2%, and 5 mM MgSO₄·7H₂O was added. The culture was carried out at 30 °C and 220 rpm until OD₀. 600 When the concentration is approximately 0.6–0.8, add the inducer isopropyl-β-D-thiogalactoside (IPTG) to a final concentration of 0.3 mM, continue culturing, and take samples for testing every 24 hours.
[0132] Continuous fermentation was performed in a 15L fermenter. The fermentation seed was transferred to 500mL LB medium at an inoculum rate of 1% and cultured until OD500. 600 The mixture was transferred to a 15L fermenter between 10 and 15 hours, with a final filling volume of 5L. The fermentation was carried out at 30°C and 750 rpm, maintaining the pH at 6.80–7.20 using ammonia, controlling dissolved oxygen (DO) at 40% (v / v), and aeration at 1.0 m³ / h. During fermentation, 70% sugarcane molasses was continuously added to support the synthesis reactions and maintain basal cellular metabolism throughout the process. Figure 9 As shown in Table 8, the fermentation cycle is 110 hours, and the highest OD is... 600 The concentration was 220. At the end of fermentation, the highest titers of tyrosol and rhodioloside reached 18.88 g / L and 31.292 g / L, respectively. The titers of tyrosol and rhodioloside at the end of fermentation were 1.924 g / L and 30.127 g / L, respectively, which further improved the biotransformation of tyrosol compared with shake flask fermentation.
[0133] Table 8
[0134]
[0135] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. A recombinant strain, characterized in that, The recombinant strain was obtained by using Escherichia coli as the host bacterium through the following steps; S1: Integrates the cscA, cscK, and cscB genes; S2: Transformation of CBS2104 and UGT genes; S3; Knockout of the pheA, trpE, and feaB genes; S4: Knockout of the TyrR gene, expressing aroG fbr The mutant's gene and encoding tyrA fbr The mutant gene; S5: Knock out the pgi gene and overexpress the zwf gene; S6: Knock out the ppc gene and overexpress the pck gene; S7: Knock down the pykF gene via promoter J23109 and overexpress the ppsA and tktA genes; The aroG fbr The amino acid sequence of the mutant is shown in SEQ ID NO:1; The tyrA fbr The amino acid sequence of the mutant is shown in SEQ ID NO:2; The sources of the UGT gene include: Any one of Triticum aestivum, Miscanthuslutarioriparius, Gossypium trilobum, Ziziphus jujuba, and Hordeum vulgare.
2. The application of the recombinant strain as described in claim 1 in the preparation of rhodioloside.
3. A method for preparing rhodioloside, characterized in that, Using sugarcane molasses as a carbon source, the recombinant strain as described in claim 1 was cultured and fermented to obtain the rhodioloside.
Citation Information
Patent Citations
Escherichia coli expression strain for high production of tyrosol and / or salidroside and icarisid D2 and application of escherichia coli expression strain
CN104946575A
Strain for synthesizing salidroside through efficient biotransformation and application of strain
CN115960811A